Zebrafish frizzled-2 Morphant Displays Defects in Body Axis Elongation

Transcription

1 2001 Wiley-Liss, Inc. genesis 30: (2001) Zebrafish frizzled-2 Morphant Displays Defects in Body Axis Elongation Saulius Sumanas, Hyon J. Kim, Spencer Hermanson, and Stephen C. Ekker* Department of Genetics, Cell Biology and Development, University of Minnesota Arnold and Mabel Beckman Center for Transposon Research, Minneapolis, Minnesota Received 1May 2001; Accepted 12 June 2001 Published online 23 July 2001; DOI /gene.1043 Wnt signaling has been implicated in many patterning processes in avertebrate embryo including morphogenetic cell rearrangements during gastrulation. Pipetail (wnt5) and silberblick (wnt11) zebrafish mutants undergo abnormal gastrulation with an undulated notochord (pipetail) and cyclopic embryos (silberblick) at later stages of development (Hammerschmidt et al., 1996; Heisenberg et al., 1996; Heisenberg et al., 2000; Rauch et al., 1997). Wnt proteins are known to transmit signals via the Frizzled seven-pass transmembrane receptor family (Bhanot et al., 1996). We have isolated cdna encoding anew Frizzled family protein, zebrafish Frizzled-2 (Fz2). Zebrafish frizzled-2 is alikely ortholog of human frizzled-2 by the sequence homology alignments and mapping data analysis. Fz2 is expressed zygotically within the notochord, somitic and posterior paraxial mesoderm. For protein knockdown studies, we utilized morpholino phosphorodiamidate antisense oligonucleotides (morpholinos, MOs). Injection of two different morpholinosintoearlyzebrafishembryostargetedtofz2 caused similar developmental defects. Fz2-morpholino injected embryos (morphants) are shorter than controls and display an undulating or kinked notochord, neural tube, and hypochord. Similar, although weaker, undulations of axial structures have been observed in pipetail mutantembryos,raisingpossibilitythatfz2mayfunction as areceptor in the wnt5 pathway regulating gastrulation movements. We isolated anovel zebrafish frizzled homolog from gastrula stage cdna library by the polymerase chain reaction (PCR). The isolated gene encodes aputative Frizzled protein with highest homology to the frizzled-2 subfamily as evident from BLAST and CLUSTAL alignments(fig.1a,b).radiationhybridmappingusingpanel LN54(Hukriedeetal.,1999)placesfz2onlinkagegroup 3, linked to the marker Z22516 (distance 0.00cR, LOD score 22.2). To confirm that we isolated true frizzled-2 ortholog from zebrafish, we performed synteny analysis between corresponding zebrafish and human chromosome regions. Zebrafish fz2 maps to the marker Z22516, which is located between the hoxb9a and dlx8 genes on linkage group 3in the LN54 panel (Hukriede et al., 1999; marker list at This region of zebrafish linkage group 3is syntenic to the human chromosome 17 region. Human fz2 maps by FISH to 17q21.1 (Zhao et al., 1995), human hoxb9 maps to 17q21-q22 (Acampora et al., 1989; Apiou et al., 1996; HUGO database), and human Dlx4, an ortholog of zebrafish Dlx8, maps to 17q21.33 (Nakamura et al., 1996; Stock et al., 1996). Thus, human frizzled-2 is likely to be the true ortholog of the zebrafish frizzled-2 gene. Using Northern blotting, we detected asingle, zygotically expressed transcript of fz2, with maximal expression level approximately at the five-somite stage (Fig. 1c). In situ hybridization revealed weak and ubiquitous expression starting from the shield stage (data not shown).duringearlysomitogenesis,fz2rnaisdetected withintheformingsomitesaswellasintwolongitudinal stripes within the paraxial posterior mesoderm (Fig. 1, d g). There is also weak expression within notochordal cells anterior to fz2 expression in the forming somites. At the 20-somite stage, fz2 expression is detected in the posterior part of the notochord and in the posterior somitic mesoderm (Fig. 1h, i). At 26 hpf, fz2 is localized within the tailbud mesoderm (Fig. 1k). Injecting pgfz2RNAintofishembryosatthe 1 2 cell