Neutral Networks of RNA Genotypes and RNA Evolution in silico
|
|
- Patrick Sparks
- 5 years ago
- Views:
Transcription
1
2 Neutral Networks of RNA Genotypes and RNA Evolution in silico Peter Schuster Institut für Theoretische Chemie und Molekulare Strukturbiologie der Universität Wien RNA Secondary Structures in Dijon Dijon,
3 No new principle will declare itself from below a heap of facts. Sir Peter Medawar, 1985
4 The genotypes or genomes of individuals and species, being reproductively related ensembles of individuals, are DNA or RNA sequences. They are changing from generation to generation through mutation and recombination. Genotypes unfold into phenotypes or organisms, which are the targets of the evolutionary selection process. Point mutations are single nucleotide exchanges. The Hamming distance of two sequences is the minimal number of single nucleotide exchanges that mutually converts the two sequence into each other.
5 A A A A A U U U U U U C C C C C C C C G G G G G G G G A U C G = adenylate = uridylate = cytidylate = guanylate Genotype: The sequence of an RNA molecule consisting of monomers chosen from four classes.
6 Phenotype: Three-dimensional structure of phenylalanyl transfer-rna
7 Sequence 5'-End 3'-End GCGGAUUUAGCUCAGDDGGGAGAGCMCCAGACUGAAYA UCUGGAGMUCCUGUGTPCGAUCCACAGAAUUCGCACCA 3'-End 5'-End 70 Secondary Structure Symbolic Notation 5'-End 3'-End Definition and formation of the secondary structure of phenylalanyl-trna
8 CGTCGTTACAATTTAGGTTATGTGCGAATTCACAAATTGAAAATACAAGAG... CGTCGTTACAATTTAAGTTATGTGCGAATTCCCAAATTAAAAACACAAGAG... Hamming distance d (S,S ) = H (i) (ii) (iii) d (S,S) = 0 H 1 1 d (S,S) = d (S,S) H 1 2 H 2 1 d (S,S) d (S,S) + d (S,S) H 1 3 H 1 2 H 2 3 The Hamming distance induces a metric in sequence space
9 Hydrogen bonds Hydrogen bonding between nucleotide bases is the principle of template action of RNA and DNA.
10 5' 3' Plus Strand G C C C G Synthesis 5' 3' Plus Strand G C C C G C 3' G Synthesis 5' 3' Plus Strand G C C C G Minus Strand C G G G C 3' 5' Complex Dissociation 5' 3' Plus Strand G C C C G 5' Minus Strand C G G + G C 3' Complementary replication as the simplest copying mechanism of RNA
11 (A) + I 1 f 1 I 1 + I 1 dx / dt = f x - x j j j j Φ =( f j - Φ) xj (A) + I 2 f 2 I 2 + I 2 Φ =Σ i f i x i ; Σ x = 1 ; i,j i i =1,2,...,n [A] = a = constant f m = max { f; j=1,2,...,n} j (A) + I j f j Ij + Ij x (t) 1 for t m (A) + I m f m I m + I m s = (f m+1 -f m )/f m succession of temporarily fittest variants: m m+1... (A) + I n f n I n + I n Selection of the fittest or fastest replicating species I m
12 Stock Solution [A] = a 0 Reaction Mixture: A; I, k=1,2,... k k 1 A + I 2 I 1 1 d 1 k 2 A + I 2 I 2 2 d 2 k 3 A + I 2 I 3 3 d 3 k 4 A + I 2 I 4 4 d 4 k 5 A + I 2 I 5 5 d 5 Replication in the flow reactor P.Schuster & K.Sigmund, Dynamics of evolutionary optimization, Ber.Bunsenges.Phys.Chem. 89: (1985)
13 Concentration of stock solution a 0 A + I + I 1 2 A + I 1 A k 1 A + I 2 I 1 1 d 1 k 2 A + I 2 I 2 2 d 2 k 3 A + I 2 I 3 3 d 3 k 4 A + I 2 I 4 4 d 4 k 5 A + I 2 I 5 5 d 5 k > k > k > k > k Flow rate r = R -1 Selection in the flow reactor: Reversible replication reactions
14 Concentration of stock solution a 0 A + I 1 A f 1 A + I 2 I 1 1 f 2 A + I 2 I 2 2 f 3 A + I 2 I 3 3 f 4 A + I 2 I 4 4 f 5 A + I 2 I 5 5 f > f > f > f > f Flow rate r = R -1 Selection in the flow reactor: Irreversible replication reactions
15 1 Fraction of advantageous variant s = 0.1 s = 0.02 s = Time [Generations] Selection of advantageous mutants in populations of N = individuals
16 Σ dx / dt = f x - x j i iq ji i j Φ I 1 + Ij Φ = Σ f x i i i ; Σ x = 1 ; i i Σ Q i ij = 1 f j Q 1j I 2 + Ij Q = (1-p) p ij n-d(i,j) d(i,j) p... Error rate per digit f j Q 2j d(i,j)... Hamming distance between I i and Ij (A) + I j f j Q jj Ij + Ij [A] = a = constant f j Q nj I n + Ij Chemical kinetics of replication and mutation
17 Concentration Master sequence Mutant cloud Sequence space The molecular quasispecies in sequence space
18 The RNA model considers RNA sequences as genotypes and simplified RNA structures, called secondary structures, as phenotypes. The mapping from genotypes into phenotypes is many-to-one. Hence, it is redundant and not invertible. Genotypes, i.e. RNA sequences, which are mapped onto the same phenotype, i.e. the same RNA secondary structure, form neutral networks. Neutral networks are represented by graphs in sequence space.
