Reconstruire le passé biologique modèles, méthodes, performances, limites

Size: px
Start display at page:

Download "Reconstruire le passé biologique modèles, méthodes, performances, limites"

Transcription

1 Reconstruire le passé biologique modèles, méthodes, performances, limites Olivier Gascuel Centre de Bioinformatique, Biostatistique et Biologie Intégrative C3BI USR 3756 Institut Pasteur & CNRS

2 Reconstruire le passé biologique modèles, méthodes, performances, limites O. Gascuel, M. Steel Inferring ancestral sequences in taxon-rich phylogenies. Mathematical Biosciences 227(2): O. Gascuel, M. Steel Predicting the ancestral character changes in a tree is typically easier than predicting the root state. Systematic Biology, 63(3):

3 Reconstruire le passé biologique modèles, méthodes, performances, limites Focus on characters rather than trees An introduction to phylogenetics * Motivations * Tree models * Sequence and character evolution models * Ancestral inference methods Inferring the tree root Inferring character changes Uncertainty principle, perpectives

4 Darwin (1837)

5 Haeckel (1875)

6 The Tree of Life

7 A growing impact. Nothing in Biology Makes Sense Except in the Light of Evolution T. Dobzhansky ,000

8 Inferring the root character? A C A T C A G C

9 Broadcasting on trees? Ising model

10 (Adv. App. Prob. 2000)

11 (Adv. App. Prob. 2000) Uniform error probability No branch length (time duration) The tree is fixed, not random

12 Inferring all character changes??????? A C A T C A G C

13 Parallel Adaptations to High Temperatures in the Archean Eon Boussau*, Blanquart* et al Nature 2008

14 HIV1 subtype A Eastern & Southern Europe (Chevenet et al. Bioinformatics 2013)

15 HIV1 subtype C

16 Phylogenetic tree models Unoriented, labelled, binary tree Mathematical expression Search tree Orangutan Gorilla Bonobo Chimpanze Human

17 Phylogenetic tree models Unoriented, labelled, binary tree Mathematical expression Search tree Orangutan Gorilla Human Chimpanze Bonobo

18 Phylogenetic tree models Rooted tree Time dimension (difficult to infer) Orangutan Gorilla Bonobo Chimpanze Human

19 Phylogenetic tree models O(n n ) topologies Orangutan Gorilla Bonobo Chimpanze Human

20 Yule-Harding (YH) speciation model - Topology (1924, 1971) An initial species (leaf) Until we obtain n extant species, randomly select a leaf in the growing tree, and speciate that (ancestral) species into 2 new species Labels are uniformly assigned to the tree leaves Robust to extinction and sampling

21 YH distribution is not uniform Expected number of cherries: n/3 versus n/4 Expected diameter: O(log(n)) versus O(sqrt(n)) Diameter (n = 95) YH Uniform (PDA)

22 Yule-Harding model with time-valued edges The speciation time on a given branch follows an exponential law (without memory) of parameter (expectation = 1 / ) 1/ 1/ 1/ 1/ 1/

23 Yule-Harding model with time-valued edges The minimum of k independent, exponential laws is an exponential law with parameter k 1/ 1/2 O(1/n 1/3 1/4 1/5 1/6 1/7 1/8 1/9

24 Yule-Harding model with time-valued edges The minimum of k independent, exponential laws is an exponential law with parameter k (many other more sophisticated models) 1/ 1/2 O(1/n 1/3 1/4 1/5 1/6 1/7 1/8 1/9

25 Modeling sequence (and character) evolution We aim at explaining the data (alignment) using a probablistic scenario of the evolution of the sites along a phylogeny

26 Modeling sequence (character) evolution A A C

27 Modeling sequence (character) evolution A A A C

28 Modeling sequence (character) evolution A or C A A A C Parsimony

29 Modeling sequence (character) evolution A or C A ACGT ACGT A A C Parsimony Probabilistic modelling

30 Modeling sequence evolution: standard assumptions Evolution is independent among lineages Evolution is memory-less (Markov model) The sites evolve independently and identically Models are time reversible Models are time homogeneous and stationary

31 The simplest RY (0,1) symmetrical Markov, time continuous model R μ Y R Y R. expected number of mutations = t

32 The simplest RY (0,1) symmetrical Markov, time continuous model R μ Y The rate matrix: Q The matrix of probability changes: P t e Qt P t t 2t 1e 1e 2t 2t 1e 1e The equilibrium distribution: R Y 1 2

33 The simplest RY (0,1) symmetrical Markov, time continuous model The rate matrix: Q The matrix of probability changes: The equilibrium distribution: R Y P t t 2t 1e 1e 2t 2t 1e 1e This model is time-reversible: X XY Y YX P t P t We assume stationnarity (frequencies of R and Y are nearly equal)

34 Jukes and Cantor model (JC69) for DNA M = A T C G A T C G Eq. (1/4, 1/4, 1/4, 1/4)

35 Felsenstein 1981 (F81) model for DNA A T C G M = A T C G T A C G C A T G G A T C Eq. ( A, T, C, G ) Felsenstein s 1981 model allows for any arbitrary set of equilibrium frequencies.

36 Kimura 2-parameter (K2P) model for DNA M = A T C G A T C G Eq. (1/4, 1/4, 1/4, 1/4) Kimura s 2-parameter model aims at reflecting the fact that transitions are more frequent than transitions

37 Hasegawa, Kishino,Yano (HKY) model for DNA A T C G M = A T C G T A C G C A T G G A T C Eq. ( A, T, C, G ) The HKY model is a way to incorporate both transition/transversion bias and an arbitrary set of equilibrium frequencies. It captures the two main aspects of DNA evolution.

