BIOINFORMATICS TRIAL EXAMINATION MASTERS KT-OR
|
|
- Lester Mark Stevenson
- 5 years ago
- Views:
Transcription
1 BIOINFORMATICS KT Maastricht University Faculty of Humanities and Science Knowledge Engineering Study TRIAL EXAMINATION MASTERS KT-OR Examiner: R.L. Westra Date: March 30, 2007 Time: 13:30 15:30 Place: TS06, room Notes: 1. The exam is an open-book exam. 2. The textbooks and lecture slides can be used during the exam. 3. The exam consists of x pages (including this page). 4. The exam time is 3 hours (180 minutes). 5. The number of exam questions is The number of points for each question is given (in bold). 7. The maximum number of points is The final exam grade is the sum of the points of the questions answered correctly. 9. The final course grade is the sum of the final exam grade plus the bonus grade that you earned from the student lectures, mini-exams, and skills class hand-ins. The final course grade will be rounded to Before answering the questions, please first read all the exam questions, and then make a plan to spend the three hours. 11. When answer the questions please do not forget: to write your name and student number on each answer page; to number the answers; and to number the answer pages. 1
2 EXERCISE 1: Short questions: 2 points i. What is a change point, and how could you detect it? ii. What is the importance of the KA/KS ratio? iii. How can you find the root on an unrooted phylogenetic tree? iv. Which operations on a chromosome can change block synteny? v. Why is average linkage better than single linkage? EXERCISE 2: Statistical sequence analysis: 2 points Suppose that we analyse a DNA sequence with the following observed multinomial distribution: p(a) = 0.5 p(c) = 0.1 p(g) = 0.3 p(t) = 0.1 Moreover, suppose that we also observe the following di-nucleotide frequencies: *A *C *G *T A* C* G* T* Use this information to determine unusual dimers (=di-nucleotides). 2
3 EXERCISE 3: Genetic distance: 2 points As the time of divergence between two sequences grows, the count of differences, d, increases. The true genetic distance, K, between the sequences, however, is not equal to d. a. Explain this phenomenon and describe a method for correcting d to estimate K. b. Describe how the role of transitions and transversions can improve this estimate for K. c. Suppose that two sequences of equal length of 1000 nucleotides, differ at 150 positions. Estimate, following the Jukes- Cantor model, the true genetic distance K, including the magnitude of the error. d. Determine when, for two sequences of equal lengths n, following the Jukes- Cantor model, determining the genetic distance becomes entire inconclusive because the variance exceeds the estimate K. EXERCISE 4: Sequence alignment: 2 points In sequence alignment sequences are compared in order to determine their degree of resemblance. a. Describe the difference(s) between local and global alignment. Suppose that in global alignment we use the following simple scoring function: σ(-,a) = σ(a,-) = σ(a,b) = -1 for all a b σ(a,b) = 1 if a = b for all letters a,b in {A,C,G,T}, and with - representing an indel. Now, suppose we have the following two amino acid sequences: s 1 = FILM s 1 = FEIM b. Write down the dynamic programming table resulting from the global alignment of the two strings s 1 and s 2 using the Needleman-Wunsch algorithm. c. Write down the optimal global alignment of s 1 and s 2 according to the dynamic programming table obtained above. 3
4 EXERCISE 5: Hidden Markov model: 2 points Consider an odorant receptor, i.e. a protein molecule that sticks in the cell membrane, extending in both the interior and exterior of the cell. This is visualised in the picture below, where the fat curved line represents the folded protein. The floating of this molecule in the cell mebrane is caused by parts of the molecule that likes to be in the membrane (hydrophylic) and parts that definitily not like this (hydrophobic). Therefore, we consider that a part of the molecule can be in two states: H + = hydrophylic, and H = hydrophobic. We employ a Hidden Markov model to estimate the hydrophobic and hydrophylic parts of the molecule, represented as: H H A: 0.1 R: 0.2 N: 0 D: 0.5 C: 0.2 A: 0.3 R: 0.2 N: 0.4 D: 0 C: 0.1 Suppose that we have the following protein sequence: NARNRDCCRN Determine the most likeli hidden sequence of hydrophobicity-states over the molecule using the Viterbi algorithm. 4
