Darwin & Natural Selection. Adapted from Mr. Gray & Bristol University
|
|
- Warren Chandler
- 5 years ago
- Views:
Transcription
1 Darwin & Natural Selection Adapted from Mr. Gray & Bristol University
2 Basic Scientific Terms Review Hypothesis: is an educated guess, based on observations. It's a prediction of cause and effect. Theory: Summarizes a hypothesis/hypotheses Supported with repeated testing Valid as long as there is no evidence to dispute it Explains how and why something happens Example: Theory of Plate Tectonics Law: Generalizes a LOT of observations Tells you what IS going to happen Example: Law of Gravitation
3 Directions Manager: read? s 1. Can a theory become a law? Explain. 2. What s wrong with this statement I have a theory that students get more write ups after the holidays.
4 Evolution Evolution: The process of change over time; one species gives rise to another & tree grows! All living things share a common ancestor. We can draw a family tree of life to show how every species is related.
5 Learning Manager read? Besides cell phones, what other non-biological items have evolved?
6 Charles Darwin Father of Evolution Proposed the theory of evolution, change over time Made observations on a 5-year trip around the world on the ship the HMS Beagle Wrote a book Origin of the Species that documented his observations Survival of the Fittest idea came from this book
7
8 Darwin s Finches
9 Check out their feet!!!
10
11 On Task Manager read? Charles Darwin noticed all the different looks of the same species. How might different looks affect whether a species goes extinct?
12 Natural Selection Natural Selection: Organisms that are best adapted to an environment survive and reproduce more than others
13 How Natural Selection Occurs 4 Ways Overproduction Variation Competition Selection
14 Overproduction Each species produces more offspring that can survive
15 Variation Each individual has a unique combination of inherited traits (DNA) Adaptation: an inherited trait that increases an organism s chances of survival Environments can change which can change the success of an adaptation Same Parents
16 Adaptation Categories Camouflage (Blend in and hide) Mimicry (Act and look like) Physiological (Poison) Behavioral (Group behavior) Remember the organism doesn t CHOOSE the adaptation! They are born with it or the environment is more supporting of it!
17
18 Coral Snake (Poisonous) Milk Snake (Not poisonous)
19
20
21
22
23
24
25 Stick Mantid
26 Flower Mantid
27 What adaptations do you see?
28 What adaptations do you see?
29 Variation The more variation within a species, the more likely they are to survive The more variation of types of species in a habitat, the more likely at least some will survive
30
31 Which community has a better chance of surviving a natural disaster? Community A Community B
32 Competition Individuals COMPETE for food, water, space, etc. Survival of the Fittest the fittest is most able to survive and reproduce Not all individuals survive to adulthood
33 Selection Best adaptations will survive and be able to pass on their traits to their kids Genotype: your genes/dna Ex: Cat s ear shape Phenotype: your physical appearance that is influenced by your genes and the environment The color of the flamingo is based on what they eat (environment)
34 Materials Manager read? s What are the 4 methods of natural selection? Which method in your opinion affects humans most?
35 How It Works Individuals with traits that are not well suited to their environment either die or leave few offspring. Evolution occurs when good traits build up in a population over many generations and bad traits are eliminated by the death of the individuals.
36 50 Million Years Ago
37
38
39 Today
40
41 Directions Manager read? Summarize how giraffes evolved.
42 Peppered Moth A Which moth will the bird catch? B
43 Evidence for Evolution: Fossil Record Homologous Body Structures Vestigial Organs Embryology Biochemical Evidence
44 Fossil Record Fossils provide a record of the history of life on Earth
45 Progression of Organisms World Health Org. en.wikipedia.org/wiki/image:eopraptor_sketch5.png NASA origins bacteria complex cells dinosaurs humans The fossil record shows a sequence from simple bacteria to more complex organisms through time and provides the most compelling evidence for evolution.