38 Reconstruction methods: Majority The majority state at the tree tips is predicted (no knowledge of the tree or the model)

39 Reconstruction Methods: Parsimony We minimize the number of changes along tree branches (no knowledge of the model and time duration) 1 st : Recursive postorder calculation (bottom-up)

40 Reconstruction Methods: Parsimony We minimize the number of changes along tree branches (no knowledge of the model and time duration) 2 nd : Recursive preorder calculation (topdown)

41 Maximum Likelihood Require to know (or estimate) the tree, branch lengths, and model parameter values One predicts the maximum posterior probability (MAP) Best possible method!

42 Maximum Likelihood Recursive postorder calculation marginal likelihood of the root states u T v L h T M P h h u M L h U M h' AC,, G, T, ', ', h' AC,, G, T ', ', P h h v M L h V M U V For a tip: L h U, M 1if U h, else 0

43 Maximum Likelihood Computation of the best scenario: We apply (independently!) the same algorithm to every internal nodes Marginal posterior for each We use a dynamic programming approach (Pupko et al. 2000) to compute the scenario with maximal joint probability (but exponential number of scenarios )

44 Results (OG & Steel ) What part of the past is reconstructible? (PAC etc) Can we compare the different methods? (simulations) In this presentation: RY (0/1) symmetric model () Yule-Harding model with t (or n) ( is key) (in which condition the past disappear?) Yule-Harding trees with t fixed and (impact of the sample size?) Extreme trees (examples and counter-examples)

45 Root state: fundamental limitation Yule-Harding trees (YH) with t (or n) For any root prediction method M 1if42:predictiveaccuracyofrootreconstructionwith:speciationrate:substitutionrateMMPAPAMOlivier Gascuel Reconstruire le passé biologique - Polytechnique, Novembre 2017

46 Root state: fundamental limitation Yule-Harding trees (YH) with t (or n) Pif4M 2 1 A1I;LM Mutual information I(;L) and accuracy PA : PAleafsetL nxp4texpt4 et Mutual information erosion with time I;L

47 Root state : parsimony limitation Yule-Harding trees (YH) with t Pif6Parsimony 2 1A PAOlivier Gascuel Reconstruire le passé biologique - Polytechnique, Novembre 2017

48 Root state : Majority rule and MAP (Mossel and Steel 2014) YH trees with t Majority has best possible bound: / = 4 Thus, the same holds for MAP

49 Root state : Majority rule p 1 YH tree, fixed t and : Majority PA With a conservative model: P ii (t) > P ij (t) If i is the root state, we expect a majority of i among tips. But the tree paths are not independent!

50 Root state : Majority rule Star tree: independent paths, laws of large numbers? AA AG AC, AT A C A T C A G A

51 Root state : Majority rule What is the spread of Yule-Harding trees?

52 Root state : Majority rule Spread index: l YX ST ( ) xy, l xy n n1 t X Y Theorem: for any fixed and t, the probability that S(T) is larger than tends to 0 when (speciation rate) Then, T becomes close to a star tree, and the accuracy of the majority rule converges to 1.

53 rsi1olivier Gascuel Reconstruire le passé biologique - Polytechnique, Novembre 2017 Root state : Parsimony and MAP With YH trees, fixed t and : PAPamony MAP 1pPandA p Realistic simulations MAP > Majority > Parsimony Majority is affected by potential sampling biases MAP and Parsimony are surprisingly robust

54 Root/Internal nodes: not that simple! Root: Yes Nodes: No Root: No Nodes: Yes

55 (ed)olivier Gascuel Reconstruire le passé biologique - Polytechnique, Novembre 2017 Internal nodes and YH trees: Yule-Harding trees with t (or n) PAv 21,fix

56 (ed)olivier Gascuel Reconstruire le passé biologique - Polytechnique, Novembre 2017 Internal nodes and YH trees: Yule-Harding trees with t (or n) PAv 21,fix At least half of the nodes are connected to a tip. In a time conditioned YH tree, the expected length of pending branches is 1 / 2 Thus, the mutual information is > 0 and the predictability > 1/2

57 (ed)olivier Gascuel Reconstruire le passé biologique - Polytechnique, Novembre 2017 Internal nodes and YH trees: Yule-Harding trees with t (or n) PAv 21,fix Strong contrast with the tree root A 2 (but no quantitative input ) 1if4P

58 Realistic simulation results: PHKY+nAOlivier Gascuel Reconstruire le passé biologique - Polytechnique, Novembre 2017

59 Discussion Internal nodes are much easier than the tree root Method robustness: model violation (ML, MP, MAJ), sampling bias (ML and MP), tree uncertainty (all) In phylogeography we predict well the flows among countries. (but not the tree root) Lakner et al. (2010) results demonstrate that these methods predict stable/credible ancestral proteins. (but not the future ;))

arxiv: v1 [q-bio.pe] 4 Sep 2013

arxiv: v1 [q-bio.pe] 4 Sep 2013 Version dated: September 5, 2013 Predicting ancestral states in a tree arxiv:1309.0926v1 [q-bio.pe] 4 Sep 2013 Predicting the ancestral character changes in a tree is typically easier than predicting the

More information

Dr. Amira A. AL-Hosary

Dr. Amira A. AL-Hosary Phylogenetic analysis Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic Basics: Biological

More information

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic analysis Phylogenetic Basics: Biological

More information

Phylogenetics: Distance Methods. COMP Spring 2015 Luay Nakhleh, Rice University

Phylogenetics: Distance Methods. COMP Spring 2015 Luay Nakhleh, Rice University Phylogenetics: Distance Methods COMP 571 - Spring 2015 Luay Nakhleh, Rice University Outline Evolutionary models and distance corrections Distance-based methods Evolutionary Models and Distance Correction

More information

Phylogenetic Tree Reconstruction

Phylogenetic Tree Reconstruction I519 Introduction to Bioinformatics, 2011 Phylogenetic Tree Reconstruction Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Evolution theory Speciation Evolution of new organisms is driven

More information

POPULATION GENETICS Winter 2005 Lecture 17 Molecular phylogenetics

POPULATION GENETICS Winter 2005 Lecture 17 Molecular phylogenetics POPULATION GENETICS Winter 2005 Lecture 17 Molecular phylogenetics - in deriving a phylogeny our goal is simply to reconstruct the historical relationships between a group of taxa. - before we review the

More information

How should we go about modeling this? Model parameters? Time Substitution rate Can we observe time or subst. rate? What can we observe?