5 ANSWERS ANSWER to EXERCISE 1 Look in book ANSWER to EXERCISE 2 Divifde each possition p2[i,j] by p1[i]*p1[j] and look where this deviates considerably from 1. ANSWER to EXERCISE 3: The Jukes - Cantor Correction As the time of divergence between two sequences increases the probability of a second substitution at any one nucleotide site increases and the increase in the count of differences is slowed. This makes these counts not a desirable measure of distance. In some way, this slow down must be accounted for. The solution to this problem was first noted by Jukes and Cantor (1969; Evol.of Protein Molecules, Academic Press). Instead of calculating distance as a simple count take the distance as (Kimura and Ohta 1972; J.Mol.Evol.2:87-90). A plot of this function for the same range of parameters as in Figure 1 is given in Figure 2. This figure shows that this distance measure increases linearly with time (this is one property that is desirable for a distance measure). This is termed the Jukes & Cantor correction to distance and clearly indicates that divergence is a logarithmic function of time. Observe the large increase in the variance as time increases. As D gets closer and closer over time to 0.75 the variance increases. In the limit as D approaches 0.75, the variance approaches infinity. This is an indication that the measure of distance becomes increasingly less reliable as time increases. Note that in expectation D is less than 0.75 but in reality D can be greater than If this is the case then a Jukes-Cantor correction cannot be done - is undefined because the argument of the logarithm will be zero. In this case you can apply a method developed by Tajima (1993, MBE 10: ). He suggests using the modified estimator 5
6 where and With variance This is actually just a different formulation of the same quantity using a Taylor series expansion to avoid the logarithm. This estimator of distance is defined for all parameter values and actually has less bias than Jukes and Cantor's original correction for small levels of divergence. 6
7 a: Jukes-Cantor b: Kimura 2-param c: d = 150/1000 => K = , Var K ~ *10-4, => error = n*sqrt(vark) = 1000*V ~ => K = 167 +/- 14 d. n = -d(1-d)/((1-4d/3)^2ln(1-4d/3)) ANSWER to EXERCISE 4 a. book b. See book pages 55-58, esp p58 c. F I L M I I I F E I - M ANSWER to EXERCISE 5 See book page 75 7
Quantifying sequence similarity
Quantifying sequence similarity Bas E. Dutilh Systems Biology: Bioinformatic Data Analysis Utrecht University, February 16 th 2016 After this lecture, you can define homology, similarity, and identity
More informationPOPULATION GENETICS Winter 2005 Lecture 17 Molecular phylogenetics
POPULATION GENETICS Winter 2005 Lecture 17 Molecular phylogenetics - in deriving a phylogeny our goal is simply to reconstruct the historical relationships between a group of taxa. - before we review the
More informationLecture 4: Evolutionary Models and Substitution Matrices (PAM and BLOSUM)
Bioinformatics II Probability and Statistics Universität Zürich and ETH Zürich Spring Semester 2009 Lecture 4: Evolutionary Models and Substitution Matrices (PAM and BLOSUM) Dr Fraser Daly adapted from
More informationSara C. Madeira. Universidade da Beira Interior. (Thanks to Ana Teresa Freitas, IST for useful resources on this subject)
Bioinformática Sequence Alignment Pairwise Sequence Alignment Universidade da Beira Interior (Thanks to Ana Teresa Freitas, IST for useful resources on this subject) 1 16/3/29 & 23/3/29 27/4/29 Outline
More informationAmira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut
Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic analysis Phylogenetic Basics: Biological
More informationEECS730: Introduction to Bioinformatics
EECS730: Introduction to Bioinformatics Lecture 07: profile Hidden Markov Model http://bibiserv.techfak.uni-bielefeld.de/sadr2/databasesearch/hmmer/profilehmm.gif Slides adapted from Dr. Shaojie Zhang
More informationLecture 4: Evolutionary models and substitution matrices (PAM and BLOSUM).
1 Bioinformatics: In-depth PROBABILITY & STATISTICS Spring Semester 2011 University of Zürich and ETH Zürich Lecture 4: Evolutionary models and substitution matrices (PAM and BLOSUM). Dr. Stefanie Muff
More informationSequence Analysis 17: lecture 5. Substitution matrices Multiple sequence alignment
Sequence Analysis 17: lecture 5 Substitution matrices Multiple sequence alignment Substitution matrices Used to score aligned positions, usually of amino acids. Expressed as the log-likelihood ratio of
More informationDr. Amira A. AL-Hosary
Phylogenetic analysis Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic Basics: Biological
More informationLecture Notes: Markov chains
Computational Genomics and Molecular Biology, Fall 5 Lecture Notes: Markov chains Dannie Durand At the beginning of the semester, we introduced two simple scoring functions for pairwise alignments: a similarity
More informationAlgorithms in Bioinformatics FOUR Pairwise Sequence Alignment. Pairwise Sequence Alignment. Convention: DNA Sequences 5. Sequence Alignment
Algorithms in Bioinformatics FOUR Sami Khuri Department of Computer Science San José State University Pairwise Sequence Alignment Homology Similarity Global string alignment Local string alignment Dot
More informationMaximum Likelihood Until recently the newest method. Popularized by Joseph Felsenstein, Seattle, Washington.