19 S k = ψ( I. ) f k = fs ( k ) Sequence space Phenotype space Non-negative numbers Mapping from sequence space into phenotype space and into fitness values
20 A multi-component neutral network Giant Component
21 A connected neutral network
22 Optimization of RNA molecules in silico W.Fontana, P.Schuster, A computer model of evolutionary optimization. Biophysical Chemistry 26 (1987), W.Fontana, W.Schnabl, P.Schuster, Physical aspects of evolutionary optimization and adaptation. Phys.Rev.A 40 (1989), M.A.Huynen, W.Fontana, P.F.Stadler, Smoothness within ruggedness. The role of neutrality in adaptation. Proc.Natl.Acad.Sci.USA 93 (1996), W.Fontana, P.Schuster, Continuity in evolution. On the nature of transitions. Science 280 (1998), W.Fontana, P.Schuster, Shaping space. The possible and the attainable in RNA genotypephenotype mapping. J.Theor.Biol. 194 (1998),
23 Evolution in the Flow Reactor: The RNA Model Sequence-structure map Structure-function map Environment ψ : f Ω(t) h s { I; d } { S; d }. ij ij { s S; } R. : d ij + Mapping into fitness values f k ( S, Ω( t) ) = f ( ( I, Ω( t)), Ω( )) ( t) = f ψ t k k dx dt k ( Q f ( t) Φ( t) ) + Q f ( t) x + η ( x, t) ω ( t), k = 1,..., n = xk kk k n j= 1, j k kj j j k k Wiener process dw ( t) = ω ( t) dt
24 Genotype-Phenotype Mapping I { S { = ( I { ) S { f = ƒ( S ) { { Evaluation of the Phenotype Mutation Q {j f 2 I 2 f 1 I1 I n I 1 f n I 2 f 2 f 1 I n+1 f n+1 f { Q f 3 I 3 Q f 3 I 3 f 4 I 4 I { f { I 4 I 5 f 4 f 5 f 5 I 5 Evolutionary dynamics including molecular phenotypes
25 Concentration Master sequence Mutant cloud Off-the-cloud mutations Sequence space The molecular quasispecies and mutations producing new variants
26 Stock Solution Reaction Mixture The flowreactor as a device for studies of evolution in vitro and in silico
27 50 S Average structure distance to target d Evolutionary trajectory Time (arbitrary units) In silico optimization in the flow reactor: Trajectory
28 36 Relay steps Number of relay step 38 Evolutionary trajectory Time Average structure distance to target d S Endconformation of optimization
29 36 Relay steps Number of relay step 38 Evolutionary trajectory Time Average structure distance to target d S Reconstruction of the last step 43 44
30 36 Relay steps Number of relay step Average structure distance to target d S 42 Evolutionary trajectory Reconstruction of last-but-one step ( 44) Time
31 36 Relay steps Number of relay step Average structure distance to target d S Evolutionary trajectory Reconstruction of step ( 43 44) Time
32 36 Relay steps Number of relay step Average structure distance to target d S Evolutionary trajectory Reconstruction of step ( ) Time
33 Average structure distance to target d S 10 Relay steps Number of relay step Evolutionary trajectory Time Evolutionary process Reconstruction Reconstruction of the relay series
34 Transition inducing point mutations Neutral point mutations Change in RNA sequences during the final five relay steps 39 44
35 50 Relay steps S Average structure distance to target d Evolutionary trajectory Time (arbitrary units) In silico optimization in the flow reactor: Trajectory and relay steps
36 50 Relay steps S Average structure distance to target d Uninterrupted presence Evolutionary trajectory Time (arbitrary units) In silico optimization in the flow reactor: Uninterrupted presence
37 Number of relay step Average structure distance to target d S Uninterrupted presence Evolutionary trajectory Time (arbitrary units) Transition inducing point mutations Neutral point mutations Neutral genotype evolution during phenotypic stasis
38 Number of relay step Average structure distance to target d S Uninterrupted presence Evolutionary trajectory Time (arbitrary units) A random sequence of minor or continuous transitions in the relay series
39 A random sequence of minor or continuous transitions in the relay series
40 Shortening of Stacks Elongation of Stacks Multiloop Minor or continuous transitions: Occur frequently on single point mutations Opening of Constrained Stacks
41 50 Relay steps S Average structure distance to target d Uninterrupted presence Evolutionary trajectory Time (arbitrary units) In silico optimization in the flow reactor: Uninterrupted presence
42 Main transition leading to clover leaf Average structure distance to target d S 10 Relay steps Evolutionary trajectory Number of relay step Time Reconstruction of a main transitions ( 38)
43 50 Relay steps Main transitions Average structure distance to target d S Evolutionary trajectory Time (arbitrary units) In silico optimization in the flow reactor: Main transitions
44 Shift Roll-Over α α a Flip a α a b Double Flip a α b β β Main or discontinuous transitions: Structural innovations, occur rarely on single point mutations Closing of Constrained Stacks Multiloop
45 50 Relay steps Main transitions Average structure distance to target d S Uninterrupted presence Evolutionary trajectory Time (arbitrary units) In silico optimization in the flow reactor
46 Variation in genotype space during optimization of phenotypes
47 Statistics of evolutionary trajectories Population size N Number of replications < n > rep Number of transitions < n > tr Number of main transitions < n > dtr The number of main transitions or evolutionary innovations is constant.
