How should we go about modeling this? Model parameters? Time Substitution rate Can we observe time or subst. rate? What can we observe?

Size: px
Start display at page:

Download "How should we go about modeling this? Model parameters? Time Substitution rate Can we observe time or subst. rate? What can we observe?"

Transcription

1 How should we go about modeling this? gorilla GAAGTCCTTGAGAAATAAACTGCACACACTGG orangutan GGACTCCTTGAGAAATAAACTGCACACACTGG Model parameters? Time Substitution rate Can we observe time or subst. rate? What can we observe? 1

2 Maximum likelihood estimation First 32 nucleotides of the ψη-globin gene of gorilla and orangutan: gorilla GAAGTCCTTGAGAAATAAACTGCACACACTGG orangutan GGACTCCTTGAGAAATAAACTGCACACACTGG logl maximum likelihood estimate (MLE) of v is v plot of log-likelihood as a function of branch length v Knowing that v = rate time, Why does the curve drop as you move left of the MLE? Why does the curve drop as you move right of the MLE? 2

3 What does this mean? Why is this number negative? From A C G T JC69 rate matrix 3 3 To A C G T 3 1 parameter: α 3 Jukes, T. H., and C. R. Cantor Evolution of protein molecules. Pages in H. N. Munro (ed.), Mammalian Protein Metabolism. Academic Press, New York. 3

4 Equilibrium Frequencies A sequence consisting only of A... C T G A Perfume bottle broken, and perfume quickly fills the room 4

5 Equilibrium Frequencies If all doors are suddenly opened, perfume will spread by diffusion to the other rooms... C T G A The instant the doors open, the rate away from A is 3α (i.e. rate = -3α) 5

6 Equilibrium Frequencies C T G A Sequence now contains a few Cs, Gs, and Ts... AATAAAAAAAAAAAA AAAACAAAAAATAAA AAAAAAACGAAGAAA AAATAAAAAAAAAAA As perfume spreads by diffusion, the difference in concentration among rooms decreases... 6

7 Equilibrium Frequencies C T G A Sequence contains a mixture of about equal quantities A, C, G and T CAGAATCGAGCAGCT TGACTACGTCATGTG GTTGCGCCGCAACGC CATATACCGCCGACT AGTTTGAGGGCGGTT AGGGCTCGGTTCGTA CATCGTATAAACATT After a long time, equilibrium (=stationarity) is achieved. 7

8 Stationarity Assumed Models assume stationarity, which means that the state frequencies do not change across the tree Models assume that substitution process has reached equilibrium by this point 8

9 From 2 parameters: α β To A C G T K80 (or K2P) rate matrix A C G T transition rate transversion rate Kimura, M A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16:

10 K80 rate matrix (looks different, but actually the same) 2 parameters: κ β A C G T A C G T ( + 2) ( + 2) ( + 2) ( + 2) All I ve done is define κ to be the transition/transversion rate ratio = Note: the K80 model is identical to the JC69 model if κ = 1 (α = β) 10

11 Likelihood Surface when K80 true K80 model (entire 2d space) Based on simulated data: sequence length = 500 sites true branch length = 0.15 true kappa = 5.0 JC69 model (just this 1d line) apple (trs/trv rate ratio) (branch length) 11

12 Likelihood Surface when JC true Based on simulated data: sequence length = 500 sites true branch length = 0.15 true kappa = 1.0 K80 model (entire 2d space) JC69 model (just this 1d line) apple (trs/trv rate ratio) (branch length) 12

13 F81 rate matrix 4 parameters: µ πa πc πg A C G T A C G T µ(1 A ) C µ G µ T µ A µ µ(1 C ) G µ T µ A µ C µ µ(1 G ) T µ A µ C µ G µ µ(1 T ) Note: the F81 model is identical to the JC69 model if all base frequencies are equal Felsenstein, J Evolutionary trees from DNA sequences: a maximum likelihood approach. Journal of Molecular Evolution 17:

14 A C G T HKY85 rate matrix A C G T C G T A G T A C T A C G 5 parameters: κ β πa πc πg A dash means equal to negative sum of other elements on the same row Note: the HKY85 model is identical to the F81 model if κ = 1. If, in addition, all base frequencies are equal, it is identical to JC69. Hasegawa, M., H. Kishino, and T. Yano Dating of the human-ape splitting by a molecular clock of mitochondrial DNA. Journal of Molecular Evolution 21:

15 A C G T GTR rate matrix A C G T C aµ G bµ T cµ A aµ G dµ T eµ A bµ C dµ T fµ A cµ C eµ G fµ 9 parameters: π A π C π G a b c d e µ Identical to the F81 model if a = b = c = d = e = f = 1. If, in addition, all the base frequencies are equal, GTR is identical to JC69. If a = c = d = f = β and b = e = κβ, GTR becomes the HKY85 model. Lanave, C., G. Preparata, C. Saccone, and G. Serio A new method for calculating evolutionary substitution rates. Journal of Molecular Evolution 20:

16 So, how do you turn likelihoods into probabilities? this is the likelihood surface: Pr(data κ,ν) want probability surface: Pr(κ,ν data) apple 16

