Maximum Likelihood Tree Estimation. Carrie Tribble IB Feb 2018

Size: px
Start display at page:

Download "Maximum Likelihood Tree Estimation. Carrie Tribble IB Feb 2018"

Transcription

1 Maximum Likelihood Tree Estimation Carrie Tribble IB Feb 2018

2 Outline 1. Tree building process under maximum likelihood 2. Key differences between maximum likelihood and parsimony 3. Some fancy extras

3 It [maximum likelihood] involves finding that evolutionary tree which yields the highest probability of evolving the observed data (Felsenstein 1981).

4 Maximum Likelihood Likelihood = P(D M) Probability Data Model

5 Maximum Likelihood Likelihood = P(D M) Probability Alignment Topology (Ψ), Branch lengths (v), Model Parameters (θ)

6 Toss a coin 10 times: H T H H T T H H H H Probability of heads is p Probability of tails is 1-p What is the probability of our data given our model of a two-sided coin? H T H H T T H H H H L = p * (1-p) * p * p *(1-p) * (1-p) * p * p * p * p L = p 7 * (1-p) 3

7 p = seq(from = 0, to = 1, by = 0.01) L = p^7 * (1 p)^3

8 Our new approach 1. Build a model of character evolution 2. Use that model to calculate the likelihood of a particular phylogeny 3. Find the tree/ parameter values with the highest likelihood (maximum likelihood)

9 Our new approach: Step 1 Build a model of character evolution What is a model? Parameters vs. parameter values A T C G A???? T???? C???? G????

10 Our new approach: Step 1 Build a model of character evolution What is a model? Parameters vs. parameter values A T C G A - a a a T a - a a C a a - a G a a a -

11 Our new approach: Step 1 Build a model of character evolution What is a model? Parameters vs. parameter values A T C G A T C G

12 Our new approach: Step 1 Build a model of character evolution What is a model? Parameters vs. parameter values Modified from Huelsenbeck 2017

13 Q = Jukes Cantor (JC69) A G C T A - μ/3 μ/3 μ/3 G μ/3 - μ/3 μ/3 C μ/3 μ/3 - μ/3 T μ/3 μ/3 μ/3 - Kimura (K80) A G C T A - K 1 1 G K C K T 1 1 K - * μ A <-> G: Transition (purine purine) C <-> T: Transition (pyrimadine pyrimadine) Felsenstein (F81) A G C T A - π G π C π T G π A - π C π T C π A π G - π T T π A π G π C - Hasegawa, Kishino, Yano (HKY85) A G C T A - kπ G π C π T * μ G kπ A - π C π T * μ C π A π G - kπ T T π A π G kπ C - Base frequencies vary

14 General Time Reversible (GTR): A G C T A - απ G βπ C γπ T G απ A - δπ C επ T * μ C βπ A δπ G - ηπ T T γπ A επ G ηπ C - Rate parameters: α = A <-> G β = A <-> C γ = A <-> T δ = C <-> G ε = T <-> G η = T <-> C Stationary base frequencies: π A = frequency of A π G = frequency of G π C = frequency of A π T = frequency of T

15 General Time Reversible (GTR): Markov models are memoryless A G C T A - απ G βπ C γπ T G απ A - δπ C επ T * μ C βπ A δπ G - ηπ T T γπ A επ G ηπ C - Rate parameters: α = A <-> G β = A <-> C γ = A <-> T δ = C <-> G ε = T <-> G η = T <-> C Stationary base frequencies: π A = frequency of A π G = frequency of G π C = frequency of A π T = frequency of T

16

17 Our new approach: Step 2 It [maximum likelihood] involves finding that evolutionary tree which yields the highest probability of evolving the observed data (Felsenstein 1981). GAATC GTATC AAATC GAATC GTATC AAATC GAATC GTATC AAATC Let s start with one site in the alignment

18 Our new approach: Step 2 P ij (t) π s0 Felsenstein 1981

19 Our new approach: Step Probability of node for all possible base pairs Felsenstein s pruning algorithm Figured modified from Huelsenbeck 2017