48 Three important steps in the formation of the trna clover leaf from a randomly chosen initial structure corresponding to three main transitions.
49 Main results of computer simulations of molecular evolution No trajectory was reproducible in detail. Sequences of target structures were different. Nevertheless solutions of comparable or the same quality are almost always achieved. Transitions between molecular phenotypes represented by RNA structures can be classified with respect to the induced structural changes. Highly probable minor transitions are opposed by main transitions with low probability of occurrence. Main transitions represent important innovations in the course of evolution. The number of minor transitions decreases with increasing population size. The number of main transitions or evolutionary innovations is approximately constant for given start and stop structures. Not all structures are accessible through evolution in the flow reactor. An example is the trna clover leaf for GC-only sequences.
50 ...Variations neither useful not injurious would not be affected by natural selection, and would be left either a fluctuating element, as perhaps we see in certain polymorphic species, or would ultimately become fixed, owing to the nature of the organism and the nature of the conditions.... Charles Darwin, Origin of species (1859)
51 Adaptive Periods End of Walk Fitness Random Drift Periods Start of Walk Genotype Space Evolution in genotype space sketched as a non-descending walk in a fitness landscape
52 Coworkers Walter Fontana, Santa Fe Institute, NM Christian Reidys, Christian Forst, Los Alamos National Laboratory, NM Peter Stadler, Universität Leipzig, GE Ivo L.Hofacker, Christoph Flamm, Universität Wien, AT Bärbel Stadler, Andreas Wernitznig, Universität Wien, AT Michael Kospach, Ulrike Langhammer, Ulrike Mückstein, Stefanie Widder Jan Cupal, Kurt Grünberger, Andreas Svrček-Seiler, Stefan Wuchty Ulrike Göbel, Institut für Molekulare Biotechnologie, Jena, GE Walter Grüner, Stefan Kopp, Jaqueline Weber
Evolution of Biomolecular Structure 2006 and RNA Secondary Structures in the Years to Come. Peter Schuster
Evolution of Biomolecular Structure 2006 and RNA Secondary Structures in the Years to Come Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe,
More informationHow Nature Circumvents Low Probabilities: The Molecular Basis of Information and Complexity. Peter Schuster
How Nature Circumvents Low Probabilities: The Molecular Basis of Information and Complexity Peter Schuster Institut für Theoretische Chemie Universität Wien, Austria Nonlinearity, Fluctuations, and Complexity
More informationIs the Concept of Error Catastrophy Relevant for Viruses? Peter Schuster
Is the Concept of Error Catastrophy Relevant for Viruses? Quasispecies and error thresholds on realistic landscapes Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa
More informationRNA From Mathematical Models to Real Molecules
RNA From Mathematical Models to Real Molecules 3. Optimization and Evolution of RNA Molecules Peter Schuster Institut für Theoretische hemie und Molekulare Strukturbiologie der Universität Wien IMPA enoma
More informationRNA Bioinformatics Beyond the One Sequence-One Structure Paradigm. Peter Schuster
RNA Bioinformatics Beyond the One Sequence-One Structure Paradigm Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA 2008 Molecular
More informationError thresholds on realistic fitness landscapes
Error thresholds on realistic fitness landscapes Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA Evolutionary Dynamics:
More informationSelf-Organization and Evolution
Self-Organization and Evolution Peter Schuster Institut für Theoretische hemie und Molekulare Strukturbiologie der Universität Wien Wissenschaftliche esellschaft: Dynamik Komplexität menschliche Systeme
More informationTracing the Sources of Complexity in Evolution. Peter Schuster
Tracing the Sources of Complexity in Evolution Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA Springer Complexity Lecture
More informationEvolution on simple and realistic landscapes
Evolution on simple and realistic landscapes An old story in a new setting Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA
More informationVon der Thermodynamik zu Selbstorganisation, Evolution und Information
Von der Thermodynamik zu Selbstorganisation, Evolution und Information Peter Schuster Institut für Theoretische hemie und Molekulare Strukturbiologie der Universität Wien Kolloquium des Physikalischen
More informationEvolution and Molecules
Evolution and Molecules Basic questions of biology seen with phsicists eyes. Peter Schuster Institut für Theoretische Chemie, niversität Wien, Österreich und The Santa Fe Institute, Santa Fe, New Mexico,
More informationComplexity in Evolutionary Processes
Complexity in Evolutionary Processes Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA 7th Vienna Central European Seminar
More informationMathematische Probleme aus den Life-Sciences
Mathematische Probleme aus den Life-Sciences Peter Schuster Institut für Theoretische Chemie und Molekulare Strukturbiologie der Universität Wien Vortragsreihe Mathematik im Betrieb Dornbirn, 27.05.2004
More informationDesigning RNA Structures
Designing RN Structures From Theoretical Models to Real Molecules Peter Schuster Institut für Theoretische hemie und Molekulare Strukturbiologie der niversität Wien Microbiology Seminar Mount Sinai School
More informationRNA From Mathematical Models to Real Molecules
R From Mathematical Models to Real Molecules 1. Sequences and Structures Peter Schuster Institut für Theoretische hemie und Molekulare Strukturbiologie der niversität Wien IMP enoma School Valdivia, 12.