17 Kinds of probabilities B = Black S = Solid W = White D = Dotted Marginal probabilities: Joint probabilities: 17

18 Kinds of probabilities (continued) Conditional probability 18

19 Bayes rule provides a way to calculate conditional probabilities 19

20 Bayes rule shows how to turn Pr(D B) into Pr(B D) 20

21 The marginal probability of D is the sum of all joint probabilities involving D 21

22 Bayes rule in statistics Likelihood of hypothesis θ Prior probability of hypothesis θ Pr( D) = Pr(D ) Pr( ) Pr(D ) Pr( ) Posterior probability of hypothesis θ Marginal probability of the data (marginalizing over hypotheses) 22

23 Moving through treespace The Larget-Simon move X Step 1: Pick 3 contiguous edges randomly, defining two subtrees, X and Y Y *Larget, B., and D. L. Simon Markov chain monte carlo algorithms for the Bayesian analysis of phylogenetic trees. Molecular Biology and Evolution 16: See also: Holder et al Syst. Biol. 54:

24 Moving through treespace The Larget-Simon move YY X X Step 1: Pick 3 contiguous edges randomly, defining two subtrees, X and Y Step 2: Shrink or grow selected 3-edge segment by a random amount 24

25 Moving through treespace The Larget-Simon move Y X Step 1: Pick 3 contiguous edges randomly, defining two subtrees, X and Y Step 2: Shrink or grow selected 3-edge segment by a random amount 25

26 Moving through treespace The Larget-Simon move Y Step 1: Pick 3 contiguous edges randomly, defining two subtrees, X and Y Step 2: Shrink or grow selected 3-edge segment by a random amount Step 3: Choose X or Y randomly, then reposition randomly 26

27 Moving through treespace The Larget-Simon move Proposed new tree: 3 edge lengths have changed and the topology differs by one NNI rearrangement Step 1: Pick 3 contiguous edges randomly, defining two subtrees, X and Y Step 2: Shrink or grow selected 3-edge segment by a random amount Step 3: Choose X or Y randomly, then reposition randomly 27

28 Moving through treespace Current tree Proposed tree log-posterior = log-posterior = (better, so accept) 28

Maximum Likelihood in Phylogenetics

Maximum Likelihood in Phylogenetics Maximum Likelihood in Phylogenetics June 1, 2009 Smithsonian Workshop on Molecular Evolution Paul O. Lewis Department of Ecology & Evolutionary Biology University of Connecticut, Storrs, CT Copyright 2009

More information

Maximum Likelihood in Phylogenetics

Maximum Likelihood in Phylogenetics Maximum Likelihood in Phylogenetics 26 January 2011 Workshop on Molecular Evolution Český Krumlov, Česká republika Paul O. Lewis Department of Ecology & Evolutionary Biology University of Connecticut,

More information

Maximum Likelihood in Phylogenetics

Maximum Likelihood in Phylogenetics Maximum Likelihood in Phylogenetics 29 July 2014 Workshop on Molecular Evolution Woods Hole, Massachusetts Paul O. Lewis Department of Ecology & Evolutionary Biology Paul O. Lewis (2014 Woods Hole Workshop

More information

Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks!

Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks! Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks! Paul has many great tools for teaching phylogenetics at his web site: http://hydrodictyon.eeb.uconn.edu/people/plewis

More information

Maximum Likelihood in Phylogenetics

Maximum Likelihood in Phylogenetics Maximum Likelihood in Phylogenetics 23 July 2013 Workshop on Molecular Evolution Woods Hole, Massachusetts Paul O. Lewis Department of Ecology & Evolutionary Biology University of Connecticut, Storrs,

More information

Likelihood in Phylogenetics

Likelihood in Phylogenetics Likelihood in Phylogenetics 22 July 2017 Workshop on Molecular Evolution Woods Hole, Mass. Paul O. Lewis Department of Ecology & Evolutionary Biology Paul O. Lewis (2017 Woods Hole Workshop in Molecular

More information

Maximum Likelihood in Phylogenetics

Maximum Likelihood in Phylogenetics Maximum Likelihood in Phylogenetics 28 January 2015 Paul O. Lewis Department of Ecology & Evolutionary Biology Workshop on Molecular Evolution Český Krumlov Paul O. Lewis (2015 Czech Republic Workshop

More information

Lecture 24. Phylogeny methods, part 4 (Models of DNA and protein change) p.1/22

Lecture 24. Phylogeny methods, part 4 (Models of DNA and protein change) p.1/22 Lecture 24. Phylogeny methods, part 4 (Models of DNA and protein change) Joe Felsenstein Department of Genome Sciences and Department of Biology Lecture 24. Phylogeny methods, part 4 (Models of DNA and

More information

Maximum Likelihood in Phylogenetics

Maximum Likelihood in Phylogenetics Maximum Likelihood in Phylogenetics 21 July 2015 Workshop on Molecular Evolution Woods Hole, Mass. Paul O. Lewis Department of Ecology & Evolutionary Biology Paul O. Lewis (2015 Woods Hole Workshop in

More information

Maximum Likelihood in Phylogenetics

Maximum Likelihood in Phylogenetics Maximum Likelihood in Phylogenetics 21 July 2015 Workshop on Molecular Evolution Woods Hole, Mass. Paul O. Lewis Department of Ecology & Evolutionary Biology Paul O. Lewis (2015 Woods Hole Workshop in

More information

Lecture 4. Models of DNA and protein change. Likelihood methods

Lecture 4. Models of DNA and protein change. Likelihood methods Lecture 4. Models of DNA and protein change. Likelihood methods Joe Felsenstein Department of Genome Sciences and Department of Biology Lecture 4. Models of DNA and protein change. Likelihood methods p.1/36

More information

What Is Conservation?