stage caused severe hyperdorsalization in 90% of experimental embryos (data not shown), as noted previously for other Frizzled proteins (Nasevicius et al., 1998). A number of fz2-overexpressing embryos displayed secondary axes (data not shown). This illustrates that fz2 is capable of activating dorsoventral axis inductionpathwaywhenoverexpressedinzebrafishembryos. To study fz2 function, we utilized an antisense morpholino oligonucleotide approach (Nasevicius and Ekker,2000;Summerton,1999).Twononoverlappingmorpholinos were designed against the fz2 sequence. Injecting either morpholino against fz2 produced similar phenotypes, indicating alikely high specificity of targeting to fz2 transcripts. The resulting embryos (fz2 morphants) display characteristic defects not commonly seen with other unrelated morpholinos. At 70% epiboly, fz2 morphants have an oblong shape compared with *Correspondence and request for materials to: Dr. Stephen C. Ekker, Department of Genetics, Cell Biology and Development, University of Minnesota Medical School, 321 Church Street, S.E., Minneapolis, Minnesota E:mail: ekker001@mail.med.umn.edu

2 FRIZZLED-2 IS INVOLVED IN AXIS ELONGATION 115 FIG. 1. Zebrafish frizzled-2 sequence analysis and expression pattern. (a) BLAST and CLUSTAL alignment tools indicate that zebrafish fz2 clusters to the Frizzled-2 protein subfamily. To minimize the effect of gaps within the alignment due to variable length sequence in the linker region between the cysteine-rich domain and transmembrane segments, only the last 380 amino acids were used in constructing the Frizzled family tree. (b) Zebrafish fz2 aligned with its closest homologs from Xenopus and humans. Arrow indicates the predicted signal sequence cleavage site, the 10 conserved cysteines within the cysteine-rich domain are shown in blue, and the putative transmembrane domains are marked with an overscored line. Full zebrafish frizzled-2 cdna sequence has been submitted to the GenBank under accession number AY For radiation hybrid mapping, the radiation hybrid panel LN54, kindly provided by M. Ekker (Hukriede et al., 1999), was screened using fz2 primers CAGTTCTGGGTGACGGACAC and ATTGCACACAACCTTGTCCC. PCR was performed for 26 cycles with annealing temperature of 60 o C. The positives were in groups 8, 11, 13, 16, 36, 49, 59, 65, 66, 70, 74, 80, 84, 87, 121, 138, 301, 306, 309, 310, 311, 312, AB9, and Mix. Linkage analysis was performed with Zebrafish Information Network software ( (c) A Northern blot demonstrating the zygotic expression of zebrafish fz2 during the first day of embryogenesis. Expression of fz2 reaches maximum at around the five-somite stage. RNA purified from 10 embryos was loaded into each lane. Northern blotting was performed as described (Hopwood et al., 1989). Ethidium bromide staining of ribosomal RNA was used as a loading control. (d k) In situ hybridization analysis of fz2 expression. Hybridization was performed as described (Jowett, 1999). The anterior is to the left in all embryos shown. (d) One-somite stage embryo (dorsal view). Fz2 expression is detected within the somitic (s) and posterior paraxial mesoderm (p). (e, f) Five-somite stage embryo. (e) Dorsal view. (f) Dorsal view of a deyolked embryo. Fz2 RNA is detected within somites (s) and two bilateral posterior domains within the paraxial mesoderm (p). There is also weak expression in the notochord anterior to fz2 expression in the somites (n). (g) Eight-somite stage embryo (dorsal view). Fz2 RNA is detected within the somites (s) and two bilateral posterior domains within the paraxial mesoderm (p). There is also a weak expression in the notochord anterior to fz2 expression in the somites (n). (h, i) Twenty-somite stage embryo. (h) Lateral view. (i) Dorsal view of a deyolked embryo, posterior part. Fz2 RNA is detected in the posterior part of the notochord (white arrowhead) and two stripes within the posterior paraxial mesoderm (black arrowheads in (i)). (i) Expression of fz2 in the posterior somitic mesoderm is bilaterally symmetric, the apparent asymmetry is an embryo-processing artifact. (k) 24 hpf embryo. Fz2 RNA is localized to the mesoderm within the tailbud (black arrowhead). round, control embryos (Fig. 2a, b). During somitogenesis, fz2 morphants are shorter and display an undulating notochord and wider, more posteriorly located somites (Fig. 2, c-h). Similar defects are apparent in 1-day-old embryos, most notably severe dorsoventral and lateral notochord undulations (Fig. 2, i m). Fz2 morphants also have reduced dorsal and ventral fins (Fig. 2j, k). More severely affected embryos are greatly shortened and have a severely folded notochord and necrosis in the head region, which may be a secondary effect of loss of function of fz2 (data not shown). Less affected embryos survive for at least 5 days when the notochord undulations can still be seen (Fig. 2n, o). Molecular analysis with the notochord marker no tail (ntl) (Schulte-Merker et al., 1994) confirmed the morphological assessment of the notochord undulations (Fig. 2, p r). In addition to undulation, the notochord was much shorter and thicker, especially in the more severely affected embryos (Fig. 2r). As evident from MyoD staining (Weinberg et al., 1996), somites are wider and compressed, especially in the more strongly affected embryos (Fig. 2, u x). In addition to the noto-

3 116 SUMANAS ET AL. FIG. 2. Analysis of zebrafish fz2 morphant phenotype. Anterior is to the left in all embryos shown. (a, b) Morphant embryos (b) have oblong shape at 70% epiboly, compared with controls (a). (c h) Morphant phenotype at the somite stage. (c, f) Uninjected control embryos. (d, g) Moderately affected fz2 morphants. (e, h) Severely affected fz2 morphants. (c, d, e) Dorsal views. (f, g, h) Lateral views. Notice the widened somites in (d, e). Black arrowheads mark the somite boundary (c, d, e), and a white arrowhead marks the notochord. Notice also notochord undulations (d, e) and the shorter body axis (g, h). Arrowheads (f, g, h) mark the length of the body axis. (i m) Morphant phenotype at hpf. (i) Control embryo. (j, k) Fz2 morphants. (l, m) Higher magnification of morphant embryos. Notice the strong notochord kinks and undulations in fz2 morphants (marked with arrows). Other axial structures, such as the neural tube and hypochord, show undulations as well. The ventral and dorsal fins are reduced. (n, o) Morphant phenotype at 4 5 days postfertilization. An arrow marks the undulation of axial structures in fz2 morphant (o); a higher magnification is shown in the inset. Morphant embryos are noticeably shorter, compared with control embryos (n). (p r)no tail (ntl) (Schulte-Merker et al., 1994) staining of the notochord at the 7 9 somite stage. (p) Control embryo. (q) Moderately affected fz2 morphant. (r) Severely affected fz2 morphant. Notice the strong undulations, shortening and thickening of the notochord in fz2 morphants. (s, t)f-spondin (Higashijima et al., 1997) staining of the floorplate at hpf. (s) Control embryo. (t) Fz2 morphant. Notice floorplate undulations in a fz2 morphant. (u x) MyoD (Weinberg et al., 1996) staining for somites at the 7 9 somite stage. (u) Control embryo. (v) Moderately affected fz2 morphant. (x) Severely affected fz2 morphant. Notice widening and compression of somites in a fz2 morphant. (y, z) Staining for the hypochord and floorplate marker fork head-7 at hpf (Odenthal and Nusslein-Volhard, 1998). (y) Control embryo. (z) Fz2 morphant. Notice hypochord (hc) and floorplate (fp) undulations in an fz2 morphant. All morphants were injected with 5 ng morpholino mix (2.5 ng MO-1 and 2.5 ng MO-2), except panels (r, x) where 7.5 ng of oligo-1 was used. Morpholinos against Fz2 had the following sequence: CCTGCATTGTCTCGAAAAGTTCCGC (MO-1) and CACACACACTTC- CACTCGCCTGCAT (MO-2). Morpholino injections were performed as described (Nasevicius and Ekker, 2000).