Maximum Likelihood This presentation is based almost entirely on Peter G. Fosters - "The Idiot s Guide to the Zen of Likelihood in a Nutshell in Seven Days for Dummies, Unleashed. http://www.bioinf.org/molsys/data/idiots.pdf
More information"Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky
MOLECULAR PHYLOGENY "Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky EVOLUTION - theory that groups of organisms change over time so that descendeants differ structurally
More informationLecture 24. Phylogeny methods, part 4 (Models of DNA and protein change) p.1/22
Lecture 24. Phylogeny methods, part 4 (Models of DNA and protein change) Joe Felsenstein Department of Genome Sciences and Department of Biology Lecture 24. Phylogeny methods, part 4 (Models of DNA and
More informationComputational Biology: Basics & Interesting Problems
Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information
More informationSTRUCTURAL BIOINFORMATICS I. Fall 2015
STRUCTURAL BIOINFORMATICS I Fall 2015 Info Course Number - Classification: Biology 5411 Class Schedule: Monday 5:30-7:50 PM, SERC Room 456 (4 th floor) Instructors: Vincenzo Carnevale - SERC, Room 704C;
More informationUnderstanding relationship between homologous sequences
Molecular Evolution Molecular Evolution How and when were genes and proteins created? How old is a gene? How can we calculate the age of a gene? How did the gene evolve to the present form? What selective
More informationHow Molecules Evolve. Advantages of Molecular Data for Tree Building. Advantages of Molecular Data for Tree Building
How Molecules Evolve Guest Lecture: Principles and Methods of Systematic Biology 11 November 2013 Chris Simon Approaching phylogenetics from the point of view of the data Understanding how sequences evolve
More informationSome of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks!
Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks! Paul has many great tools for teaching phylogenetics at his web site: http://hydrodictyon.eeb.uconn.edu/people/plewis
More informationUsing algebraic geometry for phylogenetic reconstruction
Using algebraic geometry for phylogenetic reconstruction Marta Casanellas i Rius (joint work with Jesús Fernández-Sánchez) Departament de Matemàtica Aplicada I Universitat Politècnica de Catalunya IMA
More informationEvolutionary Analysis of Viral Genomes
University of Oxford, Department of Zoology Evolutionary Biology Group Department of Zoology University of Oxford South Parks Road Oxford OX1 3PS, U.K. Fax: +44 1865 271249 Evolutionary Analysis of Viral
More informationLecture 4. Models of DNA and protein change. Likelihood methods
Lecture 4. Models of DNA and protein change. Likelihood methods Joe Felsenstein Department of Genome Sciences and Department of Biology Lecture 4. Models of DNA and protein change. Likelihood methods p.1/36
More informationUsing Bioinformatics to Study Evolutionary Relationships Instructions
3 Using Bioinformatics to Study Evolutionary Relationships Instructions Student Researcher Background: Making and Using Multiple Sequence Alignments One of the primary tasks of genetic researchers is comparing
More informationLecture 27. Phylogeny methods, part 4 (Models of DNA and protein change) p.1/26
Lecture 27. Phylogeny methods, part 4 (Models of DNA and protein change) Joe Felsenstein Department of Genome Sciences and Department of Biology Lecture 27. Phylogeny methods, part 4 (Models of DNA and
More informationSyllabus of BIOINF 528 (2017 Fall, Bioinformatics Program)
Syllabus of BIOINF 528 (2017 Fall, Bioinformatics Program) Course Name: Structural Bioinformatics Course Description: Instructor: This course introduces fundamental concepts and methods for structural
More informationAdditive distances. w(e), where P ij is the path in T from i to j. Then the matrix [D ij ] is said to be additive.