What Is Conservation? What Is Conservation? Lee A. Newberg February 22, 2005 A Central Dogma Junk DNA mutates at a background rate, but functional DNA exhibits conservation. Today s Question What is this conservation? Lee A.

More information

Lecture 27. Phylogeny methods, part 4 (Models of DNA and protein change) p.1/26

Lecture 27. Phylogeny methods, part 4 (Models of DNA and protein change) p.1/26 Lecture 27. Phylogeny methods, part 4 (Models of DNA and protein change) Joe Felsenstein Department of Genome Sciences and Department of Biology Lecture 27. Phylogeny methods, part 4 (Models of DNA and

More information

Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks!

Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks! Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks! Paul has many great tools for teaching phylogenetics at his web site: http://hydrodictyon.eeb.uconn.edu/people/plewis

More information

Bayesian Phylogenetics

Bayesian Phylogenetics Bayesian Phylogenetics Paul O. Lewis Department of Ecology & Evolutionary Biology University of Connecticut Woods Hole Molecular Evolution Workshop, July 27, 2006 2006 Paul O. Lewis Bayesian Phylogenetics

More information

Phylogeny Estimation and Hypothesis Testing using Maximum Likelihood

Phylogeny Estimation and Hypothesis Testing using Maximum Likelihood Phylogeny Estimation and Hypothesis Testing using Maximum Likelihood For: Prof. Partensky Group: Jimin zhu Rama Sharma Sravanthi Polsani Xin Gong Shlomit klopman April. 7. 2003 Table of Contents Introduction...3

More information

Letter to the Editor. Department of Biology, Arizona State University

Letter to the Editor. Department of Biology, Arizona State University Letter to the Editor Traditional Phylogenetic Reconstruction Methods Reconstruct Shallow and Deep Evolutionary Relationships Equally Well Michael S. Rosenberg and Sudhir Kumar Department of Biology, Arizona

More information

Inferring Molecular Phylogeny

Inferring Molecular Phylogeny Dr. Walter Salzburger he tree of life, ustav Klimt (1907) Inferring Molecular Phylogeny Inferring Molecular Phylogeny 55 Maximum Parsimony (MP): objections long branches I!! B D long branch attraction

More information

Lecture 4. Models of DNA and protein change. Likelihood methods

Lecture 4. Models of DNA and protein change. Likelihood methods Lecture 4. Models of DNA and protein change. Likelihood methods Joe Felsenstein Department of Genome Sciences and Department of Biology Lecture 4. Models of DNA and protein change. Likelihood methods p.1/39

More information

Lab 9: Maximum Likelihood and Modeltest

Lab 9: Maximum Likelihood and Modeltest Integrative Biology 200A University of California, Berkeley "PRINCIPLES OF PHYLOGENETICS" Spring 2010 Updated by Nick Matzke Lab 9: Maximum Likelihood and Modeltest In this lab we re going to use PAUP*

More information

A Bayesian Approach to Phylogenetics

A Bayesian Approach to Phylogenetics A Bayesian Approach to Phylogenetics Niklas Wahlberg Based largely on slides by Paul Lewis (www.eeb.uconn.edu) An Introduction to Bayesian Phylogenetics Bayesian inference in general Markov chain Monte

More information

Substitution = Mutation followed. by Fixation. Common Ancestor ACGATC 1:A G 2:C A GAGATC 3:G A 6:C T 5:T C 4:A C GAAATT 1:G A

Substitution = Mutation followed. by Fixation. Common Ancestor ACGATC 1:A G 2:C A GAGATC 3:G A 6:C T 5:T C 4:A C GAAATT 1:G A GAGATC 3:G A 6:C T Common Ancestor ACGATC 1:A G 2:C A Substitution = Mutation followed 5:T C by Fixation GAAATT 4:A C 1:G A AAAATT GAAATT GAGCTC ACGACC Chimp Human Gorilla Gibbon AAAATT GAAATT GAGCTC ACGACC

More information

Reconstruire le passé biologique modèles, méthodes, performances, limites

Reconstruire le passé biologique modèles, méthodes, performances, limites Reconstruire le passé biologique modèles, méthodes, performances, limites Olivier Gascuel Centre de Bioinformatique, Biostatistique et Biologie Intégrative C3BI USR 3756 Institut Pasteur & CNRS Reconstruire

More information

Lecture Notes: Markov chains

Lecture Notes: Markov chains Computational Genomics and Molecular Biology, Fall 5 Lecture Notes: Markov chains Dannie Durand At the beginning of the semester, we introduced two simple scoring functions for pairwise alignments: a similarity

More information

The Importance of Proper Model Assumption in Bayesian Phylogenetics

The Importance of Proper Model Assumption in Bayesian Phylogenetics Syst. Biol. 53(2):265 277, 2004 Copyright c Society of Systematic Biologists ISSN: 1063-5157 print / 1076-836X online DOI: 10.1080/10635150490423520 The Importance of Proper Model Assumption in Bayesian

More information

Maximum Likelihood Until recently the newest method. Popularized by Joseph Felsenstein, Seattle, Washington.

Maximum Likelihood Until recently the newest method. Popularized by Joseph Felsenstein, Seattle, Washington. Maximum Likelihood This presentation is based almost entirely on Peter G. Fosters - "The Idiot s Guide to the Zen of Likelihood in a Nutshell in Seven Days for Dummies, Unleashed. http://www.bioinf.org/molsys/data/idiots.pdf

More information

Who was Bayes? Bayesian Phylogenetics. What is Bayes Theorem?