More informationChemistry and Evolution at the Origin of Life. Visions and Reality
hemistry and Evolution at the rigin of Life Visions and Reality Peter Schuster Institut für Theoretische hemie und Molekulare Strukturbiologie der Universität Wien Madrid, Astrobiology Meeting 30.11.2001
More informationMathematical Modeling of Evolution
Mathematical Modeling of Evolution Solved and Open Problems Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA Emerging Modeling
More informationDifferent kinds of robustness in genetic and metabolic networks
Different kinds of robustness in genetic and metabolic networks Peter Schuster Institut für Theoretische hemie und Molekulare Strukturbiologie der Universität Wien Seminar lecture Linz, 15.12.2003 enomics
More informationHow computation has changed research in chemistry and biology
How computation has changed research in chemistry and biology Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA IWR - 25 Jahre-Jubiläum
More informationEvolution on Realistic Landscapes
Evolution on Realistic Landscapes Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA Santa Fe Institute Seminar Santa Fe, 22.05.2012
More informationThe Advantage of Using Mathematics in Biology
The Advantage of Using Mathematics in Biology Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA Erwin Schrödinger-Institut
More informationThe Role of Topology in the Study of Evolution
The Role of Topology in the Study of Evolution Avery Broome August 31, 2015 Abstract In this paper, we will attempt to understand the role topology plays in analyzing RNA secondary structures by providing
More informationCOMP598: Advanced Computational Biology Methods and Research
COMP598: Advanced Computational Biology Methods and Research Modeling the evolution of RNA in the sequence/structure network Jerome Waldispuhl School of Computer Science, McGill RNA world In prebiotic
More informationOrigin of life and early evolution in the light of present day molecular biology. Peter Schuster
Origin of life and early evolution in the light of present day molecular biology Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico,
More informationMechanisms of molecular cooperation
Mechanisms of molecular cooperation Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA Homo Sociobiologicus Evolution of human
More informationChemistry on the Early Earth
Chemistry on the Early Earth Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA Germany-Japan Round Table Heidelberg, 01. 03.11.2011
More informationChance and necessity in evolution: lessons from RNA
Physica D 133 (1999) 427 452 Chance and necessity in evolution: lessons from RNA Peter Schuster a,, Walter Fontana b,1 a Institut für Theoretische Chemie und Molekulare Strukturbiologie, Universität Wien,
More informationProblem solving by inverse methods in systems biology
Problem solving by inverse methods in systems biology Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA High-erformance comutational
More informationReplication and Mutation on Neutral Networks: Updated Version 2000
Replication and Mutation on Neutral Networks: Updated Version 2000 Christian Reidys Christian V. Forst Peter Schuster SFI WORKING PAPER: 2000-11-061 SFI Working Papers contain accounts of scientific work
More informationEvolution of Genotype-Phenotype mapping in a von Neumann Self-reproduction within the Platform of Tierra
Evolution of Genotype-Phenotype mapping in a von Neumann Self-reproduction within the Platform of Tierra Declan Baugh and Barry Mc Mullin The Rince Institute, Dublin City University, Ireland declan.baugh2@mail.dcu.ie,
More informationRNA evolution and Genotype to Phenotype maps
RNA evolution and Genotype to Phenotype maps E.S. Colizzi November 8, 2018 Introduction Biological evolution occurs in a population because 1) different genomes can generate different reproductive success
More informationEvolutionary Dynamics and Optimization. Neutral Networks as Model-Landscapes. for. RNA Secondary-Structure Folding-Landscapes
Evolutionary Dynamics and Optimization Neutral Networks as Model-Landscapes for RNA Secondary-Structure Folding-Landscapes Christian V. Forst, Christian Reidys, and Jacqueline Weber Mailing Address: Institut
More informationMolecular evolution - Part 1. Pawan Dhar BII
Molecular evolution - Part 1 Pawan Dhar BII Theodosius Dobzhansky Nothing in biology makes sense except in the light of evolution Age of life on earth: 3.85 billion years Formation of planet: 4.5 billion
More informationChapter 17. From Gene to Protein. Biology Kevin Dees
Chapter 17 From Gene to Protein DNA The information molecule Sequences of bases is a code DNA organized in to chromosomes Chromosomes are organized into genes What do the genes actually say??? Reflecting
More informationSystems biology and complexity research
Systems biology and complexity research Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA Interdisciplinary Challenges for
More informationWhen to use bit-wise neutrality
Nat Comput (010) 9:83 94 DOI 10.1007/s11047-008-9106-8 When to use bit-wise neutrality Tobias Friedrich Æ Frank Neumann Published online: 6 October 008 Ó Springer Science+Business Media B.V. 008 Abstract
More informationRNA folding at elementary step resolution
RNA (2000), 6:325 338+ Cambridge University Press+ Printed in the USA+ Copyright 2000 RNA Society+ RNA folding at elementary step resolution CHRISTOPH FLAMM, 1 WALTER FONTANA, 2,3 IVO L. HOFACKER, 1 and
More informationarxiv:physics/ v1 [physics.bio-ph] 27 Jun 2001
Maternal effects in molecular evolution Claus O. Wilke Digital Life Laboratory, Mail Code 36-93, Caltech, Pasadena, CA 925 wilke@caltech.edu (Printed: May 3, 27) arxiv:physics/693v [physics.bio-ph] 27
More information(Lys), resulting in translation of a polypeptide without the Lys amino acid. resulting in translation of a polypeptide without the Lys amino acid.