4 Table 1 Dose Dependence of fz2 Morphant Phenotype Normal Kinked/ undulated notochord Severe phenotype Other 2.5 ng MO-1 39% 6% 50% 6% 9% 2% 1% 1% 2.5 ng MO-2 n ng MO-1 27% 1% 23% 3% 43% 2% 7% 1% 5ng MO-2 n 67 4 ng MO-1 42% 9% 40% 7% 18% 3% 0% 0% n ng MO-2 58% 7% 37% 12% 0% 0% 4% 3% n 195 Both MO-1 and MO-2 against fz2 cause similar defects when injected alone into zebrafish embryos at the 1 2 cell stage. Similar defects are observed when using a mixture of the 2 morpholinos. This allowed us to use lower doses of individual morpholinos. Throughout this paper severe phenotype refers to severe shortening of body axis and a folded back, undulating notochord (embryos in Fig. 2e, h, r, x). The kinked/undulated notochord describes moderately affected embryos (Fig. 2d, g, q, v). The percentages shown are an average of at least two independent experiments. chord, other axial structures, such as the floorplate (Fig. 2s, t) and the hypochord (Fig. 2y, z), display undulations as well. Dorsoventral patterning was unaffected in fz2 morphants as analyzed by in situ with dorsal markers goosecoid and chordin at the 70% epiboly stage (data not shown). Injecting either MO-1 or MO-2 against fz2 caused the observed phenotype, whereas MO-1 was more potent than MO-2 (Table 1). Mixing the two morpholinos caused notochord undulations at higher frequency compared with individual morpholinos (Tables 1, 2) and was used for most of the experiments shown. Increasing the dose of morpholino injected resulted in a higher percentage of severely affected embryos displaying much shorter body axis, wider somites, a severely undulating and folded back notochord, and cell death in the brain region. More than half of these embryos die by 24 hpf (data not shown). As an additional specificity test, we utilized the phenotype enhancement effect observed when both morpholinos are coinjected together. As mentioned earlier, none or very few embryos display the described phenotype when low dose of 2.5 ng of either morpholino is injected (Table 2). The number of affected embryos greatly increases when both morpholinos are coinjected into embryos. There is no increase, however, if one of the morpholinos is replaced with the same amount of an unrelated morpholino against a different gene, nacre (Table 2) (Lister et al., 1999; Nasevicius and Ekker, 2000). These observations, together with the fact that both morpholinos against fz2 cause similar developmental defects, argue for the specificity of the phenotype observed. Because injection of fz2 RNA caused severe FRIZZLED-2 IS INVOLVED IN AXIS ELONGATION hyperdorsalization, we were unable to use fz2 RNA to rescue the observed morpholino phenotypes. In the accompanying paper, we report a role for another Frizzled homolog, Xenopus frizzled-7, in regulating convergent extension as well as dorsoventral axis induction (Sumanas and Ekker, 2001). Zebrafish frizzled-2 is a distinct homolog from fz7 by expression pattern and sequence homology. Also, two closely related forms of a frizzled-7 ortholog have recently been isolated from zebrafish (El-Messaoudi and Renucci, 2001; Sumanas and Ekker, unpublished observations). Although both Xfz7 and zebrafish fz2 appear to function during gastrulation, their downregulation results in quite different developmental defects. Although fz2 morphants apparently undergo defective convergent extension resulting in the undulating axial structures, Xfz7 downregulation results in the direct inhibition of convergent extension movements. These results suggest that Fz7 