20 Where do we get P ij (t) and π s0? Q = A G C T A -3λ λ λ λ G λ -3λ λ λ C λ λ -3λ λ T λ λ λ -3λ A G C T P(t) = e Qt = A p 0 (t) p 1 (t) p 1 (t) p 1 (t) G p 1 (t) p 0 (t) p 1 (t) p 1 (t) C p 1 (t) p 1 (t) p 0 (t) p 1 (t) with, p 0 (t) = ¼ + ¾e -4λt p 1 (t) = ¼ - ¼e -4λt T p 1 (t) p 1 (t) p 1 (t) p 0 (t)

21 Pick a tree & parameter values Use Felsenstein s Pruning Algorithm & your model of evolution to calculate the likelihood of a tree for a single site in an alignment Assume all sites in alignment are independent & multiply likelihoods of all sites to calculate the likelihood of the tree given the alignment Vary parameter values for that topology to find the maximum likelihood Pick a new tree, repeat! Overview:

22 This process is often untenable computationally Number of rooted trees increases A LOT with increasing number of taxa multiplying small number -> smaller numbers so we use log likelihood

23

24 Main differences: Branch length matter!!!!! Estimation of parameters Model underlies the process

25 Main differences: Branch length matter!!!!! ATTCG ATTCG Time What happened along the branches? ATTCG ATTCG

26 Main differences: Branch length matter!!!!! ATTCG ATTCG Time C -> G What happened along the branches? ATTCG G -> C ATTCG

27 Main differences: Branch length matter!!!!! Estimation of parameters Model underlies the process

28 Main differences: Branch lengths matter!!!!! Estimation of parameters How does this compare to weighting in parsimony?

29 Fancy Things Error? Rate heterogeneity Model testing Additional models (codon, amino acid, etc.)

30 Get idea of error through bootstrapping But what error is this measuring?

31 Rate Heterogeneity: Partitions gene1 gene2 gene3 gene4 gene5 A G C T A -3λ λ λ λ G λ -3λ λ λ C λ λ -3λ λ T λ λ λ -3λ

32 Rate Heterogeneity: Partitions A G C T A G C T A -3λ λ λ λ A -3λ λ λ λ G λ -3λ λ λ G λ -3λ λ λ C λ λ -3λ λ C λ λ -3λ λ T λ λ λ -3λ T λ λ λ -3λ gene1 gene2 gene3 gene4 gene5 A G C T A -3λ λ λ λ G λ -3λ λ λ C λ λ -3λ λ T λ λ λ -3λ A G C T A -3λ λ λ λ G λ -3λ λ λ C λ λ -3λ λ T λ λ λ -3λ A G C T A -3λ λ λ λ G λ -3λ λ λ C λ λ -3λ λ T λ λ λ -3λ Estimate model parameters separately for different genes!

33 Rate Heterogeneity: Partitions gene1 gene2 gene3 gene4 gene5 Estimate model parameters separately for different codon positions!

34 Rate Heterogeneity: gamma (Γ)

35 Model testing Likelihood ratio test for nested models: LR = 2 * (-lnl1 -lnl2) HKY85 -lnl = GTR -lnl = LR = 2( ) = 4.53, df = 4 critical value (P = 0.05) = 9.49 (~chi 2 distribution)

36 Model testing Aikake Information Criterion (AIC) (non nested): Find model with lowest AIC Models need not be nested Can correct for small sample sizes (AICc) BIC is a similar alternative

37 Additional models Amino Acid Codon non-markov What would a model of morphology look like?

Lecture 24. Phylogeny methods, part 4 (Models of DNA and protein change) p.1/22

Lecture 24. Phylogeny methods, part 4 (Models of DNA and protein change) p.1/22 Lecture 24. Phylogeny methods, part 4 (Models of DNA and protein change) Joe Felsenstein Department of Genome Sciences and Department of Biology Lecture 24. Phylogeny methods, part 4 (Models of DNA and