1. A change that makes a polypeptide defective has been discovered in its amino acid sequence. The normal and defective amino acid sequences are shown below. Researchers are attempting to reproduce the
More informationEVOLUTIONARY DYNAMICS ON RANDOM STRUCTURES SIMON M. FRASER CHRISTIAN M, REIDYS DISCLAIMER. United States Government or any agency thereof.
i LA-UR-, Title: Author@): Submitted io: EVOLUTONARY DYNAMCS ON RANDOM STRUCTURES SMON M. FRASER CHRSTAN M, REDYS OPTMZATON AND SSMULATWS CONFERENCE SNGAPORE SEPTEMBER 1-4, 1997 DSCLAMER This report was
More informationUNIT 5. Protein Synthesis 11/22/16
UNIT 5 Protein Synthesis IV. Transcription (8.4) A. RNA carries DNA s instruction 1. Francis Crick defined the central dogma of molecular biology a. Replication copies DNA b. Transcription converts DNA
More informationMajor questions of evolutionary genetics. Experimental tools of evolutionary genetics. Theoretical population genetics.
Evolutionary Genetics (for Encyclopedia of Biodiversity) Sergey Gavrilets Departments of Ecology and Evolutionary Biology and Mathematics, University of Tennessee, Knoxville, TN 37996-6 USA Evolutionary
More informationPlasticity, Evolvability, and Modularity in RNA
242 JOURNAL L. OF ANCEL EXPERIMENTAL AND W. FONTANA ZOOLOGY (MOL DEV EVOL) 288:242 283 (2000) Plasticity, Evolvability, and Modularity in RNA LAUREN W. ANCEL 1 AND WALTER FONTANA 2,3 * 1 Department of
More informationMATHEMATICAL MODELS - Vol. III - Mathematical Modeling and the Human Genome - Hilary S. Booth MATHEMATICAL MODELING AND THE HUMAN GENOME
MATHEMATICAL MODELING AND THE HUMAN GENOME Hilary S. Booth Australian National University, Australia Keywords: Human genome, DNA, bioinformatics, sequence analysis, evolution. Contents 1. Introduction:
More informationAPES C4L2 HOW DOES THE EARTH S LIFE CHANGE OVER TIME? Textbook pages 85 88
APES C4L2 HOW DOES THE EARTH S LIFE CHANGE OVER TIME? Textbook pages 85 88 Big Ideas Concept 4-2A The scientific theory of evolution explains how life on Earth changes over time through changes in the
More informationIIASA. Continuity in Evolution: On the Nature of Transitions INTERIM REPORT. IR / April
IIASA International Institute for Applied Systems Analysis A-2361 Laxenburg Austria Tel: +43 2236 807 Fax: +43 2236 71313 E-mail: info@iiasa.ac.at Web: www.iiasa.ac.at INTERIM REPORT IR-98-039 / April
More informationMolecular Modelling. part of Bioinformatik von RNA- und Proteinstrukturen. Sonja Prohaska. Leipzig, SS Computational EvoDevo University Leipzig
part of Bioinformatik von RNA- und Proteinstrukturen Computational EvoDevo University Leipzig Leipzig, SS 2011 Protein Structure levels or organization Primary structure: sequence of amino acids (from
More informationBridging from Chemistry to the Life Sciences Evolution seen with the Glasses of a Physicist a
Manfred Eigen-Lecture, Göttingen 09.05.2018 Bridging from Chemistry to the Life Sciences Evolution seen with the Glasses of a Physicist a Peter Schuster, Institut für Theoretische Chemie, Universität Wien
More informationEvolution and Design
Evolution and Design Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA Traunkirchner Gedankenexperimente Traunkirchen, 13.09.2005
More informationCurriculum Links. AQA GCE Biology. AS level
Curriculum Links AQA GCE Biology Unit 2 BIOL2 The variety of living organisms 3.2.1 Living organisms vary and this variation is influenced by genetic and environmental factors Causes of variation 3.2.2
More informationGenetical theory of natural selection
Reminders Genetical theory of natural selection Chapter 12 Natural selection evolution Natural selection evolution by natural selection Natural selection can have no effect unless phenotypes differ in
More information1. Contains the sugar ribose instead of deoxyribose. 2. Single-stranded instead of double stranded. 3. Contains uracil in place of thymine.