Additive distances Let T be a tree on leaf set S and let w : E R + be an edge-weighting of T, and assume T has no nodes of degree two. Let D ij = e P ij w(e), where P ij is the path in T from i to j. Then
More informationMassachusetts Institute of Technology Computational Evolutionary Biology, Fall, 2005 Notes for November 7: Molecular evolution
Massachusetts Institute of Technology 6.877 Computational Evolutionary Biology, Fall, 2005 Notes for November 7: Molecular evolution 1. Rates of amino acid replacement The initial motivation for the neutral
More information进化树构建方法的概率方法 第 4 章 : 进化树构建的概率方法 问题介绍. 部分 lid 修改自 i i f l 的 ih l i
第 4 章 : 进化树构建的概率方法 问题介绍 进化树构建方法的概率方法 部分 lid 修改自 i i f l 的 ih l i 部分 Slides 修改自 University of Basel 的 Michael Springmann 课程 CS302 Seminar Life Science Informatics 的讲义 Phylogenetic Tree branch internal node
More informationMarkov Models & DNA Sequence Evolution
7.91 / 7.36 / BE.490 Lecture #5 Mar. 9, 2004 Markov Models & DNA Sequence Evolution Chris Burge Review of Markov & HMM Models for DNA Markov Models for splice sites Hidden Markov Models - looking under
More informationTest 3 Version A. On my honor, I have neither given nor received inappropriate or unauthorized information at any time before or during this test.
Student s Printed Name: Instructor: CUID: Section: Instructions: You are not permitted to use a calculator on any portion of this test. You are not allowed to use any textbook, notes, cell phone, laptop,
More informationTest 3 Version A. On my honor, I have neither given nor received inappropriate or unauthorized information at any time before or during this test.
Student s Printed Name: Instructor: CUID: Section: Instructions: You are not permitted to use a calculator on any portion of this test. You are not allowed to use any textbook, notes, cell phone, laptop,
More informationPairwise & Multiple sequence alignments
Pairwise & Multiple sequence alignments Urmila Kulkarni-Kale Bioinformatics Centre 411 007 urmila@bioinfo.ernet.in Basis for Sequence comparison Theory of evolution: gene sequences have evolved/derived
More informationMA EXAM 3 INSTRUCTIONS VERSION 01 April 18, Section # and recitation time
MA 16600 EXAM 3 INSTRUCTIONS VERSION 01 April 18, 2018 Your name Student ID # Your TA s name Section # and recitation time 1. You must use a #2 pencil on the scantron sheet (answer sheet). 2. Check that
More informationHidden Markov Models
Hidden Markov Models Slides revised and adapted to Bioinformática 55 Engª Biomédica/IST 2005 Ana Teresa Freitas CG-Islands Given 4 nucleotides: probability of occurrence is ~ 1/4. Thus, probability of
More informationTree Building Activity
Tree Building Activity Introduction In this activity, you will construct phylogenetic trees using a phenotypic similarity (cartoon microbe pictures) and genotypic similarity (real microbe sequences). For
More informationMotivating the need for optimal sequence alignments...
1 Motivating the need for optimal sequence alignments... 2 3 Note that this actually combines two objectives of optimal sequence alignments: (i) use the score of the alignment o infer homology; (ii) use
More informationNucleotide substitution models
Nucleotide substitution models Alexander Churbanov University of Wyoming, Laramie Nucleotide substitution models p. 1/23 Jukes and Cantor s model [1] The simples symmetrical model of DNA evolution All
More informationLab 3: Practical Hidden Markov Models (HMM)
Advanced Topics in Bioinformatics Lab 3: Practical Hidden Markov Models () Maoying, Wu Department of Bioinformatics & Biostatistics Shanghai Jiao Tong University November 27, 2014 Hidden Markov Models
More informationCREATING PHYLOGENETIC TREES FROM DNA SEQUENCES
INTRODUCTION CREATING PHYLOGENETIC TREES FROM DNA SEQUENCES This worksheet complements the Click and Learn developed in conjunction with the 2011 Holiday Lectures on Science, Bones, Stones, and Genes:
More informationFirst generation sequencing and pairwise alignment (High-tech, not high throughput) Analysis of Biological Sequences
First generation sequencing and pairwise alignment (High-tech, not high throughput) Analysis of Biological Sequences 140.638 where do sequences come from? DNA is not hard to extract (getting DNA from a
More informationModeling Noise in Genetic Sequences
Modeling Noise in Genetic Sequences M. Radavičius 1 and T. Rekašius 2 1 Institute of Mathematics and Informatics, Vilnius, Lithuania 2 Vilnius Gediminas Technical University, Vilnius, Lithuania 1. Introduction:
More informationMolecular Evolution, course # Final Exam, May 3, 2006
Molecular Evolution, course #27615 Final Exam, May 3, 2006 This exam includes a total of 12 problems on 7 pages (including this cover page). The maximum number of points obtainable is 150, and at least
More informationWithout fully opening the exam, check that you have pages 1 through 12.