Who was Bayes? Bayesian Phylogenetics. What is Bayes Theorem? Who was Bayes? Bayesian Phylogenetics Bret Larget Departments of Botany and of Statistics University of Wisconsin Madison October 6, 2011 The Reverand Thomas Bayes was born in London in 1702. He was the

More information

Inferring Speciation Times under an Episodic Molecular Clock

Inferring Speciation Times under an Episodic Molecular Clock Syst. Biol. 56(3):453 466, 2007 Copyright c Society of Systematic Biologists ISSN: 1063-5157 print / 1076-836X online DOI: 10.1080/10635150701420643 Inferring Speciation Times under an Episodic Molecular

More information

Bayesian Phylogenetics

Bayesian Phylogenetics Bayesian Phylogenetics Bret Larget Departments of Botany and of Statistics University of Wisconsin Madison October 6, 2011 Bayesian Phylogenetics 1 / 27 Who was Bayes? The Reverand Thomas Bayes was born

More information

Maximum Likelihood Tree Estimation. Carrie Tribble IB Feb 2018

Maximum Likelihood Tree Estimation. Carrie Tribble IB Feb 2018 Maximum Likelihood Tree Estimation Carrie Tribble IB 200 9 Feb 2018 Outline 1. Tree building process under maximum likelihood 2. Key differences between maximum likelihood and parsimony 3. Some fancy extras

More information

Phylogenetics: Distance Methods. COMP Spring 2015 Luay Nakhleh, Rice University

Phylogenetics: Distance Methods. COMP Spring 2015 Luay Nakhleh, Rice University Phylogenetics: Distance Methods COMP 571 - Spring 2015 Luay Nakhleh, Rice University Outline Evolutionary models and distance corrections Distance-based methods Evolutionary Models and Distance Correction

More information

Phylogenetic Inference using RevBayes

Phylogenetic Inference using RevBayes Phylogenetic Inference using RevBayes Model section using Bayes factors Sebastian Höhna 1 Overview This tutorial demonstrates some general principles of Bayesian model comparison, which is based on estimating

More information

Phylogenetic Tree Reconstruction

Phylogenetic Tree Reconstruction I519 Introduction to Bioinformatics, 2011 Phylogenetic Tree Reconstruction Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Evolution theory Speciation Evolution of new organisms is driven

More information

Molecular Evolution, course # Final Exam, May 3, 2006

Molecular Evolution, course # Final Exam, May 3, 2006 Molecular Evolution, course #27615 Final Exam, May 3, 2006 This exam includes a total of 12 problems on 7 pages (including this cover page). The maximum number of points obtainable is 150, and at least

More information

Efficiencies of maximum likelihood methods of phylogenetic inferences when different substitution models are used

Efficiencies of maximum likelihood methods of phylogenetic inferences when different substitution models are used Molecular Phylogenetics and Evolution 31 (2004) 865 873 MOLECULAR PHYLOGENETICS AND EVOLUTION www.elsevier.com/locate/ympev Efficiencies of maximum likelihood methods of phylogenetic inferences when different

More information

Lie Markov models. Jeremy Sumner. School of Physical Sciences University of Tasmania, Australia

Lie Markov models. Jeremy Sumner. School of Physical Sciences University of Tasmania, Australia Lie Markov models Jeremy Sumner School of Physical Sciences University of Tasmania, Australia Stochastic Modelling Meets Phylogenetics, UTAS, November 2015 Jeremy Sumner Lie Markov models 1 / 23 The theory

More information

Bayesian Models for Phylogenetic Trees

Bayesian Models for Phylogenetic Trees Bayesian Models for Phylogenetic Trees Clarence Leung* 1 1 McGill Centre for Bioinformatics, McGill University, Montreal, Quebec, Canada ABSTRACT Introduction: Inferring genetic ancestry of different species

More information

Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks!

Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks! Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks! Paul has many great tools for teaching phylogenetics at his web site: http://hydrodictyon.eeb.uconn.edu/people/plewis

More information

Phylogenetics: Building Phylogenetic Trees

Phylogenetics: Building Phylogenetic Trees 1 Phylogenetics: Building Phylogenetic Trees COMP 571 Luay Nakhleh, Rice University 2 Four Questions Need to be Answered What data should we use? Which method should we use? Which evolutionary model should

More information

Preliminaries. Download PAUP* from: Tuesday, July 19, 16

Preliminaries. Download PAUP* from:   Tuesday, July 19, 16 Preliminaries Download PAUP* from: http://people.sc.fsu.edu/~dswofford/paup_test 1 A model of the Boston T System 1 Idea from Paul Lewis A simpler model? 2 Why do models matter? Model-based methods including

More information

KaKs Calculator: Calculating Ka and Ks Through Model Selection and Model Averaging

KaKs Calculator: Calculating Ka and Ks Through Model Selection and Model Averaging Method KaKs Calculator: Calculating Ka and Ks Through Model Selection and Model Averaging Zhang Zhang 1,2,3#, Jun Li 2#, Xiao-Qian Zhao 2,3, Jun Wang 1,2,4, Gane Ka-Shu Wong 2,4,5, and Jun Yu 1,2,4 * 1