More information

Lecture 27. Phylogeny methods, part 4 (Models of DNA and protein change) p.1/26

Lecture 27. Phylogeny methods, part 4 (Models of DNA and protein change) p.1/26 Lecture 27. Phylogeny methods, part 4 (Models of DNA and protein change) Joe Felsenstein Department of Genome Sciences and Department of Biology Lecture 27. Phylogeny methods, part 4 (Models of DNA and

More information

Lecture 4. Models of DNA and protein change. Likelihood methods

Lecture 4. Models of DNA and protein change. Likelihood methods Lecture 4. Models of DNA and protein change. Likelihood methods Joe Felsenstein Department of Genome Sciences and Department of Biology Lecture 4. Models of DNA and protein change. Likelihood methods p.1/36

More information

Maximum Likelihood Until recently the newest method. Popularized by Joseph Felsenstein, Seattle, Washington.

Maximum Likelihood Until recently the newest method. Popularized by Joseph Felsenstein, Seattle, Washington. Maximum Likelihood This presentation is based almost entirely on Peter G. Fosters - "The Idiot s Guide to the Zen of Likelihood in a Nutshell in Seven Days for Dummies, Unleashed. http://www.bioinf.org/molsys/data/idiots.pdf

More information

Probabilistic modeling and molecular phylogeny

Probabilistic modeling and molecular phylogeny Probabilistic modeling and molecular phylogeny Anders Gorm Pedersen Molecular Evolution Group Center for Biological Sequence Analysis Technical University of Denmark (DTU) What is a model? Mathematical

More information

Phylogenetics: Building Phylogenetic Trees. COMP Fall 2010 Luay Nakhleh, Rice University

Phylogenetics: Building Phylogenetic Trees. COMP Fall 2010 Luay Nakhleh, Rice University Phylogenetics: Building Phylogenetic Trees COMP 571 - Fall 2010 Luay Nakhleh, Rice University Four Questions Need to be Answered What data should we use? Which method should we use? Which evolutionary

More information

Estimating Phylogenies (Evolutionary Trees) II. Biol4230 Thurs, March 2, 2017 Bill Pearson Jordan 6-057

Estimating Phylogenies (Evolutionary Trees) II. Biol4230 Thurs, March 2, 2017 Bill Pearson Jordan 6-057 Estimating Phylogenies (Evolutionary Trees) II Biol4230 Thurs, March 2, 2017 Bill Pearson wrp@virginia.edu 4-2818 Jordan 6-057 Tree estimation strategies: Parsimony?no model, simply count minimum number

More information

Inferring Molecular Phylogeny

Inferring Molecular Phylogeny Dr. Walter Salzburger he tree of life, ustav Klimt (1907) Inferring Molecular Phylogeny Inferring Molecular Phylogeny 55 Maximum Parsimony (MP): objections long branches I!! B D long branch attraction

More information

Phylogenetics: Building Phylogenetic Trees

Phylogenetics: Building Phylogenetic Trees 1 Phylogenetics: Building Phylogenetic Trees COMP 571 Luay Nakhleh, Rice University 2 Four Questions Need to be Answered What data should we use? Which method should we use? Which evolutionary model should

More information

PHYLOGENY ESTIMATION AND HYPOTHESIS TESTING USING MAXIMUM LIKELIHOOD

PHYLOGENY ESTIMATION AND HYPOTHESIS TESTING USING MAXIMUM LIKELIHOOD Annu. Rev. Ecol. Syst. 1997. 28:437 66 Copyright c 1997 by Annual Reviews Inc. All rights reserved PHYLOGENY ESTIMATION AND HYPOTHESIS TESTING USING MAXIMUM LIKELIHOOD John P. Huelsenbeck Department of

More information

Preliminaries. Download PAUP* from: Tuesday, July 19, 16

Preliminaries. Download PAUP* from:   Tuesday, July 19, 16 Preliminaries Download PAUP* from: http://people.sc.fsu.edu/~dswofford/paup_test 1 A model of the Boston T System 1 Idea from Paul Lewis A simpler model? 2 Why do models matter? Model-based methods including