MTH 33 Exam 2 November 4th, 208 Name: Section: Recitation Instructor: INSTRUCTIONS Fill in your name, etc. on this first page. Without fully opening the exam, check that you have pages through 2. Show
More informationEVOLUTIONARY DISTANCE MODEL BASED ON DIFFERENTIAL EQUATION AND MARKOV PROCESS
August 0 Vol 4 No 005-0 JATIT & LLS All rights reserved ISSN: 99-8645 wwwjatitorg E-ISSN: 87-95 EVOLUTIONAY DISTANCE MODEL BASED ON DIFFEENTIAL EUATION AND MAKOV OCESS XIAOFENG WANG College of Mathematical
More information7.36/7.91 recitation CB Lecture #4
7.36/7.91 recitation 2-19-2014 CB Lecture #4 1 Announcements / Reminders Homework: - PS#1 due Feb. 20th at noon. - Late policy: ½ credit if received within 24 hrs of due date, otherwise no credit - Answer
More informationLecture 3: Markov chains.
1 BIOINFORMATIK II PROBABILITY & STATISTICS Summer semester 2008 The University of Zürich and ETH Zürich Lecture 3: Markov chains. Prof. Andrew Barbour Dr. Nicolas Pétrélis Adapted from a course by Dr.
More informationWithout fully opening the exam, check that you have pages 1 through 12.
Name: Section: Recitation Instructor: INSTRUCTIONS Fill in your name, etc. on this first page. Without fully opening the exam, check that you have pages through 2. Show all your work on the standard response
More informationBioinformatics 1. Sepp Hochreiter. Biology, Sequences, Phylogenetics Part 4. Bioinformatics 1: Biology, Sequences, Phylogenetics
Bioinformatics 1 Biology, Sequences, Phylogenetics Part 4 Sepp Hochreiter Klausur Mo. 30.01.2011 Zeit: 15:30 17:00 Raum: HS14 Anmeldung Kusss Contents Methods and Bootstrapping of Maximum Methods Methods
More informationPhylogenetic inference
Phylogenetic inference Bas E. Dutilh Systems Biology: Bioinformatic Data Analysis Utrecht University, March 7 th 016 After this lecture, you can discuss (dis-) advantages of different information types
More informationMA EXAM 3 Form A November 12, You must use a #2 pencil on the mark sense sheet (answer sheet).
MA 6200 EXAM 3 Form A November 2, 205 NAME STUDENT ID # YOUR TA S NAME RECITATION TIME. You must use a #2 pencil on the mark sense sheet (answer sheet). 2. If the cover of your question booklet is GREEN,
More informationMA EXAM 3 Form A April 16, You must use a #2 pencil on the mark sense sheet (answer sheet).
MA 16200 EXAM Form A April 16, 2015 NAME STUDENT ID # YOUR TA S NAME RECITATION TIME 1. You must use a #2 pencil on the mark sense sheet (answer sheet). 2. If the cover of your question booklet is GREEN,
More informationPhylogenetics: Building Phylogenetic Trees
1 Phylogenetics: Building Phylogenetic Trees COMP 571 Luay Nakhleh, Rice University 2 Four Questions Need to be Answered What data should we use? Which method should we use? Which evolutionary model should
More informationStatistics 992 Continuous-time Markov Chains Spring 2004
Summary Continuous-time finite-state-space Markov chains are stochastic processes that are widely used to model the process of nucleotide substitution. This chapter aims to present much of the mathematics
More informationTest 3 - Answer Key Version B
Student s Printed Name: Instructor: CUID: Section: Instructions: You are not permitted to use a calculator on any portion of this test. You are not allowed to use any textbook, notes, cell phone, laptop,
More informationPhylogenetic Trees. What They Are Why We Do It & How To Do It. Presented by Amy Harris Dr Brad Morantz
Phylogenetic Trees What They Are Why We Do It & How To Do It Presented by Amy Harris Dr Brad Morantz Overview What is a phylogenetic tree Why do we do it How do we do it Methods and programs Parallels
More informationWithout fully opening the exam, check that you have pages 1 through 12.