More information

Molecular Evolution & Phylogenetics

Molecular Evolution & Phylogenetics Molecular Evolution & Phylogenetics Heuristics based on tree alterations, maximum likelihood, Bayesian methods, statistical confidence measures Jean-Baka Domelevo Entfellner Learning Objectives know basic

More information

Mutation models I: basic nucleotide sequence mutation models

Mutation models I: basic nucleotide sequence mutation models Mutation models I: basic nucleotide sequence mutation models Peter Beerli September 3, 009 Mutations are irreversible changes in the DNA. This changes may be introduced by chance, by chemical agents, or

More information

BMI/CS 776 Lecture 4. Colin Dewey

BMI/CS 776 Lecture 4. Colin Dewey BMI/CS 776 Lecture 4 Colin Dewey 2007.02.01 Outline Common nucleotide substitution models Directed graphical models Ancestral sequence inference Poisson process continuous Markov process X t0 X t1 X t2

More information

Probability Distribution of Molecular Evolutionary Trees: A New Method of Phylogenetic Inference

Probability Distribution of Molecular Evolutionary Trees: A New Method of Phylogenetic Inference J Mol Evol (1996) 43:304 311 Springer-Verlag New York Inc. 1996 Probability Distribution of Molecular Evolutionary Trees: A New Method of Phylogenetic Inference Bruce Rannala, Ziheng Yang Department of

More information

An Introduction to Bayesian Inference of Phylogeny

An Introduction to Bayesian Inference of Phylogeny n Introduction to Bayesian Inference of Phylogeny John P. Huelsenbeck, Bruce Rannala 2, and John P. Masly Department of Biology, University of Rochester, Rochester, NY 427, U.S.. 2 Department of Medical

More information

Estimating Phylogenies (Evolutionary Trees) II. Biol4230 Thurs, March 2, 2017 Bill Pearson Jordan 6-057

Estimating Phylogenies (Evolutionary Trees) II. Biol4230 Thurs, March 2, 2017 Bill Pearson Jordan 6-057 Estimating Phylogenies (Evolutionary Trees) II Biol4230 Thurs, March 2, 2017 Bill Pearson wrp@virginia.edu 4-2818 Jordan 6-057 Tree estimation strategies: Parsimony?no model, simply count minimum number

More information

Phylogenetics: Building Phylogenetic Trees. COMP Fall 2010 Luay Nakhleh, Rice University

Phylogenetics: Building Phylogenetic Trees. COMP Fall 2010 Luay Nakhleh, Rice University Phylogenetics: Building Phylogenetic Trees COMP 571 - Fall 2010 Luay Nakhleh, Rice University Four Questions Need to be Answered What data should we use? Which method should we use? Which evolutionary

More information

In: P. Lemey, M. Salemi and A.-M. Vandamme (eds.). To appear in: The. Chapter 4. Nucleotide Substitution Models

In: P. Lemey, M. Salemi and A.-M. Vandamme (eds.). To appear in: The. Chapter 4. Nucleotide Substitution Models In: P. Lemey, M. Salemi and A.-M. Vandamme (eds.). To appear in: The Phylogenetic Handbook. 2 nd Edition. Cambridge University Press, UK. (final version 21. 9. 2006) Chapter 4. Nucleotide Substitution

More information

9/30/11. Evolution theory. Phylogenetic Tree Reconstruction. Phylogenetic trees (binary trees) Phylogeny (phylogenetic tree)

9/30/11. Evolution theory. Phylogenetic Tree Reconstruction. Phylogenetic trees (binary trees) Phylogeny (phylogenetic tree) I9 Introduction to Bioinformatics, 0 Phylogenetic ree Reconstruction Yuzhen Ye (yye@indiana.edu) School of Informatics & omputing, IUB Evolution theory Speciation Evolution of new organisms is driven by

More information

Stochastic Errors vs. Modeling Errors in Distance Based Phylogenetic Reconstructions

Stochastic Errors vs. Modeling Errors in Distance Based Phylogenetic Reconstructions PLGW05 Stochastic Errors vs. Modeling Errors in Distance Based Phylogenetic Reconstructions 1 joint work with Ilan Gronau 2, Shlomo Moran 3, and Irad Yavneh 3 1 2 Dept. of Biological Statistics and Computational

More information

EVOLUTIONARY DISTANCES

EVOLUTIONARY DISTANCES EVOLUTIONARY DISTANCES FROM STRINGS TO TREES Luca Bortolussi 1 1 Dipartimento di Matematica ed Informatica Università degli studi di Trieste luca@dmi.units.it Trieste, 14 th November 2007 OUTLINE 1 STRINGS:

More information

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic analysis Phylogenetic Basics: Biological

More information

Phylogenetics: Bayesian Phylogenetic Analysis. COMP Spring 2015 Luay Nakhleh, Rice University

Phylogenetics: Bayesian Phylogenetic Analysis. COMP Spring 2015 Luay Nakhleh, Rice University Phylogenetics: Bayesian Phylogenetic Analysis COMP 571 - Spring 2015 Luay Nakhleh, Rice University Bayes Rule P(X = x Y = y) = P(X = x, Y = y) P(Y = y) = P(X = x)p(y = y X = x) P x P(X = x 0 )P(Y = y X

More information

Bayesian inference & Markov chain Monte Carlo. Note 1: Many slides for this lecture were kindly provided by Paul Lewis and Mark Holder