Protein Synthesis & Mutations RNA 1. Contains the sugar ribose instead of deoxyribose. 2. Single-stranded instead of double stranded. 3. Contains uracil in place of thymine. RNA Contains: 1. Adenine 2.
More informationThe Mathematics of Darwinian Systems
The Mathematics of Darwinian Systems By Peter Schuster Abstract: Optimization is studied as the interplay of selection, recombination and mutation. The underlying model is based on ordinary differential
More informationEvolutionary dynamics of populations with genotype-phenotype map
Evolutionary dynamics of populations with genotype-phenotype map Esther Ibáñez Marcelo, Tomas Alarcon Cor Biomat 2013: Mathematics of Planet Earth CENTRE DE RECERCA MATEMÀTICA 17-21 June 2013 Esther Ibáñez
More informationLecture 7: Simple genetic circuits I
Lecture 7: Simple genetic circuits I Paul C Bressloff (Fall 2018) 7.1 Transcription and translation In Fig. 20 we show the two main stages in the expression of a single gene according to the central dogma.
More informationFrom gene to protein. Premedical biology
From gene to protein Premedical biology Central dogma of Biology, Molecular Biology, Genetics transcription replication reverse transcription translation DNA RNA Protein RNA chemically similar to DNA,
More informationFull file at CHAPTER 2 Genetics
CHAPTER 2 Genetics MULTIPLE CHOICE 1. Chromosomes are a. small linear bodies. b. contained in cells. c. replicated during cell division. 2. A cross between true-breeding plants bearing yellow seeds produces
More informationCHAPTER 23 THE EVOLUTIONS OF POPULATIONS. Section C: Genetic Variation, the Substrate for Natural Selection
CHAPTER 23 THE EVOLUTIONS OF POPULATIONS Section C: Genetic Variation, the Substrate for Natural Selection 1. Genetic variation occurs within and between populations 2. Mutation and sexual recombination
More informationCritical Mutation Rate Has an Exponential Dependence on Population Size
Critical Mutation Rate Has an Exponential Dependence on Population Size Alastair Channon 1, Elizabeth Aston 1, Charles Day 1, Roman V. Belavkin 2 and Christopher G. Knight 3 1 Research Institute for the
More informationTypes of RNA. 1. Messenger RNA(mRNA): 1. Represents only 5% of the total RNA in the cell.
RNAs L.Os. Know the different types of RNA & their relative concentration Know the structure of each RNA Understand their functions Know their locations in the cell Understand the differences between prokaryotic
More informationRNA & PROTEIN SYNTHESIS. Making Proteins Using Directions From DNA
RNA & PROTEIN SYNTHESIS Making Proteins Using Directions From DNA RNA & Protein Synthesis v Nitrogenous bases in DNA contain information that directs protein synthesis v DNA remains in nucleus v in order
More informationThe Origin of Life on Earth
Study Guide The Origin of Life on Earth Checking Your Knowledge You should be able to write out the definitions to each of the following terms in your own words: abiotic Miller-Urey experiment ribozyme
More informationChapter 8: Introduction to Evolutionary Computation
Computational Intelligence: Second Edition Contents Some Theories about Evolution Evolution is an optimization process: the aim is to improve the ability of an organism to survive in dynamically changing
More informationEVOLUTIONARY DYNAMICS AND THE EVOLUTION OF MULTIPLAYER COOPERATION IN A SUBDIVIDED POPULATION
Friday, July 27th, 11:00 EVOLUTIONARY DYNAMICS AND THE EVOLUTION OF MULTIPLAYER COOPERATION IN A SUBDIVIDED POPULATION Karan Pattni karanp@liverpool.ac.uk University of Liverpool Joint work with Prof.