MTH 33 Exam 2 April th, 208 Name: Section: Recitation Instructor: INSTRUCTIONS Fill in your name, etc. on this first page. Without fully opening the exam, check that you have pages through 2. Show all
More informationConstructing Evolutionary/Phylogenetic Trees
Constructing Evolutionary/Phylogenetic Trees 2 broad categories: Distance-based methods Ultrametric Additive: UPGMA Transformed Distance Neighbor-Joining Character-based Maximum Parsimony Maximum Likelihood
More informationEVOLUTIONARY DISTANCES
EVOLUTIONARY DISTANCES FROM STRINGS TO TREES Luca Bortolussi 1 1 Dipartimento di Matematica ed Informatica Università degli studi di Trieste luca@dmi.units.it Trieste, 14 th November 2007 OUTLINE 1 STRINGS:
More informationWithout fully opening the exam, check that you have pages 1 through 13.
MTH 33 Solutions to Exam November th, 08 Name: Section: Recitation Instructor: INSTRUCTIONS Fill in your name, etc. on this first page. Without fully opening the exam, check that you have pages through
More informationWhat Is Conservation?
What Is Conservation? Lee A. Newberg February 22, 2005 A Central Dogma Junk DNA mutates at a background rate, but functional DNA exhibits conservation. Today s Question What is this conservation? Lee A.
More informationReading for Lecture 13 Release v10
Reading for Lecture 13 Release v10 Christopher Lee November 15, 2011 Contents 1 Evolutionary Trees i 1.1 Evolution as a Markov Process...................................... ii 1.2 Rooted vs. Unrooted Trees........................................
More informationCAP 5510 Lecture 3 Protein Structures
CAP 5510 Lecture 3 Protein Structures Su-Shing Chen Bioinformatics CISE 8/19/2005 Su-Shing Chen, CISE 1 Protein Conformation 8/19/2005 Su-Shing Chen, CISE 2 Protein Conformational Structures Hydrophobicity
More informationMachine Learning, Midterm Exam
10-601 Machine Learning, Midterm Exam Instructors: Tom Mitchell, Ziv Bar-Joseph Wednesday 12 th December, 2012 There are 9 questions, for a total of 100 points. This exam has 20 pages, make sure you have
More informationLecture 18 - Selection and Tests of Neutrality. Gibson and Muse, chapter 5 Nei and Kumar, chapter 12.6 p Hartl, chapter 3, p.
Lecture 8 - Selection and Tests of Neutrality Gibson and Muse, chapter 5 Nei and Kumar, chapter 2.6 p. 258-264 Hartl, chapter 3, p. 22-27 The Usefulness of Theta Under evolution by genetic drift (i.e.,
More informationGiri Narasimhan. CAP 5510: Introduction to Bioinformatics. ECS 254; Phone: x3748
CAP 5510: Introduction to Bioinformatics Giri Narasimhan ECS 254; Phone: x3748 giri@cis.fiu.edu www.cis.fiu.edu/~giri/teach/bioinfs07.html 2/14/07 CAP5510 1 CpG Islands Regions in DNA sequences with increased
More informationNAME... Soc. Sec. #... Remote Location... (if on campus write campus) FINAL EXAM EE568 KUMAR. Sp ' 00
NAME... Soc. Sec. #... Remote Location... (if on campus write campus) FINAL EXAM EE568 KUMAR Sp ' 00 May 3 OPEN BOOK exam (students are permitted to bring in textbooks, handwritten notes, lecture notes
More informationContra Costa College Course Outline
Contra Costa College Course Outline Department & Number: BIOSC 110 Course Title: Introduction to Biological Science Pre-requisite: None Corequisite: None Advisory: None Entry Skill: None Lecture Hours:
More informationBioinformatics for Computer Scientists (Part 2 Sequence Alignment) Sepp Hochreiter
Bioinformatics for Computer Scientists (Part 2 Sequence Alignment) Institute of Bioinformatics Johannes Kepler University, Linz, Austria Sequence Alignment 2. Sequence Alignment Sequence Alignment 2.1
More informationvalue mean standard deviation
Mr. Murphy AP Statistics 2.4 The Empirical Rule and z - Scores HW Pg. 208 #4.45 (a) - (c), 4.46, 4.51, 4.52, 4.73 Objectives: 1. Calculate a z score. 2. Apply the Empirical Rule when appropriate. 3. Calculate
More informationA SURVEY OF ORGANIC CHEMISTRY CHEMISTRY 1315 TuTr 9:35-10:55 am, Boggs B6
GEORGIA INSTITUTE OF TECHNOLOGY School of Chemistry and Biochemistry Spring 2004 A SURVEY OF ORGANIC CHEMISTRY CHEMISTRY 1315 TuTr 9:35-10:55 am, Boggs B6 Instructor: Marcus Weck Office: Boggs 3-85 Phone:
More informationSome of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks!
Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks! Paul has many great tools for teaching phylogenetics at his web site: http://hydrodictyon.eeb.uconn.edu/people/plewis
More informationMolecular Evolution and Phylogenetic Tree Reconstruction
1 4 Molecular Evolution and Phylogenetic Tree Reconstruction 3 2 5 1 4 2 3 5 Orthology, Paralogy, Inparalogs, Outparalogs Phylogenetic Trees Nodes: species Edges: time of independent evolution Edge length
More informationQ1) Explain how background selection and genetic hitchhiking could explain the positive correlation between genetic diversity and recombination rate.
OEB 242 Exam Practice Problems Answer Key Q1) Explain how background selection and genetic hitchhiking could explain the positive correlation between genetic diversity and recombination rate. First, recall
More informationC E N T R. Introduction to bioinformatics 2007 E B I O I N F O R M A T I C S V U F O R I N T. Lecture 5 G R A T I V. Pair-wise Sequence Alignment
C E N T R E F O R I N T E G R A T I V E B I O I N F O R M A T I C S V U Introduction to bioinformatics 2007 Lecture 5 Pair-wise Sequence Alignment Bioinformatics Nothing in Biology makes sense except in
More informationPractice Questions for Final Exam - Math 1060Q - Fall 2014
Practice Questions for Final Exam - Math 1060Q - Fall 01 Before anyone asks, the final exam is cumulative. It will consist of about 50% problems on exponential and logarithmic functions, 5% problems on
More informationNumerical Methods Lecture 7 - Statistics, Probability and Reliability
Topics Numerical Methods Lecture 7 - Statistics, Probability and Reliability A summary of statistical analysis A summary of probability methods A summary of reliability analysis concepts Statistical Analysis
More informationNUMB3RS Activity: DNA Sequence Alignment. Episode: Guns and Roses
Teacher Page 1 NUMB3RS Activity: DNA Sequence Alignment Topic: Biomathematics DNA sequence alignment Grade Level: 10-12 Objective: Use mathematics to compare two strings of DNA Prerequisite: very basic
More informationSequence analysis and comparison
The aim with sequence identification: Sequence analysis and comparison Marjolein Thunnissen Lund September 2012 Is there any known protein sequence that is homologous to mine? Are there any other species
More informationS H/T 0 ph = log([h + ]) E = mc 2 S = klnw G = H T S ph = pk a + log([a ]/[HA]) K a = [H + ][A ]/[HA] G = RTlnK eq e iπ + 1 = 0
Biochemistry 463, Summer II Your Name: University of Maryland, College Park Your SID #: Biochemistry and Physiology Prof. Jason Kahn Exam I (100 points total) July 27, 2007 You have 80 minutes for this
More informationIntroduction to population genetics & evolution
Introduction to population genetics & evolution Course Organization Exam dates: Feb 19 March 1st Has everybody registered? Did you get the email with the exam schedule Summer seminar: Hot topics in Bioinformatics
More informationLecture 1. ASTR 111 Section 002 Introductory Astronomy Solar System. Dr. Weigel. Outline. Course Overview Topics. Course Overview General Information
Lecture 1 Course Overview Topics ASTR 111 Section 002 Introductory Astronomy Solar System Dr. Weigel Outline 1.1 Course Overview 1.2 Course Logistics and Syllabus 1.3 Angular Measurements 1.4 Accuracy
More informationHow should we go about modeling this? Model parameters? Time Substitution rate Can we observe time or subst. rate? What can we observe?
How should we go about modeling this? gorilla GAAGTCCTTGAGAAATAAACTGCACACACTGG orangutan GGACTCCTTGAGAAATAAACTGCACACACTGG Model parameters? Time Substitution rate Can we observe time or subst. rate? What
More informationName: Exam 2 Solutions. March 13, 2017
Department of Mathematics University of Notre Dame Math 00 Finite Math Spring 07 Name: Instructors: Conant/Galvin Exam Solutions March, 07 This exam is in two parts on pages and contains problems worth
More informationMATHEMATICAL MODELS - Vol. III - Mathematical Modeling and the Human Genome - Hilary S. Booth MATHEMATICAL MODELING AND THE HUMAN GENOME
MATHEMATICAL MODELING AND THE HUMAN GENOME Hilary S. Booth Australian National University, Australia Keywords: Human genome, DNA, bioinformatics, sequence analysis, evolution. Contents 1. Introduction:
More informationBIO 181 GENERAL BIOLOGY I (MAJORS) with Lab (Title change ONLY Oct. 2013) Course Package
GENERAL BIOLOGY I (MAJORS) with Lab (Title change ONLY Oct. 2013) Course Package COURSE INFORMATION Is this a new course or a proposed modification to an existing course? Please check the appropriate box.