Bayesian inference & Markov chain Monte Carlo. Note 1: Many slides for this lecture were kindly provided by Paul Lewis and Mark Holder Bayesian inference & Markov chain Monte Carlo Note 1: Many slides for this lecture were kindly provided by Paul Lewis and Mark Holder Note 2: Paul Lewis has written nice software for demonstrating Markov

More information

MCMC: Markov Chain Monte Carlo

MCMC: Markov Chain Monte Carlo I529: Machine Learning in Bioinformatics (Spring 2013) MCMC: Markov Chain Monte Carlo Yuzhen Ye School of Informatics and Computing Indiana University, Bloomington Spring 2013 Contents Review of Markov

More information

Bayesian phylogenetics. the one true tree? Bayesian phylogenetics

Bayesian phylogenetics. the one true tree? Bayesian phylogenetics Bayesian phylogenetics the one true tree? the methods we ve learned so far try to get a single tree that best describes the data however, they admit that they don t search everywhere, and that it is difficult

More information

In: M. Salemi and A.-M. Vandamme (eds.). To appear. The. Phylogenetic Handbook. Cambridge University Press, UK.

In: M. Salemi and A.-M. Vandamme (eds.). To appear. The. Phylogenetic Handbook. Cambridge University Press, UK. In: M. Salemi and A.-M. Vandamme (eds.). To appear. The Phylogenetic Handbook. Cambridge University Press, UK. Chapter 4. Nucleotide Substitution Models THEORY Korbinian Strimmer () and Arndt von Haeseler

More information

Inferring Complex DNA Substitution Processes on Phylogenies Using Uniformization and Data Augmentation

Inferring Complex DNA Substitution Processes on Phylogenies Using Uniformization and Data Augmentation Syst Biol 55(2):259 269, 2006 Copyright c Society of Systematic Biologists ISSN: 1063-5157 print / 1076-836X online DOI: 101080/10635150500541599 Inferring Complex DNA Substitution Processes on Phylogenies

More information

Massachusetts Institute of Technology Computational Evolutionary Biology, Fall, 2005 Notes for November 7: Molecular evolution

Massachusetts Institute of Technology Computational Evolutionary Biology, Fall, 2005 Notes for November 7: Molecular evolution Massachusetts Institute of Technology 6.877 Computational Evolutionary Biology, Fall, 2005 Notes for November 7: Molecular evolution 1. Rates of amino acid replacement The initial motivation for the neutral

More information

Bayesian Inference using Markov Chain Monte Carlo in Phylogenetic Studies

Bayesian Inference using Markov Chain Monte Carlo in Phylogenetic Studies Bayesian Inference using Markov Chain Monte Carlo in Phylogenetic Studies 1 What is phylogeny? Essay written for the course in Markov Chains 2004 Torbjörn Karfunkel Phylogeny is the evolutionary development

More information

Natural selection on the molecular level

Natural selection on the molecular level Natural selection on the molecular level Fundamentals of molecular evolution How DNA and protein sequences evolve? Genetic variability in evolution } Mutations } forming novel alleles } Inversions } change

More information

7. Tests for selection

7. Tests for selection Sequence analysis and genomics 7. Tests for selection Dr. Katja Nowick Group leader TFome and Transcriptome Evolution Bioinformatics group Paul-Flechsig-Institute for Brain Research www. nowicklab.info

More information

Probabilistic modeling and molecular phylogeny

Probabilistic modeling and molecular phylogeny Probabilistic modeling and molecular phylogeny Anders Gorm Pedersen Molecular Evolution Group Center for Biological Sequence Analysis Technical University of Denmark (DTU) What is a model? Mathematical

More information

Dr. Amira A. AL-Hosary

Dr. Amira A. AL-Hosary Phylogenetic analysis Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic Basics: Biological

More information

Estimating Evolutionary Trees. Phylogenetic Methods

Estimating Evolutionary Trees. Phylogenetic Methods Estimating Evolutionary Trees v if the data are consistent with infinite sites then all methods should yield the same tree v it gets more complicated when there is homoplasy, i.e., parallel or convergent

More information

Points of View JACK SULLIVAN 1 AND DAVID L. SWOFFORD 2

Points of View JACK SULLIVAN 1 AND DAVID L. SWOFFORD 2 Points of View Syst. Biol. 50(5):723 729, 2001 Should We Use Model-Based Methods for Phylogenetic Inference When We Know That Assumptions About Among-Site Rate Variation and Nucleotide Substitution Pattern

More information

Lecture 4: Evolutionary Models and Substitution Matrices (PAM and BLOSUM)

Lecture 4: Evolutionary Models and Substitution Matrices (PAM and BLOSUM) Bioinformatics II Probability and Statistics Universität Zürich and ETH Zürich Spring Semester 2009 Lecture 4: Evolutionary Models and Substitution Matrices (PAM and BLOSUM) Dr Fraser Daly adapted from

More information

Taming the Beast Workshop

Taming the Beast Workshop Workshop and Chi Zhang June 28, 2016 1 / 19 Species tree Species tree the phylogeny representing the relationships among a group of species Figure adapted from [Rogers and Gibbs, 2014] Gene tree the phylogeny

More information

Identifiability of the GTR+Γ substitution model (and other models) of DNA evolution

Identifiability of the GTR+Γ substitution model (and other models) of DNA evolution Identifiability of the GTR+Γ substitution model (and other models) of DNA evolution Elizabeth S. Allman Dept. of Mathematics and Statistics University of Alaska Fairbanks TM Current Challenges and Problems