More information

Lab 9: Maximum Likelihood and Modeltest

Lab 9: Maximum Likelihood and Modeltest Integrative Biology 200A University of California, Berkeley "PRINCIPLES OF PHYLOGENETICS" Spring 2010 Updated by Nick Matzke Lab 9: Maximum Likelihood and Modeltest In this lab we re going to use PAUP*

More information

Week 5: Distance methods, DNA and protein models

Week 5: Distance methods, DNA and protein models Week 5: Distance methods, DNA and protein models Genome 570 February, 2016 Week 5: Distance methods, DNA and protein models p.1/69 A tree and the expected distances it predicts E A 0.08 0.05 0.06 0.03

More information

BMI/CS 776 Lecture 4. Colin Dewey

BMI/CS 776 Lecture 4. Colin Dewey BMI/CS 776 Lecture 4 Colin Dewey 2007.02.01 Outline Common nucleotide substitution models Directed graphical models Ancestral sequence inference Poisson process continuous Markov process X t0 X t1 X t2

More information

Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks!

Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks! Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks! Paul has many great tools for teaching phylogenetics at his web site: http://hydrodictyon.eeb.uconn.edu/people/plewis

More information

Substitution = Mutation followed. by Fixation. Common Ancestor ACGATC 1:A G 2:C A GAGATC 3:G A 6:C T 5:T C 4:A C GAAATT 1:G A

Substitution = Mutation followed. by Fixation. Common Ancestor ACGATC 1:A G 2:C A GAGATC 3:G A 6:C T 5:T C 4:A C GAAATT 1:G A GAGATC 3:G A 6:C T Common Ancestor ACGATC 1:A G 2:C A Substitution = Mutation followed 5:T C by Fixation GAAATT 4:A C 1:G A AAAATT GAAATT GAGCTC ACGACC Chimp Human Gorilla Gibbon AAAATT GAAATT GAGCTC ACGACC

More information

Phylogenetics: Distance Methods. COMP Spring 2015 Luay Nakhleh, Rice University

Phylogenetics: Distance Methods. COMP Spring 2015 Luay Nakhleh, Rice University Phylogenetics: Distance Methods COMP 571 - Spring 2015 Luay Nakhleh, Rice University Outline Evolutionary models and distance corrections Distance-based methods Evolutionary Models and Distance Correction

More information

Phylogenetics: Likelihood

Phylogenetics: Likelihood 1 Phylogenetics: Likelihood COMP 571 Luay Nakhleh, Rice University The Problem 2 Input: Multiple alignment of a set S of sequences Output: Tree T leaf-labeled with S Assumptions 3 Characters are mutually

More information

Lecture 4. Models of DNA and protein change. Likelihood methods

Lecture 4. Models of DNA and protein change. Likelihood methods Lecture 4. Models of DNA and protein change. Likelihood methods Joe Felsenstein Department of Genome Sciences and Department of Biology Lecture 4. Models of DNA and protein change. Likelihood methods p.1/39

More information

Consensus Methods. * You are only responsible for the first two

Consensus Methods. * You are only responsible for the first two Consensus Trees * consensus trees reconcile clades from different trees * consensus is a conservative estimate of phylogeny that emphasizes points of agreement * philosophy: agreement among data sets is

More information

Molecular Evolution, course # Final Exam, May 3, 2006

Molecular Evolution, course # Final Exam, May 3, 2006 Molecular Evolution, course #27615 Final Exam, May 3, 2006 This exam includes a total of 12 problems on 7 pages (including this cover page). The maximum number of points obtainable is 150, and at least

More information

Additive distances. w(e), where P ij is the path in T from i to j. Then the matrix [D ij ] is said to be additive.

Additive distances. w(e), where P ij is the path in T from i to j. Then the matrix [D ij ] is said to be additive. Additive distances Let T be a tree on leaf set S and let w : E R + be an edge-weighting of T, and assume T has no nodes of degree two. Let D ij = e P ij w(e), where P ij is the path in T from i to j. Then

More information

How should we go about modeling this? Model parameters? Time Substitution rate Can we observe time or subst. rate? What can we observe?