How should we go about modeling this? Model parameters? Time Substitution rate Can we observe time or subst. rate? What can we observe? How should we go about modeling this? gorilla GAAGTCCTTGAGAAATAAACTGCACACACTGG orangutan GGACTCCTTGAGAAATAAACTGCACACACTGG Model parameters? Time Substitution rate Can we observe time or subst. rate? What

More information

Additive distances. w(e), where P ij is the path in T from i to j. Then the matrix [D ij ] is said to be additive.

Additive distances. w(e), where P ij is the path in T from i to j. Then the matrix [D ij ] is said to be additive. Additive distances Let T be a tree on leaf set S and let w : E R + be an edge-weighting of T, and assume T has no nodes of degree two. Let D ij = e P ij w(e), where P ij is the path in T from i to j. Then

More information

Phylogenetics: Parsimony and Likelihood. COMP Spring 2016 Luay Nakhleh, Rice University

Phylogenetics: Parsimony and Likelihood. COMP Spring 2016 Luay Nakhleh, Rice University Phylogenetics: Parsimony and Likelihood COMP 571 - Spring 2016 Luay Nakhleh, Rice University The Problem Input: Multiple alignment of a set S of sequences Output: Tree T leaf-labeled with S Assumptions

More information

Constructing Evolutionary/Phylogenetic Trees

Constructing Evolutionary/Phylogenetic Trees Constructing Evolutionary/Phylogenetic Trees 2 broad categories: istance-based methods Ultrametric Additive: UPGMA Transformed istance Neighbor-Joining Character-based Maximum Parsimony Maximum Likelihood

More information

Molecular Evolution, course # Final Exam, May 3, 2006

Molecular Evolution, course # Final Exam, May 3, 2006 Molecular Evolution, course #27615 Final Exam, May 3, 2006 This exam includes a total of 12 problems on 7 pages (including this cover page). The maximum number of points obtainable is 150, and at least

More information

Phylogenetics: Likelihood

Phylogenetics: Likelihood 1 Phylogenetics: Likelihood COMP 571 Luay Nakhleh, Rice University The Problem 2 Input: Multiple alignment of a set S of sequences Output: Tree T leaf-labeled with S Assumptions 3 Characters are mutually

More information

Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks!

Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks! Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks! Paul has many great tools for teaching phylogenetics at his web site: http://hydrodictyon.eeb.uconn.edu/people/plewis

More information

Algorithms in Bioinformatics

Algorithms in Bioinformatics Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri Distance Methods Character Methods

More information

9/30/11. Evolution theory. Phylogenetic Tree Reconstruction. Phylogenetic trees (binary trees) Phylogeny (phylogenetic tree)

9/30/11. Evolution theory. Phylogenetic Tree Reconstruction. Phylogenetic trees (binary trees) Phylogeny (phylogenetic tree) I9 Introduction to Bioinformatics, 0 Phylogenetic ree Reconstruction Yuzhen Ye (yye@indiana.edu) School of Informatics & omputing, IUB Evolution theory Speciation Evolution of new organisms is driven by

More information

Substitution = Mutation followed. by Fixation. Common Ancestor ACGATC 1:A G 2:C A GAGATC 3:G A 6:C T 5:T C 4:A C GAAATT 1:G A

Substitution = Mutation followed. by Fixation. Common Ancestor ACGATC 1:A G 2:C A GAGATC 3:G A 6:C T 5:T C 4:A C GAAATT 1:G A GAGATC 3:G A 6:C T Common Ancestor ACGATC 1:A G 2:C A Substitution = Mutation followed 5:T C by Fixation GAAATT 4:A C 1:G A AAAATT GAAATT GAGCTC ACGACC Chimp Human Gorilla Gibbon AAAATT GAAATT GAGCTC ACGACC

More information

Phylogenetic inference

Phylogenetic inference Phylogenetic inference Bas E. Dutilh Systems Biology: Bioinformatic Data Analysis Utrecht University, March 7 th 016 After this lecture, you can discuss (dis-) advantages of different information types

More information

arxiv: v1 [q-bio.pe] 1 Jun 2014

arxiv: v1 [q-bio.pe] 1 Jun 2014 THE MOST PARSIMONIOUS TREE FOR RANDOM DATA MAREIKE FISCHER, MICHELLE GALLA, LINA HERBST AND MIKE STEEL arxiv:46.27v [q-bio.pe] Jun 24 Abstract. Applying a method to reconstruct a phylogenetic tree from

More information

BMI/CS 776 Lecture 4. Colin Dewey

BMI/CS 776 Lecture 4. Colin Dewey BMI/CS 776 Lecture 4 Colin Dewey 2007.02.01 Outline Common nucleotide substitution models Directed graphical models Ancestral sequence inference Poisson process continuous Markov process X t0 X t1 X t2

More information

EVOLUTIONARY DISTANCES

EVOLUTIONARY DISTANCES EVOLUTIONARY DISTANCES FROM STRINGS TO TREES Luca Bortolussi 1 1 Dipartimento di Matematica ed Informatica Università degli studi di Trieste luca@dmi.units.it Trieste, 14 th November 2007 OUTLINE 1 STRINGS:

More information

C.DARWIN ( )

C.DARWIN ( ) C.DARWIN (1809-1882) LAMARCK Each evolutionary lineage has evolved, transforming itself, from a ancestor appeared by spontaneous generation DARWIN All organisms are historically interconnected. Their relationships

More information

"Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky

Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky MOLECULAR PHYLOGENY "Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky EVOLUTION - theory that groups of organisms change over time so that descendeants differ structurally

More information

Maximum Likelihood Until recently the newest method. Popularized by Joseph Felsenstein, Seattle, Washington.

Maximum Likelihood Until recently the newest method. Popularized by Joseph Felsenstein, Seattle, Washington. Maximum Likelihood This presentation is based almost entirely on Peter G. Fosters - "The Idiot s Guide to the Zen of Likelihood in a Nutshell in Seven Days for Dummies, Unleashed. http://www.bioinf.org/molsys/data/idiots.pdf

More information

Inferring Molecular Phylogeny

Inferring Molecular Phylogeny Dr. Walter Salzburger he tree of life, ustav Klimt (1907) Inferring Molecular Phylogeny Inferring Molecular Phylogeny 55 Maximum Parsimony (MP): objections long branches I!! B D long branch attraction

More information

Phylogeny of Mixture Models

Phylogeny of Mixture Models Phylogeny of Mixture Models Daniel Štefankovič Department of Computer Science University of Rochester joint work with Eric Vigoda College of Computing Georgia Institute of Technology Outline Introduction

More information

Sequence Analysis 17: lecture 5. Substitution matrices Multiple sequence alignment

Sequence Analysis 17: lecture 5. Substitution matrices Multiple sequence alignment Sequence Analysis 17: lecture 5 Substitution matrices Multiple sequence alignment Substitution matrices Used to score aligned positions, usually of amino acids. Expressed as the log-likelihood ratio of

More information

BINF6201/8201. Molecular phylogenetic methods

BINF6201/8201. Molecular phylogenetic methods BINF60/80 Molecular phylogenetic methods 0-7-06 Phylogenetics Ø According to the evolutionary theory, all life forms on this planet are related to one another by descent. Ø Traditionally, phylogenetics

More information

Phylogenetics: Building Phylogenetic Trees

Phylogenetics: Building Phylogenetic Trees 1 Phylogenetics: Building Phylogenetic Trees COMP 571 Luay Nakhleh, Rice University 2 Four Questions Need to be Answered What data should we use? Which method should we use? Which evolutionary model should

More information

Lecture 4: Evolutionary models and substitution matrices (PAM and BLOSUM).

Lecture 4: Evolutionary models and substitution matrices (PAM and BLOSUM). 1 Bioinformatics: In-depth PROBABILITY & STATISTICS Spring Semester 2011 University of Zürich and ETH Zürich Lecture 4: Evolutionary models and substitution matrices (PAM and BLOSUM). Dr. Stefanie Muff

More information

Lecture 4. Models of DNA and protein change. Likelihood methods

Lecture 4. Models of DNA and protein change. Likelihood methods Lecture 4. Models of DNA and protein change. Likelihood methods Joe Felsenstein Department of Genome Sciences and Department of Biology Lecture 4. Models of DNA and protein change. Likelihood methods p.1/36

More information

Phylogenetics: Parsimony

Phylogenetics: Parsimony 1 Phylogenetics: Parsimony COMP 571 Luay Nakhleh, Rice University he Problem 2 Input: Multiple alignment of a set S of sequences Output: ree leaf-labeled with S Assumptions Characters are mutually independent

More information

π b = a π a P a,b = Q a,b δ + o(δ) = 1 + Q a,a δ + o(δ) = I 4 + Qδ + o(δ),

π b = a π a P a,b = Q a,b δ + o(δ) = 1 + Q a,a δ + o(δ) = I 4 + Qδ + o(δ), ABC estimation of the scaled effective population size. Geoff Nicholls, DTC 07/05/08 Refer to http://www.stats.ox.ac.uk/~nicholls/dtc/tt08/ for material. We will begin with a practical on ABC estimation

More information

Phylogenetics: Building Phylogenetic Trees. COMP Fall 2010 Luay Nakhleh, Rice University

Phylogenetics: Building Phylogenetic Trees. COMP Fall 2010 Luay Nakhleh, Rice University Phylogenetics: Building Phylogenetic Trees COMP 571 - Fall 2010 Luay Nakhleh, Rice University Four Questions Need to be Answered What data should we use? Which method should we use? Which evolutionary

More information

A (short) introduction to phylogenetics

A (short) introduction to phylogenetics A (short) introduction to phylogenetics Thibaut Jombart, Marie-Pauline Beugin MRC Centre for Outbreak Analysis and Modelling Imperial College London Genetic data analysis with PR Statistics, Millport Field

More information

Phylogenetic Assumptions

Phylogenetic Assumptions Substitution Models and the Phylogenetic Assumptions Vivek Jayaswal Lars S. Jermiin COMMONWEALTH OF AUSTRALIA Copyright htregulation WARNING This material has been reproduced and communicated to you by

More information

Estimating Phylogenies (Evolutionary Trees) II. Biol4230 Thurs, March 2, 2017 Bill Pearson Jordan 6-057

Estimating Phylogenies (Evolutionary Trees) II. Biol4230 Thurs, March 2, 2017 Bill Pearson Jordan 6-057 Estimating Phylogenies (Evolutionary Trees) II Biol4230 Thurs, March 2, 2017 Bill Pearson wrp@virginia.edu 4-2818 Jordan 6-057 Tree estimation strategies: Parsimony?no model, simply count minimum number

More information

Probabilistic modeling and molecular phylogeny

Probabilistic modeling and molecular phylogeny Probabilistic modeling and molecular phylogeny Anders Gorm Pedersen Molecular Evolution Group Center for Biological Sequence Analysis Technical University of Denmark (DTU) What is a model? Mathematical

More information

Lecture 4: Evolutionary Models and Substitution Matrices (PAM and BLOSUM)

Lecture 4: Evolutionary Models and Substitution Matrices (PAM and BLOSUM) Bioinformatics II Probability and Statistics Universität Zürich and ETH Zürich Spring Semester 2009 Lecture 4: Evolutionary Models and Substitution Matrices (PAM and BLOSUM) Dr Fraser Daly adapted from

More information

Constructing Evolutionary/Phylogenetic Trees

Constructing Evolutionary/Phylogenetic Trees Constructing Evolutionary/Phylogenetic Trees 2 broad categories: Distance-based methods Ultrametric Additive: UPGMA Transformed Distance Neighbor-Joining Character-based Maximum Parsimony Maximum Likelihood

More information

Molecular Evolution and Phylogenetic Tree Reconstruction

Molecular Evolution and Phylogenetic Tree Reconstruction 1 4 Molecular Evolution and Phylogenetic Tree Reconstruction 3 2 5 1 4 2 3 5 Orthology, Paralogy, Inparalogs, Outparalogs Phylogenetic Trees Nodes: species Edges: time of independent evolution Edge length

More information

进化树构建方法的概率方法 第 4 章 : 进化树构建的概率方法 问题介绍. 部分 lid 修改自 i i f l 的 ih l i

进化树构建方法的概率方法 第 4 章 : 进化树构建的概率方法 问题介绍. 部分 lid 修改自 i i f l 的 ih l i 第 4 章 : 进化树构建的概率方法 问题介绍 进化树构建方法的概率方法 部分 lid 修改自 i i f l 的 ih l i 部分 Slides 修改自 University of Basel 的 Michael Springmann 课程 CS302 Seminar Life Science Informatics 的讲义 Phylogenetic Tree branch internal node

More information

Maximum Likelihood Tree Estimation. Carrie Tribble IB Feb 2018

Maximum Likelihood Tree Estimation. Carrie Tribble IB Feb 2018 Maximum Likelihood Tree Estimation Carrie Tribble IB 200 9 Feb 2018 Outline 1. Tree building process under maximum likelihood 2. Key differences between maximum likelihood and parsimony 3. Some fancy extras

More information

TheDisk-Covering MethodforTree Reconstruction

TheDisk-Covering MethodforTree Reconstruction TheDisk-Covering MethodforTree Reconstruction Daniel Huson PACM, Princeton University Bonn, 1998 1 Copyright (c) 2008 Daniel Huson. Permission is granted to copy, distribute and/or modify this document

More information

Lecture 27. Phylogeny methods, part 4 (Models of DNA and protein change) p.1/26

Lecture 27. Phylogeny methods, part 4 (Models of DNA and protein change) p.1/26 Lecture 27. Phylogeny methods, part 4 (Models of DNA and protein change) Joe Felsenstein Department of Genome Sciences and Department of Biology Lecture 27. Phylogeny methods, part 4 (Models of DNA and

More information

Using algebraic geometry for phylogenetic reconstruction

Using algebraic geometry for phylogenetic reconstruction Using algebraic geometry for phylogenetic reconstruction Marta Casanellas i Rius (joint work with Jesús Fernández-Sánchez) Departament de Matemàtica Aplicada I Universitat Politècnica de Catalunya IMA

More information

Concepts and Methods in Molecular Divergence Time Estimation

Concepts and Methods in Molecular Divergence Time Estimation Concepts and Methods in Molecular Divergence Time Estimation 26 November 2012 Prashant P. Sharma American Museum of Natural History Overview 1. Why do we date trees? 2. The molecular clock 3. Local clocks

More information

Evolutionary trees. Describe the relationship between objects, e.g. species or genes

Evolutionary trees. Describe the relationship between objects, e.g. species or genes Evolutionary trees Bonobo Chimpanzee Human Neanderthal Gorilla Orangutan Describe the relationship between objects, e.g. species or genes Early evolutionary studies The evolutionary relationships between

More information

Estimating Evolutionary Trees. Phylogenetic Methods

Estimating Evolutionary Trees. Phylogenetic Methods Estimating Evolutionary Trees v if the data are consistent with infinite sites then all methods should yield the same tree v it gets more complicated when there is homoplasy, i.e., parallel or convergent

More information

Evolutionary Tree Analysis. Overview

Evolutionary Tree Analysis. Overview CSI/BINF 5330 Evolutionary Tree Analysis Young-Rae Cho Associate Professor Department of Computer Science Baylor University Overview Backgrounds Distance-Based Evolutionary Tree Reconstruction Character-Based

More information

Taming the Beast Workshop

Taming the Beast Workshop Workshop and Chi Zhang June 28, 2016 1 / 19 Species tree Species tree the phylogeny representing the relationships among a group of species Figure adapted from [Rogers and Gibbs, 2014] Gene tree the phylogeny

More information

Improving divergence time estimation in phylogenetics: more taxa vs. longer sequences

Improving divergence time estimation in phylogenetics: more taxa vs. longer sequences Mathematical Statistics Stockholm University Improving divergence time estimation in phylogenetics: more taxa vs. longer sequences Bodil Svennblad Tom Britton Research Report 2007:2 ISSN 650-0377 Postal

More information

Phylogenetic Analysis. Han Liang, Ph.D. Assistant Professor of Bioinformatics and Computational Biology UT MD Anderson Cancer Center

Phylogenetic Analysis. Han Liang, Ph.D. Assistant Professor of Bioinformatics and Computational Biology UT MD Anderson Cancer Center Phylogenetic Analysis Han Liang, Ph.D. Assistant Professor of Bioinformatics and Computational Biology UT MD Anderson Cancer Center Outline Basic Concepts Tree Construction Methods Distance-based methods

More information

Phylogenetics. BIOL 7711 Computational Bioscience

Phylogenetics. BIOL 7711 Computational Bioscience Consortium for Comparative Genomics! University of Colorado School of Medicine Phylogenetics BIOL 7711 Computational Bioscience Biochemistry and Molecular Genetics Computational Bioscience Program Consortium

More information

Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks!

Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks! Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks! Paul has many great tools for teaching phylogenetics at his web site: http://hydrodictyon.eeb.uconn.edu/people/plewis

More information

Letter to the Editor. Department of Biology, Arizona State University

Letter to the Editor. Department of Biology, Arizona State University Letter to the Editor Traditional Phylogenetic Reconstruction Methods Reconstruct Shallow and Deep Evolutionary Relationships Equally Well Michael S. Rosenberg and Sudhir Kumar Department of Biology, Arizona

More information

Chapter 7: Models of discrete character evolution

Chapter 7: Models of discrete character evolution Chapter 7: Models of discrete character evolution pdf version R markdown to recreate analyses Biological motivation: Limblessness as a discrete trait Squamates, the clade that includes all living species

More information

The statistical and informatics challenges posed by ascertainment biases in phylogenetic data collection

The statistical and informatics challenges posed by ascertainment biases in phylogenetic data collection The statistical and informatics challenges posed by ascertainment biases in phylogenetic data collection Mark T. Holder and Jordan M. Koch Department of Ecology and Evolutionary Biology, University of

More information

Bayesian Inference using Markov Chain Monte Carlo in Phylogenetic Studies

Bayesian Inference using Markov Chain Monte Carlo in Phylogenetic Studies Bayesian Inference using Markov Chain Monte Carlo in Phylogenetic Studies 1 What is phylogeny? Essay written for the course in Markov Chains 2004 Torbjörn Karfunkel Phylogeny is the evolutionary development

More information

Algebraic Statistics Tutorial I

Algebraic Statistics Tutorial I Algebraic Statistics Tutorial I Seth Sullivant North Carolina State University June 9, 2012 Seth Sullivant (NCSU) Algebraic Statistics June 9, 2012 1 / 34 Introduction to Algebraic Geometry Let R[p] =

More information

Likelihood Ratio Tests for Detecting Positive Selection and Application to Primate Lysozyme Evolution

Likelihood Ratio Tests for Detecting Positive Selection and Application to Primate Lysozyme Evolution Likelihood Ratio Tests for Detecting Positive Selection and Application to Primate Lysozyme Evolution Ziheng Yang Department of Biology, University College, London An excess of nonsynonymous substitutions

More information

Lecture 24. Phylogeny methods, part 4 (Models of DNA and protein change) p.1/22

Lecture 24. Phylogeny methods, part 4 (Models of DNA and protein change) p.1/22 Lecture 24. Phylogeny methods, part 4 (Models of DNA and protein change) Joe Felsenstein Department of Genome Sciences and Department of Biology Lecture 24. Phylogeny methods, part 4 (Models of DNA and

More information

Reconstruction of certain phylogenetic networks from their tree-average distances

Reconstruction of certain phylogenetic networks from their tree-average distances Reconstruction of certain phylogenetic networks from their tree-average distances Stephen J. Willson Department of Mathematics Iowa State University Ames, IA 50011 USA swillson@iastate.edu October 10,

More information

Theory of Evolution Charles Darwin

Theory of Evolution Charles Darwin Theory of Evolution Charles arwin 858-59: Origin of Species 5 year voyage of H.M.S. eagle (83-36) Populations have variations. Natural Selection & Survival of the fittest: nature selects best adapted varieties

More information

Lie Markov models. Jeremy Sumner. School of Physical Sciences University of Tasmania, Australia

Lie Markov models. Jeremy Sumner. School of Physical Sciences University of Tasmania, Australia Lie Markov models Jeremy Sumner School of Physical Sciences University of Tasmania, Australia Stochastic Modelling Meets Phylogenetics, UTAS, November 2015 Jeremy Sumner Lie Markov models 1 / 23 The theory

More information

1. Can we use the CFN model for morphological traits?

1. Can we use the CFN model for morphological traits? 1. Can we use the CFN model for morphological traits? 2. Can we use something like the GTR model for morphological traits? 3. Stochastic Dollo. 4. Continuous characters. Mk models k-state variants of the

More information

From Individual-based Population Models to Lineage-based Models of Phylogenies

From Individual-based Population Models to Lineage-based Models of Phylogenies From Individual-based Population Models to Lineage-based Models of Phylogenies Amaury Lambert (joint works with G. Achaz, H.K. Alexander, R.S. Etienne, N. Lartillot, H. Morlon, T.L. Parsons, T. Stadler)

More information

Consistency Index (CI)

Consistency Index (CI) Consistency Index (CI) minimum number of changes divided by the number required on the tree. CI=1 if there is no homoplasy negatively correlated with the number of species sampled Retention Index (RI)

More information

Massachusetts Institute of Technology Computational Evolutionary Biology, Fall, 2005 Notes for November 7: Molecular evolution

Massachusetts Institute of Technology Computational Evolutionary Biology, Fall, 2005 Notes for November 7: Molecular evolution Massachusetts Institute of Technology 6.877 Computational Evolutionary Biology, Fall, 2005 Notes for November 7: Molecular evolution 1. Rates of amino acid replacement The initial motivation for the neutral

More information

Lecture Notes: Markov chains

Lecture Notes: Markov chains Computational Genomics and Molecular Biology, Fall 5 Lecture Notes: Markov chains Dannie Durand At the beginning of the semester, we introduced two simple scoring functions for pairwise alignments: a similarity

More information

HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM

HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM I529: Machine Learning in Bioinformatics (Spring 2017) HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM Yuzhen Ye School of Informatics and Computing Indiana University, Bloomington

More information

Molecular Evolution & Phylogenetics

Molecular Evolution & Phylogenetics Molecular Evolution & Phylogenetics Heuristics based on tree alterations, maximum likelihood, Bayesian methods, statistical confidence measures Jean-Baka Domelevo Entfellner Learning Objectives know basic

More information

Phylogenetic Trees. Phylogenetic Trees Five. Phylogeny: Inference Tool. Phylogeny Terminology. Picture of Last Quagga. Importance of Phylogeny 5.

Phylogenetic Trees. Phylogenetic Trees Five. Phylogeny: Inference Tool. Phylogeny Terminology. Picture of Last Quagga. Importance of Phylogeny 5. Five Sami Khuri Department of Computer Science San José State University San José, California, USA sami.khuri@sjsu.edu v Distance Methods v Character Methods v Molecular Clock v UPGMA v Maximum Parsimony

More information

Phylogenetic invariants versus classical phylogenetics

Phylogenetic invariants versus classical phylogenetics Phylogenetic invariants versus classical phylogenetics Marta Casanellas Rius (joint work with Jesús Fernández-Sánchez) Departament de Matemàtica Aplicada I Universitat Politècnica de Catalunya Algebraic

More information

Lecture 6 Phylogenetic Inference

Lecture 6 Phylogenetic Inference Lecture 6 Phylogenetic Inference From Darwin s notebook in 1837 Charles Darwin Willi Hennig From The Origin in 1859 Cladistics Phylogenetic inference Willi Hennig, Cladistics 1. Clade, Monophyletic group,

More information

Evolutionary Models. Evolutionary Models

Evolutionary Models. Evolutionary Models Edit Operators In standard pairwise alignment, what are the allowed edit operators that transform one sequence into the other? Describe how each of these edit operations are represented on a sequence alignment

More information

3/1/17. Content. TWINSCAN model. Example. TWINSCAN algorithm. HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM

3/1/17. Content. TWINSCAN model. Example. TWINSCAN algorithm. HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM I529: Machine Learning in Bioinformatics (Spring 2017) Content HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM Yuzhen Ye School of Informatics and Computing Indiana University,

More information

The Generalized Neighbor Joining method

The Generalized Neighbor Joining method The Generalized Neighbor Joining method Ruriko Yoshida Dept. of Mathematics Duke University Joint work with Dan Levy and Lior Pachter www.math.duke.edu/ ruriko data mining 1 Challenge We would like to

More information

Discrete & continuous characters: The threshold model

Discrete & continuous characters: The threshold model Discrete & continuous characters: The threshold model Discrete & continuous characters: the threshold model So far we have discussed continuous & discrete character models separately for estimating ancestral

More information

Algorithmic Methods Well-defined methodology Tree reconstruction those that are well-defined enough to be carried out by a computer. Felsenstein 2004,

Algorithmic Methods Well-defined methodology Tree reconstruction those that are well-defined enough to be carried out by a computer. Felsenstein 2004, Tracing the Evolution of Numerical Phylogenetics: History, Philosophy, and Significance Adam W. Ferguson Phylogenetic Systematics 26 January 2009 Inferring Phylogenies Historical endeavor Darwin- 1837

More information

Integrative Biology 200 "PRINCIPLES OF PHYLOGENETICS" Spring 2016 University of California, Berkeley. Parsimony & Likelihood [draft]

Integrative Biology 200 PRINCIPLES OF PHYLOGENETICS Spring 2016 University of California, Berkeley. Parsimony & Likelihood [draft] Integrative Biology 200 "PRINCIPLES OF PHYLOGENETICS" Spring 2016 University of California, Berkeley K.W. Will Parsimony & Likelihood [draft] 1. Hennig and Parsimony: Hennig was not concerned with parsimony

More information

Identifiability of the GTR+Γ substitution model (and other models) of DNA evolution

Identifiability of the GTR+Γ substitution model (and other models) of DNA evolution Identifiability of the GTR+Γ substitution model (and other models) of DNA evolution Elizabeth S. Allman Dept. of Mathematics and Statistics University of Alaska Fairbanks TM Current Challenges and Problems

More information

"PRINCIPLES OF PHYLOGENETICS: ECOLOGY AND EVOLUTION" Integrative Biology 200B Spring 2009 University of California, Berkeley

PRINCIPLES OF PHYLOGENETICS: ECOLOGY AND EVOLUTION Integrative Biology 200B Spring 2009 University of California, Berkeley "PRINCIPLES OF PHYLOGENETICS: ECOLOGY AND EVOLUTION" Integrative Biology 200B Spring 2009 University of California, Berkeley B.D. Mishler Jan. 22, 2009. Trees I. Summary of previous lecture: Hennigian

More information

Phylogeny: building the tree of life

Phylogeny: building the tree of life Phylogeny: building the tree of life Dr. Fayyaz ul Amir Afsar Minhas Department of Computer and Information Sciences Pakistan Institute of Engineering & Applied Sciences PO Nilore, Islamabad, Pakistan

More information

A Phylogenetic Network Construction due to Constrained Recombination

A Phylogenetic Network Construction due to Constrained Recombination A Phylogenetic Network Construction due to Constrained Recombination Mohd. Abdul Hai Zahid Research Scholar Research Supervisors: Dr. R.C. Joshi Dr. Ankush Mittal Department of Electronics and Computer

More information

Minimum evolution using ordinary least-squares is less robust than neighbor-joining

Minimum evolution using ordinary least-squares is less robust than neighbor-joining Minimum evolution using ordinary least-squares is less robust than neighbor-joining Stephen J. Willson Department of Mathematics Iowa State University Ames, IA 50011 USA email: swillson@iastate.edu November

More information

Is the equal branch length model a parsimony model?

Is the equal branch length model a parsimony model? Table 1: n approximation of the probability of data patterns on the tree shown in figure?? made by dropping terms that do not have the minimal exponent for p. Terms that were dropped are shown in red;

More information

Maximum Likelihood in Phylogenetics

Maximum Likelihood in Phylogenetics Maximum Likelihood in Phylogenetics June 1, 2009 Smithsonian Workshop on Molecular Evolution Paul O. Lewis Department of Ecology & Evolutionary Biology University of Connecticut, Storrs, CT Copyright 2009

More information

Inferring Phylogenetic Trees. Distance Approaches. Representing distances. in rooted and unrooted trees. The distance approach to phylogenies

Inferring Phylogenetic Trees. Distance Approaches. Representing distances. in rooted and unrooted trees. The distance approach to phylogenies Inferring Phylogenetic Trees Distance Approaches Representing distances in rooted and unrooted trees The distance approach to phylogenies given: an n n matrix M where M ij is the distance between taxa

More information

STA 4273H: Statistical Machine Learning

STA 4273H: Statistical Machine Learning STA 4273H: Statistical Machine Learning Russ Salakhutdinov Department of Statistics! rsalakhu@utstat.toronto.edu! http://www.utstat.utoronto.ca/~rsalakhu/ Sidney Smith Hall, Room 6002 Lecture 3 Linear

More information

Week 5: Distance methods, DNA and protein models

Week 5: Distance methods, DNA and protein models Week 5: Distance methods, DNA and protein models Genome 570 February, 2016 Week 5: Distance methods, DNA and protein models p.1/69 A tree and the expected distances it predicts E A 0.08 0.05 0.06 0.03

More information

Molecular Evolution & Phylogenetics Traits, phylogenies, evolutionary models and divergence time between sequences

Molecular Evolution & Phylogenetics Traits, phylogenies, evolutionary models and divergence time between sequences Molecular Evolution & Phylogenetics Traits, phylogenies, evolutionary models and divergence time between sequences Basic Bioinformatics Workshop, ILRI Addis Ababa, 12 December 2017 1 Learning Objectives

More information

BIOL 1010 Introduction to Biology: The Evolution and Diversity of Life. Spring 2011 Sections A & B

BIOL 1010 Introduction to Biology: The Evolution and Diversity of Life. Spring 2011 Sections A & B BIOL 1010 Introduction to Biology: The Evolution and Diversity of Life. Spring 2011 Sections A & B Steve Thompson: stthompson@valdosta.edu http://www.bioinfo4u.net 1 ʻTree of Life,ʼ ʻprimitive,ʼ ʻprogressʼ

More information

Probability Distribution of Molecular Evolutionary Trees: A New Method of Phylogenetic Inference

Probability Distribution of Molecular Evolutionary Trees: A New Method of Phylogenetic Inference J Mol Evol (1996) 43:304 311 Springer-Verlag New York Inc. 1996 Probability Distribution of Molecular Evolutionary Trees: A New Method of Phylogenetic Inference Bruce Rannala, Ziheng Yang Department of

More information

Stochastic Errors vs. Modeling Errors in Distance Based Phylogenetic Reconstructions

Stochastic Errors vs. Modeling Errors in Distance Based Phylogenetic Reconstructions PLGW05 Stochastic Errors vs. Modeling Errors in Distance Based Phylogenetic Reconstructions 1 joint work with Ilan Gronau 2, Shlomo Moran 3, and Irad Yavneh 3 1 2 Dept. of Biological Statistics and Computational

More information

Bioinformatics 1. Sepp Hochreiter. Biology, Sequences, Phylogenetics Part 4. Bioinformatics 1: Biology, Sequences, Phylogenetics

Bioinformatics 1. Sepp Hochreiter. Biology, Sequences, Phylogenetics Part 4. Bioinformatics 1: Biology, Sequences, Phylogenetics Bioinformatics 1 Biology, Sequences, Phylogenetics Part 4 Sepp Hochreiter Klausur Mo. 30.01.2011 Zeit: 15:30 17:00 Raum: HS14 Anmeldung Kusss Contents Methods and Bootstrapping of Maximum Methods Methods

More information

Using phylogenetics to estimate species divergence times... Basics and basic issues for Bayesian inference of divergence times (plus some digression)

Using phylogenetics to estimate species divergence times... Basics and basic issues for Bayesian inference of divergence times (plus some digression) Using phylogenetics to estimate species divergence times... More accurately... Basics and basic issues for Bayesian inference of divergence times (plus some digression) "A comparison of the structures

More information

Evolutionary trees. Describe the relationship between objects, e.g. species or genes

Evolutionary trees. Describe the relationship between objects, e.g. species or genes Evolutionary trees Bonobo Chimpanzee Human Neanderthal Gorilla Orangutan Describe the relationship between objects, e.g. species or genes Early evolutionary studies Anatomical features were the dominant

More information

Properties of normal phylogenetic networks

Properties of normal phylogenetic networks Properties of normal phylogenetic networks Stephen J. Willson Department of Mathematics Iowa State University Ames, IA 50011 USA swillson@iastate.edu August 13, 2009 Abstract. A phylogenetic network is

More information

Inferring Speciation Times under an Episodic Molecular Clock

Inferring Speciation Times under an Episodic Molecular Clock Syst. Biol. 56(3):453 466, 2007 Copyright c Society of Systematic Biologists ISSN: 1063-5157 print / 1076-836X online DOI: 10.1080/10635150701420643 Inferring Speciation Times under an Episodic Molecular

More information

What is Phylogenetics

What is Phylogenetics What is Phylogenetics Phylogenetics is the area of research concerned with finding the genetic connections and relationships between species. The basic idea is to compare specific characters (features)

More information