More information

Limitations of Markov Chain Monte Carlo Algorithms for Bayesian Inference of Phylogeny

Limitations of Markov Chain Monte Carlo Algorithms for Bayesian Inference of Phylogeny Limitations of Markov Chain Monte Carlo Algorithms for Bayesian Inference of Phylogeny Elchanan Mossel Eric Vigoda July 5, 2005 Abstract Markov Chain Monte Carlo algorithms play a key role in the Bayesian

More information

Algorithmic Methods Well-defined methodology Tree reconstruction those that are well-defined enough to be carried out by a computer. Felsenstein 2004,

Algorithmic Methods Well-defined methodology Tree reconstruction those that are well-defined enough to be carried out by a computer. Felsenstein 2004, Tracing the Evolution of Numerical Phylogenetics: History, Philosophy, and Significance Adam W. Ferguson Phylogenetic Systematics 26 January 2009 Inferring Phylogenies Historical endeavor Darwin- 1837

More information

Phylogenetic Assumptions

Phylogenetic Assumptions Substitution Models and the Phylogenetic Assumptions Vivek Jayaswal Lars S. Jermiin COMMONWEALTH OF AUSTRALIA Copyright htregulation WARNING This material has been reproduced and communicated to you by

More information

Hastings Ratio of the LOCAL Proposal Used in Bayesian Phylogenetics

Hastings Ratio of the LOCAL Proposal Used in Bayesian Phylogenetics 2005 POINTS OF VIEW 961 Tarrío, R., F. Rodriguez-Trelles, and F. J. Ayala. 2001. Shared nucleotide composition biases among species and their impacts on phylogenetic reconstructions of the Drosophilidae.

More information

Lecture 6 Phylogenetic Inference

Lecture 6 Phylogenetic Inference Lecture 6 Phylogenetic Inference From Darwin s notebook in 1837 Charles Darwin Willi Hennig From The Origin in 1859 Cladistics Phylogenetic inference Willi Hennig, Cladistics 1. Clade, Monophyletic group,

More information

Using phylogenetics to estimate species divergence times... Basics and basic issues for Bayesian inference of divergence times (plus some digression)

Using phylogenetics to estimate species divergence times... Basics and basic issues for Bayesian inference of divergence times (plus some digression) Using phylogenetics to estimate species divergence times... More accurately... Basics and basic issues for Bayesian inference of divergence times (plus some digression) "A comparison of the structures

More information

Phylogenetic Inference using RevBayes

Phylogenetic Inference using RevBayes Phylogenetic Inference using RevBayes Substitution Models Sebastian Höhna 1 Overview This tutorial demonstrates how to set up and perform analyses using common nucleotide substitution models. The substitution

More information

Taming the Beast Workshop

Taming the Beast Workshop Workshop David Rasmussen & arsten Magnus June 27, 2016 1 / 31 Outline of sequence evolution: rate matrices Markov chain model Variable rates amongst different sites: +Γ Implementation in BES2 2 / 31 genotype

More information

Estimating the Rate of Evolution of the Rate of Molecular Evolution

Estimating the Rate of Evolution of the Rate of Molecular Evolution Estimating the Rate of Evolution of the Rate of Molecular Evolution Jeffrey L. Thorne,* Hirohisa Kishino, and Ian S. Painter* *Program in Statistical Genetics, Statistics Department, North Carolina State

More information

EVOLUTIONARY DISTANCE MODEL BASED ON DIFFERENTIAL EQUATION AND MARKOV PROCESS

EVOLUTIONARY DISTANCE MODEL BASED ON DIFFERENTIAL EQUATION AND MARKOV PROCESS August 0 Vol 4 No 005-0 JATIT & LLS All rights reserved ISSN: 99-8645 wwwjatitorg E-ISSN: 87-95 EVOLUTIONAY DISTANCE MODEL BASED ON DIFFEENTIAL EUATION AND MAKOV OCESS XIAOFENG WANG College of Mathematical

More information

"Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky

Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky MOLECULAR PHYLOGENY "Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky EVOLUTION - theory that groups of organisms change over time so that descendeants differ structurally

More information

Homoplasy. Selection of models of molecular evolution. Evolutionary correction. Saturation

Homoplasy. Selection of models of molecular evolution. Evolutionary correction. Saturation Homoplasy Selection of models of molecular evolution David Posada Homoplasy indicates identity not produced by descent from a common ancestor. Graduate class in Phylogenetics, Campus Agrário de Vairão,

More information

Bayesian support is larger than bootstrap support in phylogenetic inference: a mathematical argument

Bayesian support is larger than bootstrap support in phylogenetic inference: a mathematical argument Bayesian support is larger than bootstrap support in phylogenetic inference: a mathematical argument Tom Britton Bodil Svennblad Per Erixon Bengt Oxelman June 20, 2007 Abstract In phylogenetic inference

More information

Phylogenetics. BIOL 7711 Computational Bioscience

Phylogenetics. BIOL 7711 Computational Bioscience Consortium for Comparative Genomics! University of Colorado School of Medicine Phylogenetics BIOL 7711 Computational Bioscience Biochemistry and Molecular Genetics Computational Bioscience Program Consortium