How should we go about modeling this? Model parameters? Time Substitution rate Can we observe time or subst. rate? What can we observe? How should we go about modeling this? gorilla GAAGTCCTTGAGAAATAAACTGCACACACTGG orangutan GGACTCCTTGAGAAATAAACTGCACACACTGG Model parameters? Time Substitution rate Can we observe time or subst. rate? What

More information

Phylogenetic Assumptions

Phylogenetic Assumptions Substitution Models and the Phylogenetic Assumptions Vivek Jayaswal Lars S. Jermiin COMMONWEALTH OF AUSTRALIA Copyright htregulation WARNING This material has been reproduced and communicated to you by

More information

Consensus methods. Strict consensus methods

Consensus methods. Strict consensus methods Consensus methods A consensus tree is a summary of the agreement among a set of fundamental trees There are many consensus methods that differ in: 1. the kind of agreement 2. the level of agreement Consensus

More information

Constructing Evolutionary/Phylogenetic Trees

Constructing Evolutionary/Phylogenetic Trees Constructing Evolutionary/Phylogenetic Trees 2 broad categories: Distance-based methods Ultrametric Additive: UPGMA Transformed Distance Neighbor-Joining Character-based Maximum Parsimony Maximum Likelihood

More information

Phylogeny Estimation and Hypothesis Testing using Maximum Likelihood

Phylogeny Estimation and Hypothesis Testing using Maximum Likelihood Phylogeny Estimation and Hypothesis Testing using Maximum Likelihood For: Prof. Partensky Group: Jimin zhu Rama Sharma Sravanthi Polsani Xin Gong Shlomit klopman April. 7. 2003 Table of Contents Introduction...3

More information

POPULATION GENETICS Winter 2005 Lecture 17 Molecular phylogenetics

POPULATION GENETICS Winter 2005 Lecture 17 Molecular phylogenetics POPULATION GENETICS Winter 2005 Lecture 17 Molecular phylogenetics - in deriving a phylogeny our goal is simply to reconstruct the historical relationships between a group of taxa. - before we review the

More information

Constructing Evolutionary/Phylogenetic Trees

Constructing Evolutionary/Phylogenetic Trees Constructing Evolutionary/Phylogenetic Trees 2 broad categories: istance-based methods Ultrametric Additive: UPGMA Transformed istance Neighbor-Joining Character-based Maximum Parsimony Maximum Likelihood

More information

Integrative Biology 200 "PRINCIPLES OF PHYLOGENETICS" Spring 2016 University of California, Berkeley. Parsimony & Likelihood [draft]

Integrative Biology 200 PRINCIPLES OF PHYLOGENETICS Spring 2016 University of California, Berkeley. Parsimony & Likelihood [draft] Integrative Biology 200 "PRINCIPLES OF PHYLOGENETICS" Spring 2016 University of California, Berkeley K.W. Will Parsimony & Likelihood [draft] 1. Hennig and Parsimony: Hennig was not concerned with parsimony

More information

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic analysis Phylogenetic Basics: Biological

More information

C.DARWIN ( )

C.DARWIN ( ) C.DARWIN (1809-1882) LAMARCK Each evolutionary lineage has evolved, transforming itself, from a ancestor appeared by spontaneous generation DARWIN All organisms are historically interconnected. Their relationships

More information

Special features of phangorn (Version 2.3.1)

Special features of phangorn (Version 2.3.1) Special features of phangorn (Version 2.3.1) Klaus P. Schliep November 1, 2017 Introduction This document illustrates some of the phangorn [4] specialised features which are useful but maybe not as well-known

More information

Lecture Notes: Markov chains

Lecture Notes: Markov chains Computational Genomics and Molecular Biology, Fall 5 Lecture Notes: Markov chains Dannie Durand At the beginning of the semester, we introduced two simple scoring functions for pairwise alignments: a similarity

More information

Dr. Amira A. AL-Hosary

Dr. Amira A. AL-Hosary Phylogenetic analysis Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic Basics: Biological

More information

Phylogenetic Trees. What They Are Why We Do It & How To Do It. Presented by Amy Harris Dr Brad Morantz