and Fz2 are likely to regulate different aspects of convergent extension during gastrulation, although we cannot exclude possible species differences between Xenopus laevis and Danio rerio. We describe here the first specific loss-of-function phenotype for a transmembrane Wnt receptor frizzled in zebrafish. The observed undulations of axial structures, together with the observed changes in embryo shape during gastrulation, argue for the involvement of fz2 in the process of gastrulation, possibly through the control of convergent extension movements. The observed undulations of axial structures are similar to the ones observed in wnt5 mutant (pipetail) embryos (Hammerschmidt et al., 1996; Rauch et al., 1997). Wnt5 is expressed in somites and tailbuds at somitogenesis, thus partially overlapping with fz2 expression (Blader et al., 1996). However, pipetail and Fz2 morphant phenotypes are not identical. Wnt5 mutant embryos display stronger condensation of somites and weaker notochord undulations than fz2 morphants (Hammerschmidt et al., 1996; Table 2 The Formation of Kinked/Undulated Phenotype as Well as More Severe Phenotypes (See Table 1) are Specific to fz2 Morpholinos Normal Kinked/ undulated notochord Severe phenotypes Other ng MO-1 96% 1% 2% 1% 0% 0% 2% 1% n ng MO-2 100% 0% 0% 0% 0% 0% 0% 0% n ng MO-1 47% 5% 38% 13% 14% 7% 1% 1% 2.5 ng MO-2 n ng MO-1 95% 1% 3% 1% 0 2% 1% 2.5 ng nacre n 100 The addition of MO-2 morpholino to MO-1 greatly enhances the frequency of observed phenotypes while addition of unrelated morpholino against gene nacre (Lister et al., 1999; Nasevicius and Ekker, 2000) does not. Data shown is an average of at least two independent experiments.

5 118 SUMANAS ET AL. Rauch et al., 1997). Notochord defects in fz2 morphants may be independent from the somitic defects. Knypek mutant embryos (Solnica-Krezel et al., 1996; Stemple et al., 1996) display mainly a folded notochord, whereas other mutants, such as trilobite (Hammerschmidt et al., 1996; Solnica-Krezel et al., 1996), display mainly compressed somites. Our observations suggest that wnt5 and fz2 may function in the same signaling pathway during gastrulation and axis elongation. However, subsequent experiments will work out the specific role of fz2 in the mechanisms of gastrulation and/or convergent extension during embryonic elongation/midline formation. ACKNOWLEDGMENTS Work was funded by an NIH grant to SCE. We thank M. Hammerschmidt for scientific discussion. LITERATURE CITED Acampora D, D Esposito M, Faiella A, Pannese M, Migliaccio E, Morelli F, Stornaiuolo A, Nigro V, Simeone A, Boncinelli E The human HOX gene family. Nucleic Acids Res 17: Apiou F, Flagiello D, Cillo C, Malfoy B, Poupon MF, Dutrillaux B Fine mapping of human HOX gene clusters. Cytogenet Cell Genet 73: Bhanot P, Brink M, Samos CH, Hseih J-C, Wang Y, Macke JP, Nathans J, Nusse, R A new member of the frizzled family from Drosophila functions as a Wingless receptor. Nature 382: Blader P, Strahle U, Ingham PW Three Wnt genes expressed in a wide variety of tissues during development of the zebrafish, Danio rerio: developmental and evolutionary perspectives. Dev Genes Evol 206:3 13. El-Messaoudi S, Renucci A Expression pattern of the frizzled 7 gene during zebrafish embryonic development. Mech Dev 102: Hammerschmidt M, Pelegri F, Mulins MC, Kane DA, Brand M, van Eeden FJ M, Furutani-Seiki M, Granato M, Haffter P, Heisenberg C-P, Jiang Y-J, Kelsh RN, Odenthal J, Warga RM, Nusslein-Volhard C Mutations affecting morphogenesis during gastrulation and tail