More information

Branch-Length Prior Influences Bayesian Posterior Probability of Phylogeny

Branch-Length Prior Influences Bayesian Posterior Probability of Phylogeny Syst. Biol. 54(3):455 470, 2005 Copyright c Society of Systematic Biologists ISSN: 1063-5157 print / 1076-836X online DOI: 10.1080/10635150590945313 Branch-Length Prior Influences Bayesian Posterior Probability

More information

Bioinformatics 1. Sepp Hochreiter. Biology, Sequences, Phylogenetics Part 4. Bioinformatics 1: Biology, Sequences, Phylogenetics

Bioinformatics 1. Sepp Hochreiter. Biology, Sequences, Phylogenetics Part 4. Bioinformatics 1: Biology, Sequences, Phylogenetics Bioinformatics 1 Biology, Sequences, Phylogenetics Part 4 Sepp Hochreiter Klausur Mo. 30.01.2011 Zeit: 15:30 17:00 Raum: HS14 Anmeldung Kusss Contents Methods and Bootstrapping of Maximum Methods Methods

More information

Bayesian Phylogenetics

Bayesian Phylogenetics Bayesian Phylogenetics 30 July 2014 Workshop on Molecular Evolution Woods Hole Paul O. Lewis Department of Ecology & Evolutionary Biology Paul O. Lewis (2014 Woods Hole Molecular Evolution Workshop) 1

More information

The Phylo- HMM approach to problems in comparative genomics, with examples.

The Phylo- HMM approach to problems in comparative genomics, with examples. The Phylo- HMM approach to problems in comparative genomics, with examples. Keith Bettinger Introduction The theory of evolution explains the diversity of organisms on Earth by positing that earlier species

More information

Markov chain Monte-Carlo to estimate speciation and extinction rates: making use of the forest hidden behind the (phylogenetic) tree

Markov chain Monte-Carlo to estimate speciation and extinction rates: making use of the forest hidden behind the (phylogenetic) tree Markov chain Monte-Carlo to estimate speciation and extinction rates: making use of the forest hidden behind the (phylogenetic) tree Nicolas Salamin Department of Ecology and Evolution University of Lausanne

More information

Evolutionary Analysis of Viral Genomes

Evolutionary Analysis of Viral Genomes University of Oxford, Department of Zoology Evolutionary Biology Group Department of Zoology University of Oxford South Parks Road Oxford OX1 3PS, U.K. Fax: +44 1865 271249 Evolutionary Analysis of Viral

More information

Are Guinea Pigs Rodents? The Importance of Adequate Models in Molecular Phylogenetics

Are Guinea Pigs Rodents? The Importance of Adequate Models in Molecular Phylogenetics Journal of Mammalian Evolution, Vol. 4, No. 2, 1997 Are Guinea Pigs Rodents? The Importance of Adequate Models in Molecular Phylogenetics Jack Sullivan1'2 and David L. Swofford1 The monophyly of Rodentia

More information

Nucleotide substitution models

Nucleotide substitution models Nucleotide substitution models Alexander Churbanov University of Wyoming, Laramie Nucleotide substitution models p. 1/23 Jukes and Cantor s model [1] The simples symmetrical model of DNA evolution All

More information

Estimating Divergence Dates from Molecular Sequences

Estimating Divergence Dates from Molecular Sequences Estimating Divergence Dates from Molecular Sequences Andrew Rambaut and Lindell Bromham Department of Zoology, University of Oxford The ability to date the time of divergence between lineages using molecular

More information

Phylogeny of Mixture Models

Phylogeny of Mixture Models Phylogeny of Mixture Models Daniel Štefankovič Department of Computer Science University of Rochester joint work with Eric Vigoda College of Computing Georgia Institute of Technology Outline Introduction

More information

Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks!

Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks! Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks! Paul has many great tools for teaching phylogenetics at his web site: http://hydrodictyon.eeb.uconn.edu/people/plewis

More information

Phylogenetics and Darwin. An Introduction to Phylogenetics. Tree of Life. Darwin s Trees

Phylogenetics and Darwin. An Introduction to Phylogenetics. Tree of Life. Darwin s Trees Phylogenetics and Darwin An Introduction to Phylogenetics Bret Larget larget@stat.wisc.edu Departments of Botany and of Statistics University of Wisconsin Madison February 4, 2008 A phylogeny is a tree

More information

Inferring phylogeny. Today s topics. Milestones of molecular evolution studies Contributions to molecular evolution

Inferring phylogeny. Today s topics. Milestones of molecular evolution studies Contributions to molecular evolution Today s topics Inferring phylogeny Introduction! Distance methods! Parsimony method!"#$%&'(!)* +,-.'/01!23454(6!7!2845*0&4'9#6!:&454(6 ;?@AB=C?DEF Overview of phylogenetic inferences Methodology Methods

More information

POPULATION GENETICS Winter 2005 Lecture 17 Molecular phylogenetics

POPULATION GENETICS Winter 2005 Lecture 17 Molecular phylogenetics POPULATION GENETICS Winter 2005 Lecture 17 Molecular phylogenetics - in deriving a phylogeny our goal is simply to reconstruct the historical relationships between a group of taxa. - before we review the

More information

Concepts and Methods in Molecular Divergence Time Estimation

Concepts and Methods in Molecular Divergence Time Estimation Concepts and Methods in Molecular Divergence Time Estimation 26 November 2012 Prashant P. Sharma American Museum of Natural History Overview 1. Why do we date trees? 2. The molecular clock 3. Local clocks

More information