More informationUnit 2: Chemistry. Unit Overview:
Unit 2: Chemistry Unit Overview: This unit will focus on basic chemistry and some of the major process of organic chemistry (dehydration synthesis, hydrolysis, and enzyme action) that help form carbon
More informationWelcome to Chemistry 376
CHM 376 Spring 2014 Welcome to Chemistry 376 This course will give you a chance to explore the experimental world of physical chemistry. In each of six experiments you will study how simple physical models,
More informationHidden Markov Models
Hidden Markov Models A selection of slides taken from the following: Chris Bystroff Protein Folding Initiation Site Motifs Iosif Vaisman Bioinformatics and Gene Discovery Colin Cherry Hidden Markov Models
More informationC.DARWIN ( )
C.DARWIN (1809-1882) LAMARCK Each evolutionary lineage has evolved, transforming itself, from a ancestor appeared by spontaneous generation DARWIN All organisms are historically interconnected. Their relationships
More informationAlgorithms in Computational Biology (236522) spring 2008 Lecture #1
Algorithms in Computational Biology (236522) spring 2008 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: 15:30-16:30/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office hours:??
More informationCampbell Biology AP Edition 11 th Edition, 2018
A Correlation and Narrative Summary of Campbell Biology AP Edition 11 th Edition, 2018 To the AP Biology Curriculum Framework AP is a trademark registered and/or owned by the College Board, which was not
More informationMath 164-1: Optimization Instructor: Alpár R. Mészáros
Math 164-1: Optimization Instructor: Alpár R. Mészáros First Midterm, April 20, 2016 Name (use a pen): Student ID (use a pen): Signature (use a pen): Rules: Duration of the exam: 50 minutes. By writing
More informationSequence Alignments. Dynamic programming approaches, scoring, and significance. Lucy Skrabanek ICB, WMC January 31, 2013
Sequence Alignments Dynamic programming approaches, scoring, and significance Lucy Skrabanek ICB, WMC January 31, 213 Sequence alignment Compare two (or more) sequences to: Find regions of conservation
More informationLecture 4: Hidden Markov Models: An Introduction to Dynamic Decision Making. November 11, 2010
Hidden Lecture 4: Hidden : An Introduction to Dynamic Decision Making November 11, 2010 Special Meeting 1/26 Markov Model Hidden When a dynamical system is probabilistic it may be determined by the transition
More informationHidden Markov Models
Hidden Markov Models Slides revised and adapted to Bioinformática 55 Engª Biomédica/IST 2005 Ana Teresa Freitas Forward Algorithm For Markov chains we calculate the probability of a sequence, P(x) How
More informationInferring Phylogenetic Trees. Distance Approaches. Representing distances. in rooted and unrooted trees. The distance approach to phylogenies
Inferring Phylogenetic Trees Distance Approaches Representing distances in rooted and unrooted trees The distance approach to phylogenies given: an n n matrix M where M ij is the distance between taxa
More informationGeneral Calculus II. Course Text. Course Description. Course Objectives. Course Prerequisites. Important Terms
Course Text General Calculus II Students may select any one of these texts aligned to this course: Larson, R., Hostetler, R. P., and Edwards, B. Calculus Early Transcendental Functions, 3rd edition. Houghton
More informationHidden Markov Models. based on chapters from the book Durbin, Eddy, Krogh and Mitchison Biological Sequence Analysis via Shamir s lecture notes
Hidden Markov Models based on chapters from the book Durbin, Eddy, Krogh and Mitchison Biological Sequence Analysis via Shamir s lecture notes music recognition deal with variations in - actual sound -
More informationBioinformatics. Scoring Matrices. David Gilbert Bioinformatics Research Centre
Bioinformatics Scoring Matrices David Gilbert Bioinformatics Research Centre www.brc.dcs.gla.ac.uk Department of Computing Science, University of Glasgow Learning Objectives To explain the requirement
More information1. (4 % each, total 20 %) Answer each of the following. (No need to show your work for this problem). 3 n. n!? n=1
NAME: EXAM 4 - Math 56 SOlutions Instruction: Circle your answers and show all your work CLEARLY Partial credit will be given only when you present what belongs to part of a correct solution (4 % each,
More information