More informationSECOND PUBLIC EXAMINATION. Honour School of Physics Part C: 4 Year Course. Honour School of Physics and Philosophy Part C C7: BIOLOGICAL PHYSICS
2757 SECOND PUBLIC EXAMINATION Honour School of Physics Part C: 4 Year Course Honour School of Physics and Philosophy Part C C7: BIOLOGICAL PHYSICS TRINITY TERM 2013 Monday, 17 June, 2.30 pm 5.45 pm 15
More informationNeutral Evolution of Mutational Robustness
Neutral Evolution of Mutational Robustness Erik van Nimwegen James P. Crutchfield Martijn Huynen SFI WORKING PAPER: 1999-03-021 SFI Working Papers contain accounts of scientific work of the author(s) and
More informationQuantifying slow evolutionary dynamics in RNA fitness landscapes
Zurich Open Repository and Archive University of Zurich Main Library Strickhofstrasse 39 CH-8057 Zurich www.zora.uzh.ch Year: 2010 Quantifying slow evolutionary dynamics in RNA fitness landscapes Sulc,
More informationExercise 3 Exploring Fitness and Population Change under Selection
Exercise 3 Exploring Fitness and Population Change under Selection Avidians descended from ancestors with different adaptations are competing in a selective environment. Can we predict how natural selection
More informationarxiv: v1 [q-bio.bm] 31 Oct 2017
arxiv:1711.10549v1 [q-bio.bm] 31 Oct 2017 Doc-Start Structural bioinformatics Bioinformatics doi.10.1093/bioinformatics/xxxxxx Advance Access Publication Date: Day Month Year Manuscript Category An efficient
More informationQuasispecies distribution of Eigen model
Vol 16 No 9, September 2007 c 2007 Chin. Phys. Soc. 1009-1963/2007/16(09)/2600-08 Chinese Physics and IOP Publishing Ltd Quasispecies distribution of Eigen model Chen Jia( ), Li Sheng( ), and Ma Hong-Ru(
More informationComplete Suboptimal Folding of RNA and the Stability of Secondary Structures
Stefan Wuchty 1 Walter Fontana 1,2 Ivo L. Hofacker 1 Peter Schuster 1,2 1 Institut für Theoretische Chemie, Universität Wien, Währingerstrasse 17, A-1090 Wien, Austria Complete Suboptimal Folding of RNA
More informationGENE ACTIVITY Gene structure Transcription Transcript processing mrna transport mrna stability Translation Posttranslational modifications
1 GENE ACTIVITY Gene structure Transcription Transcript processing mrna transport mrna stability Translation Posttranslational modifications 2 DNA Promoter Gene A Gene B Termination Signal Transcription
More informationThe Topology of the Possible: Formal Spaces Underlying Patterns of Evolutionary Change
The Topology of the Possible: Formal Spaces Underlying Patterns of Evolutionary Change Bärbel M. R. Stadler Peter F. Stadler Günter P. Wagner Walter Fontana SFI WORKING PAPER: 2000-12-070 SFI Working Papers
More informationCell Growth and Genetics
Cell Growth and Genetics Cell Division (Mitosis) Cell division results in two identical daughter cells. The process of cell divisions occurs in three parts: Interphase - duplication of chromosomes and
More informationWhy EvoSysBio? Combine the rigor from two powerful quantitative modeling traditions: Molecular Systems Biology. Evolutionary Biology
Why EvoSysBio? Combine the rigor from two powerful quantitative modeling traditions: Molecular Systems Biology rigorous models of molecules... in organisms Modeling Evolutionary Biology rigorous models
More informationPeter Schuster, Institut für Theoretische Chemie der Universität Wien, Austria Darwin s Optimization in the looking glasses of physics and chemistry
Peter Schuster, Institut für Theoretische Chemie der Universität Wien, Austria Darwin s Optimization in the looking glasses of physics and chemistry Prologue The traditions of scientific research in physics
More informationProblems on Evolutionary dynamics
Problems on Evolutionary dynamics Doctoral Programme in Physics José A. Cuesta Lausanne, June 10 13, 2014 Replication 1. Consider the Galton-Watson process defined by the offspring distribution p 0 =
More informationThe Phenotype-Genotype- Phenotype (PGP) Map. Nayely Velez-Cruz and Dr. Manfred Laubichler
The Phenotype-Genotype- Phenotype (PGP) Map Nayely Velez-Cruz and Dr. Manfred Laubichler Overview 1. The role of the genotype to phenotype map in current evolutionary theory 2. Origins of phenotypic variation
More informationReading Assignments. A. Genes and the Synthesis of Polypeptides. Lecture Series 7 From DNA to Protein: Genotype to Phenotype
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
More informationGCD3033:Cell Biology. Transcription
Transcription Transcription: DNA to RNA A) production of complementary strand of DNA B) RNA types C) transcription start/stop signals D) Initiation of eukaryotic gene expression E) transcription factors
More informationObjective 3.01 (DNA, RNA and Protein Synthesis)
Objective 3.01 (DNA, RNA and Protein Synthesis) DNA Structure o Discovered by Watson and Crick o Double-stranded o Shape is a double helix (twisted ladder) o Made of chains of nucleotides: o Has four types
More informationQUANTIFYING SLOW EVOLUTIONARY DYNAMICS IN RNA FITNESS LANDSCAPES
Journal of Bioinformatics and Computational Biology Vol. 8, No. 6 (2010) 1027 1040 c Imperial College Press DOI: 10.1142/S0219720010005075 QUANTIFYING SLOW EVOLUTIONARY DYNAMICS IN RNA FITNESS LANDSCAPES
More informationSI Appendix. 1. A detailed description of the five model systems
SI Appendix The supporting information is organized as follows: 1. Detailed description of all five models. 1.1 Combinatorial logic circuits composed of NAND gates (model 1). 1.2 Feed-forward combinatorial
More informationComputational Biology: Basics & Interesting Problems
Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information
More informationGenetics 304 Lecture 6
Genetics 304 Lecture 6 00/01/27 Assigned Readings Busby, S. and R.H. Ebright (1994). Promoter structure, promoter recognition, and transcription activation in prokaryotes. Cell 79:743-746. Reed, W.L. and
More informationMutation, Selection, Gene Flow, Genetic Drift, and Nonrandom Mating Results in Evolution
Mutation, Selection, Gene Flow, Genetic Drift, and Nonrandom Mating Results in Evolution 15.2 Intro In biology, evolution refers specifically to changes in the genetic makeup of populations over time.
More informationSystems Biology: A Personal View IX. Landscapes. Sitabhra Sinha IMSc Chennai
Systems Biology: A Personal View IX. Landscapes Sitabhra Sinha IMSc Chennai Fitness Landscapes Sewall Wright pioneered the description of how genotype or phenotypic fitness are related in terms of a fitness
More informationCasting Polymer Nets To Optimize Molecular Codes
Casting Polymer Nets To Optimize Molecular Codes The physical language of molecules Mathematical Biology Forum (PRL 2007, PNAS 2008, Phys Bio 2008, J Theo Bio 2007, E J Lin Alg 2007) Biological information
More informationCelloS: a Multi-level Approach to Evolutionary Dynamics
CelloS: a Multi-level Approach to Evolutionary Dynamics Camille Stephan-Otto Attolini 1, Peter F. Stadler 12, and Christoph Flamm 1 1 Institut für Theoretische Chemie, Universität Wien, Währingerstraße
More informationThe role of form in molecular biology. Conceptual parallelism with developmental and evolutionary biology
The role of form in molecular biology Conceptual parallelism with developmental and evolutionary biology Laura Nuño de la Rosa (UCM & IHPST) KLI Brown Bag talks 2008 The irreducibility of biological form
More informationMetastable Evolutionary Dynamics: Crossing Fitness Barriers or Escaping via Neutral Paths?
Metastable Evolutionary Dynamics: Crossing Fitness Barriers or Escaping via Neutral Paths? Erik van Nimwegen James P. Crutchfield SFI WORKING PAPER: 1999-07-041 SFI Working Papers contain accounts of scientific
More informationThe Amoeba-Flagellate Transformation
The Amoeba-Flagellate Transformation Camille Stephan-Otto Attolini Institute for Theoretical Chemistry and Structural Biology, Vienna University, Austria Bled, Slovenia. March, 2005 The Amoeba-Flagellate
More informationarxiv:physics/ v1 [physics.bio-ph] 19 Apr 2000
Optimal Mutation Rates in Dynamic Environments Martin Nilsson Santa Fe Institute, 1399 Hyde Park Road, Santa Fe, New Mexico 87501 USA Institute of Theoretical Physics, Chalmers University of Technology
More informationHaploid & diploid recombination and their evolutionary impact
Haploid & diploid recombination and their evolutionary impact W. Garrett Mitchener College of Charleston Mathematics Department MitchenerG@cofc.edu http://mitchenerg.people.cofc.edu Introduction The basis
More informationMultiple Choice Review- Eukaryotic Gene Expression
Multiple Choice Review- Eukaryotic Gene Expression 1. Which of the following is the Central Dogma of cell biology? a. DNA Nucleic Acid Protein Amino Acid b. Prokaryote Bacteria - Eukaryote c. Atom Molecule
More informationGenetic Algorithms. Donald Richards Penn State University
Genetic Algorithms Donald Richards Penn State University Easy problem: Find the point which maximizes f(x, y) = [16 x(1 x)y(1 y)] 2, x, y [0,1] z (16*x*y*(1-x)*(1-y))**2 0.829 0.663 0.497 0.331 0.166 1
More informationVom Modell zur Steuerung
Vom Modell zur Steuerung Sind wir überfordert von der Komplexität der Welt? Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria und The Santa Fe Institute, Santa Fe, New Mexico,
More informationRIBOSOME: THE ENGINE OF THE LIVING VON NEUMANN S CONSTRUCTOR
RIBOSOME: THE ENGINE OF THE LIVING VON NEUMANN S CONSTRUCTOR IAS 2012 Von Neumann s universal constructor Self-reproducing machine: constructor + tape (1948/9). Program on tape: (i) retrieve parts from
More informationThe RNA World, Fitness Landscapes, and all that
The RN World, Fitness Landscapes, and all that Peter F. Stadler Bioinformatics roup, Dept. of omputer Science & Interdisciplinary enter for Bioinformatics, niversity of Leipzig RNomics roup, Fraunhofer
More informationDarwin's theory of natural selection, its rivals, and cells. Week 3 (finish ch 2 and start ch 3)
Darwin's theory of natural selection, its rivals, and cells Week 3 (finish ch 2 and start ch 3) 1 Historical context Discovery of the new world -new observations challenged long-held views -exposure to
More information