46 Transitional Fossils Ex. Archaeopteryx Missing link between reptiles and birds
47 Geologic Separation
48 Homologous Body Structures Body parts that are similar in different species Related organisms have similar body structures
49
50 Humans and Gorillas Bone Structure
51 Vestigial Organs Leftover organs (traces of evolution) that serve no purpose currently (did in the past) Examples appendix, tonsils, tailbone, wisdom teeth
52 Embryology Embryos of all vertebrates are very similar early on yes you had gills!
53 The Pharyngeal Pouches will shape parts of the pharynx and upper bronchial segments
54 Biochemistry DNA with more similar sequences suggest species are more closely related Humans and chimpanzees share > 98% of identical DNA sequences HUMAN CHIMPANZEE GORILLA CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCATGACTGTTGAACGA CCAAGGTCACAACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA Genetic code of chimps and gorillas is almost identical to humans
55 Directions Manager read? What are the 5 types of evidence used for evolution? What is your opinion about evolution?
56 Thinking outside biology/species how might the quote above affect you in everyday/real life?
57 Supporting Resources Must Watch Fantastic Review Simpson Evolution
Theory of Evolution. Evolution The process of change over time. Specifically, a change in the frequency of a gene or allele in a population over time
Theory of Evolution Learning Goals Define "Evolution" & "Natural Selection". Describe the 4 steps of Natural Selection, giving an example of each. Explain the importance of "Variation". Does Natural Selection
More informationDUE TODAY DUE TODAY. HOMEWORK: Student Weekly Grade Tracking #25. CLASSWORK: Blood Typing Lab Ernie s Exit (Turn in) Admit Ticket
Admit Ticket WOR KS HEE T Read Blood Types Sheet Complete Blood Type Worksheets DUE TODAY DUE TODAY HOMEWORK: Student Weekly Grade Tracking #25 CLASSWORK: Blood Typing Lab Ernie s Exit (Turn in) http://www.powerpointhintergrund.com/uploads/new-year-ppt-background-8.jpg
More informationDarwin s theory of evolution by natural selection
Percorso interdisciplinare di avviamento al CLIL Darwin s theory of evolution by natural selection CLASSE 5^B Prof. A. Le Piane Prof. F. Minissale Theory of Evolution Evolution: the process of change over
More informationDarwin s Theory of Evolution
EVOLUTION Darwin s Theory of Evolution n Evolution, or change over time, is the process by which modern organisms have descended from ancient organisms. n A scientific theory is a well-supported testable
More informationEvolution: change in the hereditary
Mechanisms of Evolution Evolution: change in the hereditary features of species over time. Species: a group of organisms that successfully reproduce among themselves. There are two kinds of evolution:
More informationWhat is Evolution? Evolution Unit Vocabulary. Answer: Evidence of Evolution. What is a Gene Pool? Change over time.
What is Evolution? Evolution Unit Vocabulary Practice Quiz Change over time. Evidence of Evolution The gradual development of something, especially from simple to more complex. Can be big or very small
More informationIntroduction to Evolution
Introduction to Evolution What is evolution? A basic definition of evolution evolution can be precisely defined as any change in the frequency of alleles within a gene pool from one generation to the
More informationDarwin s Theory of Natural Selection
Darwin s Theory of Natural Selection Question: Has Life Ever Changed? In 1700 s, scientists examined fossils that showed how extinct species look very different than they do today. Scientists began to
More informationEvolution. Formation of EARTH. First cells by endosymbiosis. The Scientists. Lamarck Darwin. Change Over Time
Evolution Change Over Time Evolution Definition: A change in a population of a species over time Organisms evolve to adapt better to their environment According to Evolution, all living things (organisms)
More informationWhat is Evolution? Study of how things change over time
10.2 15 Darwin s Theory Observations of Evolution What is Evolution? Study of how things change over time 10.2 15 Darwin s Theory Observations of Evolution Theories of Evolution - Lamarck Jean Baptiste
More informationHistory of Biological Diversity. Evolution: Darwin s travel
History of Biological Diversity Evolution: Darwin s travel Developing the Theory of Evolution The Galápagos Islands Darwin noticed that the different islands all seemed to have their own, slightly different
More informationTHE THEORY OF EVOLUTION
THE THEORY OF EVOLUTION Name: Period: Date: I. Evolution- A brief overview EVOLUTION IS: 1. 2. Descent with modifications 3. Plants and animals of today are forms of plants and animals of the past 4. Organisms
More informationEVOLUTION No matter what your beliefs are, it is always better to have as much information as you can so that you can form your own, educated opinion!
EVOLUTION No matter what your beliefs are, it is always better to have as much information as you can so that you can form your own, educated opinion! Standards SB5. Students will evaluate the role of
More information#Evolution. Nothing in Biology makes sense except in the light of evolution.
#Evolution Nothing in Biology makes sense except in the light of evolution. The Theory of Evolution Change over time. People used to think that species did not change. DARWIN WAS NOT THE PERSON TO COME
More informationEvolution. Species Changing over time
Evolution Species Changing over time Objectives I can differentiate between natural selection and artificial selection and I can give examples of each. I can explain several reasons for genetic variation
More informationADAPTATIONS. Characteristics that give an organism a better chance of survival.
ADAPTATIONS Characteristics that give an organism a better chance of survival. Special traits that help living organisms survive in a particular environment. Ex: Polar bear s thick white fur keeps him
More informationREVIEW 6: EVOLUTION. 1. Define evolution: Was not the first to think of evolution, but he did figure out how it works (mostly).
Name: REVIEW 6: EVOLUTION 1. Define evolution: 2. Modern Theory of Evolution: a. Charles Darwin: Was not the first to think of evolution, but he did figure out how it works (mostly). However, Darwin didn
More informationEvolution. Evolutionary Thought / Evidence. Video clip: Is evolution a theory? (mousetrap DVD)
Evolution Evolutionary Thought / Evidence Video clip: Is evolution a theory? (mousetrap DVD) Theories of Evolution Evolution - an orderly succession of changes Biological evolution - the change of populations
More informationUnit 8: EVOLUTION NOTES
Unit 8: EVOLUTION NOTES Canale LE EVOLUTION is the change in gene frequency in a population over time. Generally, organisms change from simple to more complex, and happens over many generations. **Evolution
More informationEvolution. Darwin s Voyage
Evolution Darwin s Voyage Charles Darwin Explorer on an observation trip to the Galapagos Islands. He set sail on the HMS Beagle in 1858 from England on a 5 year trip. He was a naturalist (a person who
More informationTheory of Evolution. Mr. Rafferty 5-19
Theory of Evolution Mr. Rafferty 5-19 Theories of Evolution Theories of Evolution attempt to explain how the similarities and differences among species came about. Early theories stated that new species
More informationChange Over Time Concept Map
Change Over Time Concept Map Darwin reasoned that plants or animals that arrived on the Galapagos Islands faced conditions that were different from those on the mainland. Perhaps, Darwin hypothesized,
More informationUNIT 4: EVOLUTION Chapter 10: Principles of Evolution. I. Early Ideas about Evolution (10.1) A. Early scientists proposed ideas about evolution
UNIT IV Chapter 10 Principles of Evolution UNIT 4: EVOLUTION Chapter 10: Principles of Evolution I. Early Ideas about Evolution (10.1) A. Early scientists proposed ideas about evolution 1. Evolution- process
More informationCharles Darwin and Evolution
Charles Darwin and Evolution from so simple a beginning, endless forms most beautiful and most wonderful have been, and are being, evolved. On the Origin of Species I. Darwin s Travels 1. In 1831, Charles
More informationBiology Chapter 15 Evolution Notes
Biology Chapter 15 Evolution Notes Section 1: Darwin's Theory of Evolution by Natural Selection Charles Darwin- English naturalist that studied animals over a number of years before developing the theory
More informationLesson 1 Syllabus Reference
Lesson 1 Syllabus Reference Outcomes A student Explains how biological understanding has advanced through scientific discoveries, technological developments and the needs of society. Content The theory
More informationNatural Selection. Charles Darwin & Alfred Russell Wallace
Natural Selection Charles Darwin & Alfred Russell Wallace Darwin s Influences Darwin observed such variations in species on his voyage as a naturalist on the HMS Beagle Darwin s Influences Kept vast diaries
More informationMultiple lines of evidence support the theory of evolution.
Section 2: Multiple lines of evidence support the theory of evolution. K What I Know W What I Want to Find Out L What I Learned Essential Questions How do fossils provide evidence of evolution? How does
More informationChapter 16. Darwin s Theory Of Evolution
Chapter 16 Darwin s Theory Of Evolution 16-1 I. Evolution A. process by which modern organisms have descended from ancient organisms (change over time) II. Charles Darwin A. Sailed around the world on
More informationRefer to chapter 16 in your textbook
Refer to chapter 16 in your textbook Learning Goals: 1. Explain how the 6 pieces of evidence support the theory of evolution. 2. Describe the conditions under which natural selection occurs. Evidence of
More informationBiology. Slide 1 of 41. End Show. Copyright Pearson Prentice Hall
Biology 1 of 41 Do Now: Why do the colors of moths change over time? Write a detailed explanation on the scrap paper provided. 2 of 41 Why do the colors of moths change over time? 3 of 41 4 of 41 Evolution
More informationVocab Darwin & Evolution (Chap 15)
Vocab Darwin & Evolution (Chap 15) 1. Evolution 2. Theory 3. Charles Darwin 4. Fossil 5. Species 6. Natural variation 7. Artificial selection 8. Struggle for existence 9. Fitness 10.Adaptation 11.Survival
More informationnatural selection evolution
Honors Biology Bellringer: signintoaclicker! natural selection evolution Standard: Students will evaluate the role of natural selection in the development of the theory of evolution. Element: a. Trace
More informationBiology. Evolution: History & Process
Biology Evolution: History & Process Terms: A species is a group of organisms, or population, that can be interbreed & produce fertile offspring. Variations are the differences found within species. Ex:
More informationEVOLUTION BY NATURAL SELECTION. This presentation contains copyrighted material under the educational fair use exemption to the U.S. copyright law.
EVOLUTION BY NATURAL SELECTION This presentation contains copyrighted material under the educational fair use exemption to the U.S. copyright law. Ancient ideas of evolution! Plato! Every organism was
More information2/17/17. B. Four scientists important in development of evolution theory
UNIT 4: EVOLUTION Chapter 10: Principles of Evolution I. Early Ideas about Evolution (10.1) A. Early scientists proposed ideas about evolution 1. Evolution- process of biological change by which descendants
More informationTheory a well supported testable explanation of phenomenon occurring in the natural world.
Evolution Theory of Evolution Theory a well supported testable explanation of phenomenon occurring in the natural world. Evolution the process by which modern organisms changed over time from ancient common
More informationEvolution. Species Changing over time
Evolution Species Changing over time Charles Darwin Evolution by Means of Natural Selection Reasons for Change Mutation A mutation could cause parents with genes for bright green coloration to have offspring
More informationEVOLUTION. Charles Darwin
EVOLUTION Charles Darwin Question for Thought Earth has millions of other kinds of organisms of every imaginable shape, size, and habitat. This variety of living things is called biological diversity.
More informationQuazi accurate photo history
Quazi accurate photo history Evolution- change over time Fossils preserved remains Geologic Time earth s history The evidence shows changes in environment changes in species The Theory of Evolution supported
More informationDO NOW. Each PAIR should take one white cloth and one cup of beans from the back desk. Make sure you have 20 white beans and 20 brown beans.
DO NOW Each PAIR should take one white cloth and one cup of beans from the back desk. Make sure you have 20 white beans and 20 brown beans. Class Results Number of Brown Beans Picked Number of White Beans
More informationChapter 15 Darwin s Theory of Evolution. Essential Question: What evidence did Darwin use to develop his theory of evolution?
Chapter 15 Darwin s Theory of Evolution Essential Question: What evidence did Darwin use to develop his theory of evolution? 15-1 The Puzzle of Life s Diversity How did life change from a prokaryote to
More informationEvolution. Chapters 16 & 17
Evolution Chapters 16 & 17 Darwin s Voyage Chapter 16 Change over time Evolution Charles Darwin Developed a scientific theory that explains how modern organisms evolved over long periods of time through
More information#Evolution. Nothing in Biology makes sense except in the light of evolution.
#Evolution Nothing in Biology makes sense except in the light of evolution. The Theory of Evolution Change over time. People used to think that species did not change. DARWIN WAS NOT THE PERSON TO COME
More informationTHE THEORY OF EVOLUTION
THE THEORY OF EVOLUTION Why evolution matters Theory: A well-substantiated explanation of some aspect of the natural world, based on a body of facts that have been repeatedly confirmed through observation
More information15.2 Evidence of Evolution
15.2 Evidence of Evolution I. Support for Evolution - theory of evolution states that all organisms on Earth have descended from a common ancestor a. The fossil record i. Fossils provide evidence of evolution
More informationChange Over Time. Evidence for evolution
Change Over Time Evidence for evolution 1. Fossils 2. Geographic Distribution of Living Things 3. Structural Adaptations 4. Physiological Adaptations 5. Anatomy 6. Biochemistry 1. Fossils In biological
More informationAre individuals in a population of a species the same?
LEARNING OUTCOMES Define the term variation. Discuss the fact that variation occurs within, as well as between, species. Describe the differences between continuous and discontinuous variation, using examples
More informationEvidence of EVOLUTION
Evidence of EVOLUTION Evolution: Genetic change in a population through time Charles Darwin On his journey around the world, Darwin found evidence of GRADUAL CHANGE (evolution) He cited evidences he found
More information15.3 Darwin Presents his Case. Biology Mr. Hines
15.3 Darwin Presents his Case Biology Mr. Hines Darwin returned to England with a wealth of new data. He brought many specimens from the Galapagos to further his studies and to present his data to others.
More informationCh. 15: Evolution - change in a species or the formation of new species over time
Ch. 15: Evolution - change in a species or the formation of new species over time 15.1 Darwin Early Beliefs All species permanent and unchanging Earth only a few thousand years old religion Beliefs based
More informationChapter 15 Open Note Quiz Concepts 2 nd Period
Chapter 15 Open Note Quiz Concepts 2 nd Period 1.) Please describe the difference between a homologous structure and an analogous structure. Homologous Structure = Same bone structure, different function
More informationDarwin s Conclusions. The Theory of Evolution
The Theory of Evolution More Evidence for Evolution Notes Pt. 3 Darwin s Conclusions 1. Many traits are heritable 2. Mutations result in variation populations have individuals with many different traits
More information#Evolution. Nothing in Biology makes sense except in the light of evolution.
Wednesday 1/24/18 Pick up your assignment in the tray. Turn in your BEAD lab from Monday! Due first minute of class or it s late. Turn in homework if you didn t finish your work in class yesterday! Due
More informationTheory of Evolution. Chapter 15
Theory of Evolution Chapter 15 The History of Evolutionary Thought Evolution The development of new types of organisms from preexisting types of organisms over time. Also could be described as a heritable
More information7.1 What is the Theory of Evolution?
Evolution 7.1 What is the Theory of Evolution? SCIENTIFIC THEORY: a well-tested scientific explanation that no evidence contradicts Theories explain the basic ideas of science. If scientists find new evidence
More informationEvidence for Evolution
Evidence for Evolution Evolution Biological evolution is descent with modification. It is important to remember that: Humans did not evolve from chimpanzees. Humans and chimpanzees are evolutionary cousins
More informationNatural Selection. Factors for Natural Selection: 1. Variation 2. Heritability 3. Overproduction (Overpopulation) 4. Reproductive Advantage
Natural Selection Variation: Heritability: Overproduction: Reproductive Advantage Driven by Environment Factors for Natural Selection: 1. Variation 2. Heritability 3. Overproduction (Overpopulation) 4.
More informationRegents Biology REVIEW 6: EVOLUTION. 1. Define evolution:
Period Date REVIEW 6: EVOLUTION 1. Define evolution: 2. Modern Theory of Evolution: a. Charles Darwin: Was not the first to think of evolution, but he did figure out how it works (mostly). However, Darwin
More informationGAUTENG DEPARTMENT OF EDUCATION SENIOR SECONDARY INTERVENTION PROGRAMME LIFE SCIENCES GRADE 12 SESSION 4 (LEARNER NOTES)
TOPIC 2: THEORIES OF EVOLUTION (PART 1) Learner Note: Evolution is a theory. Evolution is change over time. Diversity is the RESULT of this change over time. If a trait is good, the organism survives and
More informationEVOLUTION change in populations over time
EVOLUTION change in populations over time HISTORY ideas that shaped the current theory James Hutton (1785) proposes that Earth is shaped by geological forces that took place over extremely long periods
More informationStudy guide for test on end of chapter 2 and beginning of chapter 3
Study guide for test on end of chapter 2 and beginning of chapter 3 Chapter 2 questions: You should review: 1. 2 sets of notes: Evidence for Evolution (be able to name 3 of the 5) and What can affect evolution
More information15 Darwin's Theory of Natural Selection 15-1 The Puzzle of Life's Diversity
15-1 The Puzzle of Life's Diversity Study the photo of leaves... What else do you see? How did the Leaf Mantis come to look like decaying leaves? Define evolution in its simplest meaning? Review the meaning
More informationChapter 10 Study Guide SECTION 1: Early Ideas about Evolution
NAME Chapter 10 Study Guide SECTION 1: Early Ideas about Evolution BIOLOGY PREAP/GT Match each scientist with the statement that best reflects his ideas about evolutionary theory. 1. Linnaeus a. Species
More informationEvidences of Evolution
Evidences of Evolution Darwin stated that all organisms descend from a common ancestor Darwin based his theory of Natural Selection on observations of: Traits, geographical distribution, selective breeding,
More informationBoardworks Ltd The first wellknown. evolution:
1 of 7 2 of 7 The first wellknown theory of evolution: 3 of 7 Lamarck s theory of evolution: The Theory of Use/Disuse and Acquired Traits Jean-Baptiste Lamarck (1744-1829) was a French botanist who believed
More informationEVOLUTION. HISTORY: Ideas that shaped the current evolutionary theory. Evolution change in populations over time.
EVOLUTION HISTORY: Ideas that shaped the current evolutionary theory. Evolution change in populations over time. James Hutton & Charles Lyell proposes that Earth is shaped by geological forces that took
More informationNatural Selection Study Guide Answer Key
Natural Selection Study Guide Answer Key 1. This evidence comes out of the Earth's crust. It is the timeline of past life, organized by estimated ages and classified by similarities in form. What is it?
More informationStation 1. What is Evolution? What causes Evolution? A primary example of Evolution, is different bird beak sizes. What caused this to occur?
Station 1 What is Evolution? What causes Evolution? A primary example of Evolution, is different bird beak sizes. What caused this to occur? Station 2 What is Survival of the Fittest? How is fitness measured?
More information4. Identify one bird that would most likely compete for food with the large tree finch. Support your answer. [1]
Name: Topic 5B 1. A hawk has a genetic trait that gives it much better eyesight than other hawks of the same species in the same area. Explain how this could lead to evolutionary change within this species
More informationEvidence for EVOLUTION
Evidence for EVOLUTION Fossils A fossil is the naturally preserved remains or traces of animals or plants that lived in the geologic past. There are two main types of fossils; body and trace. Body fossils
More informationBiology Slide 1 of 41
Biology 1 of 41 15-3 Darwin Presents His Case 2 of 41 15-3 Darwin Presents His Case Publication of On the Origin of Species Publication of On the Origin of Species Darwin filled notebooks with his ideas
More informationBiology. Slide 1 of 41. End Show. Copyright Pearson Prentice Hall
Biology 1 of 41 15-3 Darwin Presents His Case 2 of 41 Publication of On the Origin of Species Publication of On the Origin of Species Darwin filled notebooks with his ideas about species diversity and
More informationPublication of On the Origin of Species Darwin Presents His Case
Publication of On the Origin of Species Publication of On the Origin of Species Darwin filled notebooks with his ideas about species diversity and the evolution process. Darwin was stunned and disturbed
More informationEvolution. Darwin s Journey and Observations
Evolution Darwin s Journey and Observations Who was Charles Darwin? English naturalist Took a 5 year voyage on the HMS Beagle Voyage s intent was to explore the coast of South America Darwin took many
More informationHeritability: Natural Selection: Overproduction:
Name: _ Due Date: _ Per: _ Unit 4.1 Study Guide Directions: Complete all sections to the best of your ability. On the day of the Quiz (the due date for this assignment) turn this in with all of your Unit
More informationHBio Evolution Practice Test 1
HBio Evolution Practice Test 1 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Which of the following are examples of fossils? a. shells or old bones b.
More informationWrite 2 facts from the following slides. OR If there are questions on the slides answer the questions.
Evolution Test 8.LS4.4) Develop a scientific explanation of how natural selection plays a role in determining the survival of a species in a changing environment. 8.LS4.3) Analyze evidence from geology,
More informationEvolution. Just a few points
Evolution Just a few points Just What is a Species??? Species: a group of organisms that share similar characteristics can interbreed with one another produce fertile offspring Population: One species
More informationSTRUGGLE FOR EXISTENCE
NATURAL SELECTION STRUGGLE FOR EXISTENCE If more individuals are produced than can survive à members of a population must compete to obtain food, living space, and other limited necessities of life Called:
More informationHappy Mon./Tues.! 2/24 & 2/25 Bell Work Today Answer questions 7-10 from Analyzing Aminoacid Sequences p. 47 in notebook
Happy Mon./Tues.! 2/24 & 2/25 Bell Work Today Answer questions 7-10 from Analyzing Aminoacid Sequences p. 47 in notebook Today in class: Transformation Video & Questions (turn in at the end of class) All
More informationAGENDA Go Over DUT; offer REDO opportunity Notes on Intro to Evolution Cartoon Activity
Date: Number your notebook and label the top the following: EVEN Pages-LEFT SIDE Page 176- Concept Map Page 178- Sequence Page 180- Vocabulary Page 182- Warm Ups Page 184- Cartoon Questions HN- Natural
More informationMAIN IDEA: Early scientists proposed ideas about evolution. In a phrase, tell what each scientist did to help develop evolutionary theory.
SECTION 10.1 KEY CONCEPT EARLY IDEAS ABOUT EVOLUTION Study Guide There were theories of biological and geologic change before Darwin. VOCABULARY evolution fossil gradualism species catastrophism uniformitarianism
More informationEcology Notes Part 1. Abiotic NONliving components in an ecosystem. Ecosystem
Ecology Notes Part 1 Ecology the study of the relationship between organisms and their environment Ecosystem an organism s surroundings consisting of both living and nonliving things and how that organism
More informationCH_15_Evolution.notebook. February 28, Cellular Evolution. Jean Baptiste de Lamarck. Endosymbiont Theory. Charles Darwin
Cellular Evolution The first cells were prokaryotic They did not need oxygen (the atmosphere did not contain oxygen until 1.8 billion years ago) Eukaryotic cells were found in the fossil record about 2
More informationUnsaved Test, Version: 1 1
Name: Key Concepts Select the term or terms that best complete the statement. A. algae and bacteria B. Cretaceous Extinction C. fossil record D. mass extinction E. multicellular organism F. Permian Extinction
More informationChapter 16: Evolutionary Theory
Chapter 16: Evolutionary Theory Section 1: Developing a Theory Evolution: Artificial Selection: Evolution: I. A Theory to Explain Change Over Time B. Charles Darwin C. Theory: D. Modern evolutionary theory
More informationBiology 2017 Mr. Johnson
Class Notes For EVOLUTION Biology 2017 Mr. Johnson Evolution genetic change over time *Theory = explanation based on much evidence (do not confuse with hypothesis ) *Not goal-oriented (can change and
More information15-3 Darwin Presents His Case Slide 2 of 41
15-3 Darwin Presents His Case 2 of 41 Publication of On the Origin of Species Publication of On the Origin of Species Darwin filled notebooks with his ideas about species diversity and the evolution process.
More informationWhich concept would be correctly placed in box X? A) use and disuse B) variation C) changes in nucleic acids D) transmission of acquired traits
1. Base your answer to the following question on Some of the concepts included in Darwin's theory of natural selection are represented in the diagram below. Which concept would be correctly placed in box
More informationTHE THEORY OF EVOLUTION. Darwin, the people who contributed to his ideas, and what it all really means.
THE THEORY OF EVOLUTION Darwin, the people who contributed to his ideas, and what it all really means. DARWIN S JOURNEY Charles Darwin was born in England on February 12, 1809. Geologists were suggesting
More informationDarwin s Observations & Conclusions The Struggle for Existence
Darwin s Observations & Conclusions The Struggle for Existence 1 Voyage of the Beagle During His Travels, Darwin Made Numerous Observations And Collected Evidence That Led Him To Propose A Revolutionary
More informationEvolution Test Review
Name Evolution Test Review Period 1) A group of interbreeding organisms (a species) living in a given area is called population 2) Give an example of a species. Ex. One wolf Give an example of a population.
More informationb. In Table 1 (question #2 on the Answer Sheet describe the function of each set of bones and answer the question.)
Biology EVIDENCE OF EVOLUTION INTRODUCTION: Evidence has been found to indicate that living things have changed gradually during their natural history. The study of fossils as well as embryology, biochemistry,
More informationTHE HISTORY OF THE THEORY. Darwin presented that happens and offered an of how it happens. Theory a broad that has been and
Evolution Notes THE HISTORY OF THE THEORY Why is the evolutionary theory associated with Charles Darwin? Darwin presented that happens and offered an of how it happens. o Evolution the process by which
More informationThe slow, gradual change in a population of organisms over time
The slow, gradual change in a population of organisms over time SB5. Students will evaluate the role of natural selection in the development of the theory of evolution. acquired characteristics inherited
More informationFinal Revision G8 Biology ( ) Multiple Choice Identify the choice that best completes the statement or answers the question.
Final Revision G8 Biology ( 2017-2018 ) Multiple Choice Identify the choice that best completes the statement or answers the question. 1 A species is a group of similar organisms that A can mate with each
More informationGuided Notes: Evolution. is the change in traits through generations over! Occurs in, NOT individual organisms
Guided Notes: Evolution The Theory of Evolution is the change in traits through generations over! Occurs in, NOT individual organisms How Have Organisms Changed? At the time life emerged, the Earth was
More informationChapter 16.1 Introduction to Evolution and Evidence
Chapter 16.1 Introduction to Evolution and Evidence Vocabulary Evolution Artificial Selection Natural Selection Homologous Structures Vestigial Structures Adaptation Variation Key Concepts Who was Darwin
More informationTrue or False? Lamarck s Theory of Evolution. Jean-Baptiste Pierre Antoine de Monet, Chevalier de Lamarck
True or False? We know what it is, we ve seen the evidence, but Aim: How does evolution happen? Charles Darwin was the 1 st scientist to offer an explanation for how Evolution happens. Jean-Baptiste Pierre
More information