formation in the zebrafish, Danio rerio. Development 123: Heisenberg CP, Tada M, Rauch GJ, Saude L, Concha ML, Geisler R, Stemple DL, Smith JC, Wilson SW Silberblick/Wnt11 mediates convergent extension movements during zebrafish gastrulation. Nature 405: Heisenberg CP, Brand M, Jian YJ, Warga RM, Beuchle D, van Eeden FJ, Furutani-Seiki M, Granato M, Haffter P, Hammerschmidt M, Kane DA, Kelsh, RN, Mullins MC, Odenthal J, Nusslein-Volhard C Genes involved in forebrain development in the zebrafish, Danio rerio. Development 123: Higashijima S, Nose A, Eguchi G, Hotta Y, Okamoto H Mindin/ F-spondin family: novel ECM proteins expressed in the zebrafish embryonic axis. Dev Biol 192: Hopwood ND, Pluck A, Gurdon JB MyoD expression in the forming somites is an early response to mesoderm induction Xenopus embryos. EMBO J 8: Hukriede NA, Joly L, Tsang M, Miles J, Tellis P, Epstein JA, Barbazuk WB, Li FN, Paw B, Postlethwait JH, Hudson TJ, Zon LI, McPherson JD, Chevrette M, Dawid IB, Johnson SL., Ekker M Radiation hybrid mapping of the zebrafish genome. PNAS 96: Jowett T Analysis of protein and gene expression. Methods Cell Biol 59: Lister JA, Robetson CP, Lepage T, Johnson SL., Raible DW nacre encodes a zebrafish microphtalmia-related protein that regulates neural-crest-derived pigment cell fate. Development 126: Nakamura S, Stock DW, Wydner L, Bollekens JA, Takeshita K, Nagai BM, Chiba S, Kitamura T, Freeland TM, Zhao Z, Minowada J, Lawrence JB, Weiss KM, Ruddle FH Genomic analysis of a new mammalian Distal-less gene: Dlx7. Genomics 38: Nasevicius A, Ekker SC Effective targeted gene knockdown in zebrafish. Nat Genet 26: Nasevicius A, Hyatt T, Kim H, Guttman J, Walsh E, Sumanas S, Wang Y, Ekker SC Evidence for a frizzled-mediated wnt pathway required for zebrafish dorsal mesoderm formation. Development 125: Odenthal J, Nusslein-Volhard C fork head domain genes in zebrafish. Dev Genes Evol 208: Rauch G-J, Hammerschmidt M, Blader P, Schauerte HE, Strahle U, Ingham PW, McMahon AP, Haffter P Wnt5 is required for tail formation in the zebrafish embryo. Cold Spring Harbor Symp Quant Biol 62: Schulte-Merker S, van Eeden FJ, Halpern ME, Kimmel CB, Nusslein- Volhard C no tail (ntl) is the zebrafish homologue of the mouse T (Brachyury) gene. Development 120: Solnica-Krezel L, Stemple DL, Mountcastle-Shah E, Rangini Z, Neuhauss SCF, Malicki J, Schier AF, Stainier DYR, Zwartkruis F, Abdelilah S, Driever W Mutations affecting cell fates and cellular rearrangements during gastrulation in zebrafish. Development 123: Stemple, DL, Solnica-Krezel L, Zwartkruis F, Neuhauss SCF, Schier AF, Malicki J, Stainier DYR, Abdelilah S, Rangini Z, Mountcastle-Shah E, Driever W Mutations affecting development of the notochord in zebrafish. Development 123: Stock DW, Ellies DL, Zhao Z, Ekker M, Ruddle FH., Weiss KM The evolution of the vertebrate Dlx gene family. Proc Natl Acad Sci 93: Sumanas S, Ekker SC Xenopus frizzled-7 morphant displays defects in dorso-ventral patterning and covergent extension movements during gastrulation. Genesis this issue. Summerton J Morpholino antisense oligomers: the case for an RNase H-independent structural type. Biochim Biophys Acta 1489: Weinberg ES, Allende ML, Kelly CS. Abdelhamid A, Murakami T, Andermann P, Doerre OG, Grunwald DJ, Riggleman B Developmental regulation of zebrafish MyoD in wild-type, no tail and spadetail embryos. Development 122: Zhao Z, Lee CC, Baldini A, Caskey CT A human homologue of the Drosophila polarity gene frizzled has been identified and mapped to 17q21.1. Genomics 27: