Darwin & Natural Selection. Adapted from Mr. Gray & Bristol University

Size: px
Start display at page:

Download "Darwin & Natural Selection. Adapted from Mr. Gray & Bristol University"

Transcription

1 Darwin & Natural Selection Adapted from Mr. Gray & Bristol University

2 Basic Scientific Terms Review Hypothesis: is an educated guess, based on observations. It's a prediction of cause and effect. Theory: Summarizes a hypothesis/hypotheses Supported with repeated testing Valid as long as there is no evidence to dispute it Explains how and why something happens Example: Theory of Plate Tectonics Law: Generalizes a LOT of observations Tells you what IS going to happen Example: Law of Gravitation

3 Directions Manager: read? s 1. Can a theory become a law? Explain. 2. What s wrong with this statement I have a theory that students get more write ups after the holidays.

4 Evolution Evolution: The process of change over time; one species gives rise to another & tree grows! All living things share a common ancestor. We can draw a family tree of life to show how every species is related.

5 Learning Manager read? Besides cell phones, what other non-biological items have evolved?

6 Charles Darwin Father of Evolution Proposed the theory of evolution, change over time Made observations on a 5-year trip around the world on the ship the HMS Beagle Wrote a book Origin of the Species that documented his observations Survival of the Fittest idea came from this book

7

8 Darwin s Finches

9 Check out their feet!!!

10

11 On Task Manager read? Charles Darwin noticed all the different looks of the same species. How might different looks affect whether a species goes extinct?

12 Natural Selection Natural Selection: Organisms that are best adapted to an environment survive and reproduce more than others

13 How Natural Selection Occurs 4 Ways Overproduction Variation Competition Selection

14 Overproduction Each species produces more offspring that can survive

15 Variation Each individual has a unique combination of inherited traits (DNA) Adaptation: an inherited trait that increases an organism s chances of survival Environments can change which can change the success of an adaptation Same Parents

16 Adaptation Categories Camouflage (Blend in and hide) Mimicry (Act and look like) Physiological (Poison) Behavioral (Group behavior) Remember the organism doesn t CHOOSE the adaptation! They are born with it or the environment is more supporting of it!

17

18 Coral Snake (Poisonous) Milk Snake (Not poisonous)

19

20

21

22

23

24

25 Stick Mantid

26 Flower Mantid

27 What adaptations do you see?

28 What adaptations do you see?

29 Variation The more variation within a species, the more likely they are to survive The more variation of types of species in a habitat, the more likely at least some will survive

30

31 Which community has a better chance of surviving a natural disaster? Community A Community B

32 Competition Individuals COMPETE for food, water, space, etc. Survival of the Fittest the fittest is most able to survive and reproduce Not all individuals survive to adulthood

33 Selection Best adaptations will survive and be able to pass on their traits to their kids Genotype: your genes/dna Ex: Cat s ear shape Phenotype: your physical appearance that is influenced by your genes and the environment The color of the flamingo is based on what they eat (environment)

34 Materials Manager read? s What are the 4 methods of natural selection? Which method in your opinion affects humans most?

35 How It Works Individuals with traits that are not well suited to their environment either die or leave few offspring. Evolution occurs when good traits build up in a population over many generations and bad traits are eliminated by the death of the individuals.

36 50 Million Years Ago

37

38

39 Today

40

41 Directions Manager read? Summarize how giraffes evolved.

42 Peppered Moth A Which moth will the bird catch? B

43 Evidence for Evolution: Fossil Record Homologous Body Structures Vestigial Organs Embryology Biochemical Evidence

44 Fossil Record Fossils provide a record of the history of life on Earth

45 Progression of Organisms World Health Org. en.wikipedia.org/wiki/image:eopraptor_sketch5.png NASA origins bacteria complex cells dinosaurs humans The fossil record shows a sequence from simple bacteria to more complex organisms through time and provides the most compelling evidence for evolution.

46 Transitional Fossils Ex. Archaeopteryx Missing link between reptiles and birds

47 Geologic Separation

48 Homologous Body Structures Body parts that are similar in different species Related organisms have similar body structures

49

50 Humans and Gorillas Bone Structure

51 Vestigial Organs Leftover organs (traces of evolution) that serve no purpose currently (did in the past) Examples appendix, tonsils, tailbone, wisdom teeth

52 Embryology Embryos of all vertebrates are very similar early on yes you had gills!

53 The Pharyngeal Pouches will shape parts of the pharynx and upper bronchial segments

54 Biochemistry DNA with more similar sequences suggest species are more closely related Humans and chimpanzees share > 98% of identical DNA sequences HUMAN CHIMPANZEE GORILLA CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCATGACTGTTGAACGA CCAAGGTCACAACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA Genetic code of chimps and gorillas is almost identical to humans

55 Directions Manager read? What are the 5 types of evidence used for evolution? What is your opinion about evolution?

56 Thinking outside biology/species how might the quote above affect you in everyday/real life?

57 Supporting Resources Must Watch Fantastic Review Simpson Evolution

Theory of Evolution. Evolution The process of change over time. Specifically, a change in the frequency of a gene or allele in a population over time

Theory of Evolution. Evolution The process of change over time. Specifically, a change in the frequency of a gene or allele in a population over time Theory of Evolution Learning Goals Define "Evolution" & "Natural Selection". Describe the 4 steps of Natural Selection, giving an example of each. Explain the importance of "Variation". Does Natural Selection

More information

DUE TODAY DUE TODAY. HOMEWORK: Student Weekly Grade Tracking #25. CLASSWORK: Blood Typing Lab Ernie s Exit (Turn in) Admit Ticket

DUE TODAY DUE TODAY. HOMEWORK: Student Weekly Grade Tracking #25. CLASSWORK: Blood Typing Lab Ernie s Exit (Turn in) Admit Ticket Admit Ticket WOR KS HEE T Read Blood Types Sheet Complete Blood Type Worksheets DUE TODAY DUE TODAY HOMEWORK: Student Weekly Grade Tracking #25 CLASSWORK: Blood Typing Lab Ernie s Exit (Turn in) http://www.powerpointhintergrund.com/uploads/new-year-ppt-background-8.jpg

More information

Darwin s theory of evolution by natural selection

Darwin s theory of evolution by natural selection Percorso interdisciplinare di avviamento al CLIL Darwin s theory of evolution by natural selection CLASSE 5^B Prof. A. Le Piane Prof. F. Minissale Theory of Evolution Evolution: the process of change over

More information

Darwin s Theory of Evolution

Darwin s Theory of Evolution EVOLUTION Darwin s Theory of Evolution n Evolution, or change over time, is the process by which modern organisms have descended from ancient organisms. n A scientific theory is a well-supported testable

More information

Evolution: change in the hereditary

Evolution: change in the hereditary Mechanisms of Evolution Evolution: change in the hereditary features of species over time. Species: a group of organisms that successfully reproduce among themselves. There are two kinds of evolution:

More information

What is Evolution? Evolution Unit Vocabulary. Answer: Evidence of Evolution. What is a Gene Pool? Change over time.

What is Evolution? Evolution Unit Vocabulary. Answer: Evidence of Evolution. What is a Gene Pool? Change over time. What is Evolution? Evolution Unit Vocabulary Practice Quiz Change over time. Evidence of Evolution The gradual development of something, especially from simple to more complex. Can be big or very small

More information

Introduction to Evolution

Introduction to Evolution Introduction to Evolution What is evolution? A basic definition of evolution evolution can be precisely defined as any change in the frequency of alleles within a gene pool from one generation to the

More information

Darwin s Theory of Natural Selection

Darwin s Theory of Natural Selection Darwin s Theory of Natural Selection Question: Has Life Ever Changed? In 1700 s, scientists examined fossils that showed how extinct species look very different than they do today. Scientists began to

More information

Evolution. Formation of EARTH. First cells by endosymbiosis. The Scientists. Lamarck Darwin. Change Over Time

Evolution. Formation of EARTH. First cells by endosymbiosis. The Scientists. Lamarck Darwin. Change Over Time Evolution Change Over Time Evolution Definition: A change in a population of a species over time Organisms evolve to adapt better to their environment According to Evolution, all living things (organisms)

More information

What is Evolution? Study of how things change over time

What is Evolution? Study of how things change over time 10.2 15 Darwin s Theory Observations of Evolution What is Evolution? Study of how things change over time 10.2 15 Darwin s Theory Observations of Evolution Theories of Evolution - Lamarck Jean Baptiste

More information

History of Biological Diversity. Evolution: Darwin s travel

History of Biological Diversity. Evolution: Darwin s travel History of Biological Diversity Evolution: Darwin s travel Developing the Theory of Evolution The Galápagos Islands Darwin noticed that the different islands all seemed to have their own, slightly different

More information

THE THEORY OF EVOLUTION

THE THEORY OF EVOLUTION THE THEORY OF EVOLUTION Name: Period: Date: I. Evolution- A brief overview EVOLUTION IS: 1. 2. Descent with modifications 3. Plants and animals of today are forms of plants and animals of the past 4. Organisms

More information

EVOLUTION No matter what your beliefs are, it is always better to have as much information as you can so that you can form your own, educated opinion!

EVOLUTION No matter what your beliefs are, it is always better to have as much information as you can so that you can form your own, educated opinion! EVOLUTION No matter what your beliefs are, it is always better to have as much information as you can so that you can form your own, educated opinion! Standards SB5. Students will evaluate the role of

More information

#Evolution. Nothing in Biology makes sense except in the light of evolution.

#Evolution. Nothing in Biology makes sense except in the light of evolution. #Evolution Nothing in Biology makes sense except in the light of evolution. The Theory of Evolution Change over time. People used to think that species did not change. DARWIN WAS NOT THE PERSON TO COME

More information

Evolution. Species Changing over time

Evolution. Species Changing over time Evolution Species Changing over time Objectives I can differentiate between natural selection and artificial selection and I can give examples of each. I can explain several reasons for genetic variation

More information

ADAPTATIONS. Characteristics that give an organism a better chance of survival.

ADAPTATIONS. Characteristics that give an organism a better chance of survival. ADAPTATIONS Characteristics that give an organism a better chance of survival. Special traits that help living organisms survive in a particular environment. Ex: Polar bear s thick white fur keeps him

More information

REVIEW 6: EVOLUTION. 1. Define evolution: Was not the first to think of evolution, but he did figure out how it works (mostly).

REVIEW 6: EVOLUTION. 1. Define evolution: Was not the first to think of evolution, but he did figure out how it works (mostly). Name: REVIEW 6: EVOLUTION 1. Define evolution: 2. Modern Theory of Evolution: a. Charles Darwin: Was not the first to think of evolution, but he did figure out how it works (mostly). However, Darwin didn

More information

Evolution. Evolutionary Thought / Evidence. Video clip: Is evolution a theory? (mousetrap DVD)

Evolution. Evolutionary Thought / Evidence. Video clip: Is evolution a theory? (mousetrap DVD) Evolution Evolutionary Thought / Evidence Video clip: Is evolution a theory? (mousetrap DVD) Theories of Evolution Evolution - an orderly succession of changes Biological evolution - the change of populations

More information

Unit 8: EVOLUTION NOTES

Unit 8: EVOLUTION NOTES Unit 8: EVOLUTION NOTES Canale LE EVOLUTION is the change in gene frequency in a population over time. Generally, organisms change from simple to more complex, and happens over many generations. **Evolution

More information

Evolution. Darwin s Voyage

Evolution. Darwin s Voyage Evolution Darwin s Voyage Charles Darwin Explorer on an observation trip to the Galapagos Islands. He set sail on the HMS Beagle in 1858 from England on a 5 year trip. He was a naturalist (a person who

More information

Theory of Evolution. Mr. Rafferty 5-19

Theory of Evolution. Mr. Rafferty 5-19 Theory of Evolution Mr. Rafferty 5-19 Theories of Evolution Theories of Evolution attempt to explain how the similarities and differences among species came about. Early theories stated that new species

More information

Change Over Time Concept Map

Change Over Time Concept Map Change Over Time Concept Map Darwin reasoned that plants or animals that arrived on the Galapagos Islands faced conditions that were different from those on the mainland. Perhaps, Darwin hypothesized,

More information

UNIT 4: EVOLUTION Chapter 10: Principles of Evolution. I. Early Ideas about Evolution (10.1) A. Early scientists proposed ideas about evolution

UNIT 4: EVOLUTION Chapter 10: Principles of Evolution. I. Early Ideas about Evolution (10.1) A. Early scientists proposed ideas about evolution UNIT IV Chapter 10 Principles of Evolution UNIT 4: EVOLUTION Chapter 10: Principles of Evolution I. Early Ideas about Evolution (10.1) A. Early scientists proposed ideas about evolution 1. Evolution- process

More information

Charles Darwin and Evolution

Charles Darwin and Evolution Charles Darwin and Evolution from so simple a beginning, endless forms most beautiful and most wonderful have been, and are being, evolved. On the Origin of Species I. Darwin s Travels 1. In 1831, Charles

More information

Biology Chapter 15 Evolution Notes

Biology Chapter 15 Evolution Notes Biology Chapter 15 Evolution Notes Section 1: Darwin's Theory of Evolution by Natural Selection Charles Darwin- English naturalist that studied animals over a number of years before developing the theory

More information

Lesson 1 Syllabus Reference

Lesson 1 Syllabus Reference Lesson 1 Syllabus Reference Outcomes A student Explains how biological understanding has advanced through scientific discoveries, technological developments and the needs of society. Content The theory

More information

Natural Selection. Charles Darwin & Alfred Russell Wallace

Natural Selection. Charles Darwin & Alfred Russell Wallace Natural Selection Charles Darwin & Alfred Russell Wallace Darwin s Influences Darwin observed such variations in species on his voyage as a naturalist on the HMS Beagle Darwin s Influences Kept vast diaries

More information

Multiple lines of evidence support the theory of evolution.

Multiple lines of evidence support the theory of evolution. Section 2: Multiple lines of evidence support the theory of evolution. K What I Know W What I Want to Find Out L What I Learned Essential Questions How do fossils provide evidence of evolution? How does

More information

Chapter 16. Darwin s Theory Of Evolution

Chapter 16. Darwin s Theory Of Evolution Chapter 16 Darwin s Theory Of Evolution 16-1 I. Evolution A. process by which modern organisms have descended from ancient organisms (change over time) II. Charles Darwin A. Sailed around the world on

More information

Refer to chapter 16 in your textbook

Refer to chapter 16 in your textbook Refer to chapter 16 in your textbook Learning Goals: 1. Explain how the 6 pieces of evidence support the theory of evolution. 2. Describe the conditions under which natural selection occurs. Evidence of

More information

Biology. Slide 1 of 41. End Show. Copyright Pearson Prentice Hall

Biology. Slide 1 of 41. End Show. Copyright Pearson Prentice Hall Biology 1 of 41 Do Now: Why do the colors of moths change over time? Write a detailed explanation on the scrap paper provided. 2 of 41 Why do the colors of moths change over time? 3 of 41 4 of 41 Evolution

More information

Vocab Darwin & Evolution (Chap 15)

Vocab Darwin & Evolution (Chap 15) Vocab Darwin & Evolution (Chap 15) 1. Evolution 2. Theory 3. Charles Darwin 4. Fossil 5. Species 6. Natural variation 7. Artificial selection 8. Struggle for existence 9. Fitness 10.Adaptation 11.Survival

More information

natural selection evolution

natural selection evolution Honors Biology Bellringer: signintoaclicker! natural selection evolution Standard: Students will evaluate the role of natural selection in the development of the theory of evolution. Element: a. Trace

More information

Biology. Evolution: History & Process

Biology. Evolution: History & Process Biology Evolution: History & Process Terms: A species is a group of organisms, or population, that can be interbreed & produce fertile offspring. Variations are the differences found within species. Ex:

More information

EVOLUTION BY NATURAL SELECTION. This presentation contains copyrighted material under the educational fair use exemption to the U.S. copyright law.

EVOLUTION BY NATURAL SELECTION. This presentation contains copyrighted material under the educational fair use exemption to the U.S. copyright law. EVOLUTION BY NATURAL SELECTION This presentation contains copyrighted material under the educational fair use exemption to the U.S. copyright law. Ancient ideas of evolution! Plato! Every organism was

More information

2/17/17. B. Four scientists important in development of evolution theory

2/17/17. B. Four scientists important in development of evolution theory UNIT 4: EVOLUTION Chapter 10: Principles of Evolution I. Early Ideas about Evolution (10.1) A. Early scientists proposed ideas about evolution 1. Evolution- process of biological change by which descendants

More information

Theory a well supported testable explanation of phenomenon occurring in the natural world.

Theory a well supported testable explanation of phenomenon occurring in the natural world. Evolution Theory of Evolution Theory a well supported testable explanation of phenomenon occurring in the natural world. Evolution the process by which modern organisms changed over time from ancient common

More information

Evolution. Species Changing over time

Evolution. Species Changing over time Evolution Species Changing over time Charles Darwin Evolution by Means of Natural Selection Reasons for Change Mutation A mutation could cause parents with genes for bright green coloration to have offspring

More information

EVOLUTION. Charles Darwin

EVOLUTION. Charles Darwin EVOLUTION Charles Darwin Question for Thought Earth has millions of other kinds of organisms of every imaginable shape, size, and habitat. This variety of living things is called biological diversity.

More information

Quazi accurate photo history

Quazi accurate photo history Quazi accurate photo history Evolution- change over time Fossils preserved remains Geologic Time earth s history The evidence shows changes in environment changes in species The Theory of Evolution supported

More information

DO NOW. Each PAIR should take one white cloth and one cup of beans from the back desk. Make sure you have 20 white beans and 20 brown beans.

DO NOW. Each PAIR should take one white cloth and one cup of beans from the back desk. Make sure you have 20 white beans and 20 brown beans. DO NOW Each PAIR should take one white cloth and one cup of beans from the back desk. Make sure you have 20 white beans and 20 brown beans. Class Results Number of Brown Beans Picked Number of White Beans

More information

Chapter 15 Darwin s Theory of Evolution. Essential Question: What evidence did Darwin use to develop his theory of evolution?

Chapter 15 Darwin s Theory of Evolution. Essential Question: What evidence did Darwin use to develop his theory of evolution? Chapter 15 Darwin s Theory of Evolution Essential Question: What evidence did Darwin use to develop his theory of evolution? 15-1 The Puzzle of Life s Diversity How did life change from a prokaryote to

More information

Evolution. Chapters 16 & 17

Evolution. Chapters 16 & 17 Evolution Chapters 16 & 17 Darwin s Voyage Chapter 16 Change over time Evolution Charles Darwin Developed a scientific theory that explains how modern organisms evolved over long periods of time through

More information

#Evolution. Nothing in Biology makes sense except in the light of evolution.

#Evolution. Nothing in Biology makes sense except in the light of evolution. #Evolution Nothing in Biology makes sense except in the light of evolution. The Theory of Evolution Change over time. People used to think that species did not change. DARWIN WAS NOT THE PERSON TO COME

More information

THE THEORY OF EVOLUTION

THE THEORY OF EVOLUTION THE THEORY OF EVOLUTION Why evolution matters Theory: A well-substantiated explanation of some aspect of the natural world, based on a body of facts that have been repeatedly confirmed through observation

More information

15.2 Evidence of Evolution

15.2 Evidence of Evolution 15.2 Evidence of Evolution I. Support for Evolution - theory of evolution states that all organisms on Earth have descended from a common ancestor a. The fossil record i. Fossils provide evidence of evolution

More information

Change Over Time. Evidence for evolution

Change Over Time. Evidence for evolution Change Over Time Evidence for evolution 1. Fossils 2. Geographic Distribution of Living Things 3. Structural Adaptations 4. Physiological Adaptations 5. Anatomy 6. Biochemistry 1. Fossils In biological

More information

Are individuals in a population of a species the same?

Are individuals in a population of a species the same? LEARNING OUTCOMES Define the term variation. Discuss the fact that variation occurs within, as well as between, species. Describe the differences between continuous and discontinuous variation, using examples

More information

Evidence of EVOLUTION

Evidence of EVOLUTION Evidence of EVOLUTION Evolution: Genetic change in a population through time Charles Darwin On his journey around the world, Darwin found evidence of GRADUAL CHANGE (evolution) He cited evidences he found

More information

15.3 Darwin Presents his Case. Biology Mr. Hines

15.3 Darwin Presents his Case. Biology Mr. Hines 15.3 Darwin Presents his Case Biology Mr. Hines Darwin returned to England with a wealth of new data. He brought many specimens from the Galapagos to further his studies and to present his data to others.

More information

Ch. 15: Evolution - change in a species or the formation of new species over time

Ch. 15: Evolution - change in a species or the formation of new species over time Ch. 15: Evolution - change in a species or the formation of new species over time 15.1 Darwin Early Beliefs All species permanent and unchanging Earth only a few thousand years old religion Beliefs based

More information

Chapter 15 Open Note Quiz Concepts 2 nd Period

Chapter 15 Open Note Quiz Concepts 2 nd Period Chapter 15 Open Note Quiz Concepts 2 nd Period 1.) Please describe the difference between a homologous structure and an analogous structure. Homologous Structure = Same bone structure, different function

More information

Darwin s Conclusions. The Theory of Evolution

Darwin s Conclusions. The Theory of Evolution The Theory of Evolution More Evidence for Evolution Notes Pt. 3 Darwin s Conclusions 1. Many traits are heritable 2. Mutations result in variation populations have individuals with many different traits

More information

#Evolution. Nothing in Biology makes sense except in the light of evolution.

#Evolution. Nothing in Biology makes sense except in the light of evolution. Wednesday 1/24/18 Pick up your assignment in the tray. Turn in your BEAD lab from Monday! Due first minute of class or it s late. Turn in homework if you didn t finish your work in class yesterday! Due

More information

Theory of Evolution. Chapter 15

Theory of Evolution. Chapter 15 Theory of Evolution Chapter 15 The History of Evolutionary Thought Evolution The development of new types of organisms from preexisting types of organisms over time. Also could be described as a heritable

More information

7.1 What is the Theory of Evolution?

7.1 What is the Theory of Evolution? Evolution 7.1 What is the Theory of Evolution? SCIENTIFIC THEORY: a well-tested scientific explanation that no evidence contradicts Theories explain the basic ideas of science. If scientists find new evidence

More information

Evidence for Evolution

Evidence for Evolution Evidence for Evolution Evolution Biological evolution is descent with modification. It is important to remember that: Humans did not evolve from chimpanzees. Humans and chimpanzees are evolutionary cousins

More information

Natural Selection. Factors for Natural Selection: 1. Variation 2. Heritability 3. Overproduction (Overpopulation) 4. Reproductive Advantage

Natural Selection. Factors for Natural Selection: 1. Variation 2. Heritability 3. Overproduction (Overpopulation) 4. Reproductive Advantage Natural Selection Variation: Heritability: Overproduction: Reproductive Advantage Driven by Environment Factors for Natural Selection: 1. Variation 2. Heritability 3. Overproduction (Overpopulation) 4.

More information

Regents Biology REVIEW 6: EVOLUTION. 1. Define evolution:

Regents Biology REVIEW 6: EVOLUTION. 1. Define evolution: Period Date REVIEW 6: EVOLUTION 1. Define evolution: 2. Modern Theory of Evolution: a. Charles Darwin: Was not the first to think of evolution, but he did figure out how it works (mostly). However, Darwin

More information

GAUTENG DEPARTMENT OF EDUCATION SENIOR SECONDARY INTERVENTION PROGRAMME LIFE SCIENCES GRADE 12 SESSION 4 (LEARNER NOTES)

GAUTENG DEPARTMENT OF EDUCATION SENIOR SECONDARY INTERVENTION PROGRAMME LIFE SCIENCES GRADE 12 SESSION 4 (LEARNER NOTES) TOPIC 2: THEORIES OF EVOLUTION (PART 1) Learner Note: Evolution is a theory. Evolution is change over time. Diversity is the RESULT of this change over time. If a trait is good, the organism survives and

More information

EVOLUTION change in populations over time

EVOLUTION change in populations over time EVOLUTION change in populations over time HISTORY ideas that shaped the current theory James Hutton (1785) proposes that Earth is shaped by geological forces that took place over extremely long periods

More information

Study guide for test on end of chapter 2 and beginning of chapter 3

Study guide for test on end of chapter 2 and beginning of chapter 3 Study guide for test on end of chapter 2 and beginning of chapter 3 Chapter 2 questions: You should review: 1. 2 sets of notes: Evidence for Evolution (be able to name 3 of the 5) and What can affect evolution

More information

15 Darwin's Theory of Natural Selection 15-1 The Puzzle of Life's Diversity

15 Darwin's Theory of Natural Selection 15-1 The Puzzle of Life's Diversity 15-1 The Puzzle of Life's Diversity Study the photo of leaves... What else do you see? How did the Leaf Mantis come to look like decaying leaves? Define evolution in its simplest meaning? Review the meaning

More information

Chapter 10 Study Guide SECTION 1: Early Ideas about Evolution

Chapter 10 Study Guide SECTION 1: Early Ideas about Evolution NAME Chapter 10 Study Guide SECTION 1: Early Ideas about Evolution BIOLOGY PREAP/GT Match each scientist with the statement that best reflects his ideas about evolutionary theory. 1. Linnaeus a. Species

More information

Evidences of Evolution

Evidences of Evolution Evidences of Evolution Darwin stated that all organisms descend from a common ancestor Darwin based his theory of Natural Selection on observations of: Traits, geographical distribution, selective breeding,

More information

Boardworks Ltd The first wellknown. evolution:

Boardworks Ltd The first wellknown. evolution: 1 of 7 2 of 7 The first wellknown theory of evolution: 3 of 7 Lamarck s theory of evolution: The Theory of Use/Disuse and Acquired Traits Jean-Baptiste Lamarck (1744-1829) was a French botanist who believed

More information

EVOLUTION. HISTORY: Ideas that shaped the current evolutionary theory. Evolution change in populations over time.

EVOLUTION. HISTORY: Ideas that shaped the current evolutionary theory. Evolution change in populations over time. EVOLUTION HISTORY: Ideas that shaped the current evolutionary theory. Evolution change in populations over time. James Hutton & Charles Lyell proposes that Earth is shaped by geological forces that took

More information

Natural Selection Study Guide Answer Key

Natural Selection Study Guide Answer Key Natural Selection Study Guide Answer Key 1. This evidence comes out of the Earth's crust. It is the timeline of past life, organized by estimated ages and classified by similarities in form. What is it?

More information

Station 1. What is Evolution? What causes Evolution? A primary example of Evolution, is different bird beak sizes. What caused this to occur?

Station 1. What is Evolution? What causes Evolution? A primary example of Evolution, is different bird beak sizes. What caused this to occur? Station 1 What is Evolution? What causes Evolution? A primary example of Evolution, is different bird beak sizes. What caused this to occur? Station 2 What is Survival of the Fittest? How is fitness measured?

More information

4. Identify one bird that would most likely compete for food with the large tree finch. Support your answer. [1]

4. Identify one bird that would most likely compete for food with the large tree finch. Support your answer. [1] Name: Topic 5B 1. A hawk has a genetic trait that gives it much better eyesight than other hawks of the same species in the same area. Explain how this could lead to evolutionary change within this species

More information

Evidence for EVOLUTION

Evidence for EVOLUTION Evidence for EVOLUTION Fossils A fossil is the naturally preserved remains or traces of animals or plants that lived in the geologic past. There are two main types of fossils; body and trace. Body fossils

More information

Biology Slide 1 of 41

Biology Slide 1 of 41 Biology 1 of 41 15-3 Darwin Presents His Case 2 of 41 15-3 Darwin Presents His Case Publication of On the Origin of Species Publication of On the Origin of Species Darwin filled notebooks with his ideas

More information

Biology. Slide 1 of 41. End Show. Copyright Pearson Prentice Hall

Biology. Slide 1 of 41. End Show. Copyright Pearson Prentice Hall Biology 1 of 41 15-3 Darwin Presents His Case 2 of 41 Publication of On the Origin of Species Publication of On the Origin of Species Darwin filled notebooks with his ideas about species diversity and

More information

Publication of On the Origin of Species Darwin Presents His Case

Publication of On the Origin of Species Darwin Presents His Case Publication of On the Origin of Species Publication of On the Origin of Species Darwin filled notebooks with his ideas about species diversity and the evolution process. Darwin was stunned and disturbed

More information

Evolution. Darwin s Journey and Observations

Evolution. Darwin s Journey and Observations Evolution Darwin s Journey and Observations Who was Charles Darwin? English naturalist Took a 5 year voyage on the HMS Beagle Voyage s intent was to explore the coast of South America Darwin took many

More information

Heritability: Natural Selection: Overproduction:

Heritability: Natural Selection: Overproduction: Name: _ Due Date: _ Per: _ Unit 4.1 Study Guide Directions: Complete all sections to the best of your ability. On the day of the Quiz (the due date for this assignment) turn this in with all of your Unit

More information

HBio Evolution Practice Test 1

HBio Evolution Practice Test 1 HBio Evolution Practice Test 1 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Which of the following are examples of fossils? a. shells or old bones b.

More information

Write 2 facts from the following slides. OR If there are questions on the slides answer the questions.

Write 2 facts from the following slides. OR If there are questions on the slides answer the questions. Evolution Test 8.LS4.4) Develop a scientific explanation of how natural selection plays a role in determining the survival of a species in a changing environment. 8.LS4.3) Analyze evidence from geology,

More information

Evolution. Just a few points

Evolution. Just a few points Evolution Just a few points Just What is a Species??? Species: a group of organisms that share similar characteristics can interbreed with one another produce fertile offspring Population: One species

More information

STRUGGLE FOR EXISTENCE

STRUGGLE FOR EXISTENCE NATURAL SELECTION STRUGGLE FOR EXISTENCE If more individuals are produced than can survive à members of a population must compete to obtain food, living space, and other limited necessities of life Called:

More information

Happy Mon./Tues.! 2/24 & 2/25 Bell Work Today Answer questions 7-10 from Analyzing Aminoacid Sequences p. 47 in notebook

Happy Mon./Tues.! 2/24 & 2/25 Bell Work Today Answer questions 7-10 from Analyzing Aminoacid Sequences p. 47 in notebook Happy Mon./Tues.! 2/24 & 2/25 Bell Work Today Answer questions 7-10 from Analyzing Aminoacid Sequences p. 47 in notebook Today in class: Transformation Video & Questions (turn in at the end of class) All

More information

AGENDA Go Over DUT; offer REDO opportunity Notes on Intro to Evolution Cartoon Activity

AGENDA Go Over DUT; offer REDO opportunity Notes on Intro to Evolution Cartoon Activity Date: Number your notebook and label the top the following: EVEN Pages-LEFT SIDE Page 176- Concept Map Page 178- Sequence Page 180- Vocabulary Page 182- Warm Ups Page 184- Cartoon Questions HN- Natural

More information

MAIN IDEA: Early scientists proposed ideas about evolution. In a phrase, tell what each scientist did to help develop evolutionary theory.

MAIN IDEA: Early scientists proposed ideas about evolution. In a phrase, tell what each scientist did to help develop evolutionary theory. SECTION 10.1 KEY CONCEPT EARLY IDEAS ABOUT EVOLUTION Study Guide There were theories of biological and geologic change before Darwin. VOCABULARY evolution fossil gradualism species catastrophism uniformitarianism

More information

Ecology Notes Part 1. Abiotic NONliving components in an ecosystem. Ecosystem

Ecology Notes Part 1. Abiotic NONliving components in an ecosystem. Ecosystem Ecology Notes Part 1 Ecology the study of the relationship between organisms and their environment Ecosystem an organism s surroundings consisting of both living and nonliving things and how that organism

More information

CH_15_Evolution.notebook. February 28, Cellular Evolution. Jean Baptiste de Lamarck. Endosymbiont Theory. Charles Darwin

CH_15_Evolution.notebook. February 28, Cellular Evolution. Jean Baptiste de Lamarck. Endosymbiont Theory. Charles Darwin Cellular Evolution The first cells were prokaryotic They did not need oxygen (the atmosphere did not contain oxygen until 1.8 billion years ago) Eukaryotic cells were found in the fossil record about 2

More information

Unsaved Test, Version: 1 1

Unsaved Test, Version: 1 1 Name: Key Concepts Select the term or terms that best complete the statement. A. algae and bacteria B. Cretaceous Extinction C. fossil record D. mass extinction E. multicellular organism F. Permian Extinction

More information

Chapter 16: Evolutionary Theory

Chapter 16: Evolutionary Theory Chapter 16: Evolutionary Theory Section 1: Developing a Theory Evolution: Artificial Selection: Evolution: I. A Theory to Explain Change Over Time B. Charles Darwin C. Theory: D. Modern evolutionary theory

More information

Biology 2017 Mr. Johnson

Biology 2017 Mr. Johnson Class Notes For EVOLUTION Biology 2017 Mr. Johnson Evolution genetic change over time *Theory = explanation based on much evidence (do not confuse with hypothesis ) *Not goal-oriented (can change and

More information

15-3 Darwin Presents His Case Slide 2 of 41

15-3 Darwin Presents His Case Slide 2 of 41 15-3 Darwin Presents His Case 2 of 41 Publication of On the Origin of Species Publication of On the Origin of Species Darwin filled notebooks with his ideas about species diversity and the evolution process.

More information

Which concept would be correctly placed in box X? A) use and disuse B) variation C) changes in nucleic acids D) transmission of acquired traits

Which concept would be correctly placed in box X? A) use and disuse B) variation C) changes in nucleic acids D) transmission of acquired traits 1. Base your answer to the following question on Some of the concepts included in Darwin's theory of natural selection are represented in the diagram below. Which concept would be correctly placed in box

More information

THE THEORY OF EVOLUTION. Darwin, the people who contributed to his ideas, and what it all really means.

THE THEORY OF EVOLUTION. Darwin, the people who contributed to his ideas, and what it all really means. THE THEORY OF EVOLUTION Darwin, the people who contributed to his ideas, and what it all really means. DARWIN S JOURNEY Charles Darwin was born in England on February 12, 1809. Geologists were suggesting

More information

Darwin s Observations & Conclusions The Struggle for Existence

Darwin s Observations & Conclusions The Struggle for Existence Darwin s Observations & Conclusions The Struggle for Existence 1 Voyage of the Beagle During His Travels, Darwin Made Numerous Observations And Collected Evidence That Led Him To Propose A Revolutionary

More information

Evolution Test Review

Evolution Test Review Name Evolution Test Review Period 1) A group of interbreeding organisms (a species) living in a given area is called population 2) Give an example of a species. Ex. One wolf Give an example of a population.

More information

b. In Table 1 (question #2 on the Answer Sheet describe the function of each set of bones and answer the question.)

b. In Table 1 (question #2 on the Answer Sheet describe the function of each set of bones and answer the question.) Biology EVIDENCE OF EVOLUTION INTRODUCTION: Evidence has been found to indicate that living things have changed gradually during their natural history. The study of fossils as well as embryology, biochemistry,

More information

THE HISTORY OF THE THEORY. Darwin presented that happens and offered an of how it happens. Theory a broad that has been and

THE HISTORY OF THE THEORY. Darwin presented that happens and offered an of how it happens. Theory a broad that has been and Evolution Notes THE HISTORY OF THE THEORY Why is the evolutionary theory associated with Charles Darwin? Darwin presented that happens and offered an of how it happens. o Evolution the process by which

More information

The slow, gradual change in a population of organisms over time

The slow, gradual change in a population of organisms over time The slow, gradual change in a population of organisms over time SB5. Students will evaluate the role of natural selection in the development of the theory of evolution. acquired characteristics inherited

More information

Final Revision G8 Biology ( ) Multiple Choice Identify the choice that best completes the statement or answers the question.

Final Revision G8 Biology ( ) Multiple Choice Identify the choice that best completes the statement or answers the question. Final Revision G8 Biology ( 2017-2018 ) Multiple Choice Identify the choice that best completes the statement or answers the question. 1 A species is a group of similar organisms that A can mate with each

More information

Guided Notes: Evolution. is the change in traits through generations over! Occurs in, NOT individual organisms

Guided Notes: Evolution. is the change in traits through generations over! Occurs in, NOT individual organisms Guided Notes: Evolution The Theory of Evolution is the change in traits through generations over! Occurs in, NOT individual organisms How Have Organisms Changed? At the time life emerged, the Earth was

More information

Chapter 16.1 Introduction to Evolution and Evidence

Chapter 16.1 Introduction to Evolution and Evidence Chapter 16.1 Introduction to Evolution and Evidence Vocabulary Evolution Artificial Selection Natural Selection Homologous Structures Vestigial Structures Adaptation Variation Key Concepts Who was Darwin

More information

True or False? Lamarck s Theory of Evolution. Jean-Baptiste Pierre Antoine de Monet, Chevalier de Lamarck

True or False? Lamarck s Theory of Evolution. Jean-Baptiste Pierre Antoine de Monet, Chevalier de Lamarck True or False? We know what it is, we ve seen the evidence, but Aim: How does evolution happen? Charles Darwin was the 1 st scientist to offer an explanation for how Evolution happens. Jean-Baptiste Pierre

More information