Phylogenetic Trees. What They Are Why We Do It & How To Do It. Presented by Amy Harris Dr Brad Morantz Phylogenetic Trees What They Are Why We Do It & How To Do It Presented by Amy Harris Dr Brad Morantz Overview What is a phylogenetic tree Why do we do it How do we do it Methods and programs Parallels

More information

Natural selection on the molecular level

Natural selection on the molecular level Natural selection on the molecular level Fundamentals of molecular evolution How DNA and protein sequences evolve? Genetic variability in evolution } Mutations } forming novel alleles } Inversions } change

More information

Lie Markov models. Jeremy Sumner. School of Physical Sciences University of Tasmania, Australia

Lie Markov models. Jeremy Sumner. School of Physical Sciences University of Tasmania, Australia Lie Markov models Jeremy Sumner School of Physical Sciences University of Tasmania, Australia Stochastic Modelling Meets Phylogenetics, UTAS, November 2015 Jeremy Sumner Lie Markov models 1 / 23 The theory

More information

Evolutionary Genomics: Phylogenetics

Evolutionary Genomics: Phylogenetics Evolutionary Genomics: Phylogenetics Nicolas Salamin nicolas.salamin@unil.ch Department of Computational Biology, University of Lausanne Swiss Institute of Bioinformatics March 16th, 2017 Tree of Life

More information

Phylogenetic Inference and Hypothesis Testing. Catherine Lai (92720) BSc(Hons) Department of Mathematics and Statistics University of Melbourne

Phylogenetic Inference and Hypothesis Testing. Catherine Lai (92720) BSc(Hons) Department of Mathematics and Statistics University of Melbourne Phylogenetic Inference and Hypothesis Testing Catherine Lai (92720) BSc(Hons) Department of Mathematics and Statistics University of Melbourne November 13, 2003 Contents 1 Introduction 4 2 Molecular Phylogenetics

More information

Evolutionary Analysis of Viral Genomes

Evolutionary Analysis of Viral Genomes University of Oxford, Department of Zoology Evolutionary Biology Group Department of Zoology University of Oxford South Parks Road Oxford OX1 3PS, U.K. Fax: +44 1865 271249 Evolutionary Analysis of Viral

More information

Concepts and Methods in Molecular Divergence Time Estimation

Concepts and Methods in Molecular Divergence Time Estimation Concepts and Methods in Molecular Divergence Time Estimation 26 November 2012 Prashant P. Sharma American Museum of Natural History Overview 1. Why do we date trees? 2. The molecular clock 3. Local clocks

More information

Taming the Beast Workshop

Taming the Beast Workshop Workshop David Rasmussen & arsten Magnus June 27, 2016 1 / 31 Outline of sequence evolution: rate matrices Markov chain model Variable rates amongst different sites: +Γ Implementation in BES2 2 / 31 genotype

More information

Phylogenetic Inference using RevBayes

Phylogenetic Inference using RevBayes Phylogenetic Inference using RevBayes Model section using Bayes factors Sebastian Höhna 1 Overview This tutorial demonstrates some general principles of Bayesian model comparison, which is based on estimating

More information

Phylogenetics: Parsimony and Likelihood. COMP Spring 2016 Luay Nakhleh, Rice University

Phylogenetics: Parsimony and Likelihood. COMP Spring 2016 Luay Nakhleh, Rice University Phylogenetics: Parsimony and Likelihood COMP 571 - Spring 2016 Luay Nakhleh, Rice University The Problem Input: Multiple alignment of a set S of sequences Output: Tree T leaf-labeled with S Assumptions

More information

Phylogenetics. Applications of phylogenetics. Unrooted networks vs. rooted trees. Outline

Phylogenetics. Applications of phylogenetics. Unrooted networks vs. rooted trees. Outline Phylogenetics Todd Vision iology 522 March 26, 2007 pplications of phylogenetics Studying organismal or biogeographic history Systematics ating events in the fossil record onservation biology Studying

More information

Reconstruire le passé biologique modèles, méthodes, performances, limites

Reconstruire le passé biologique modèles, méthodes, performances, limites Reconstruire le passé biologique modèles, méthodes, performances, limites Olivier Gascuel Centre de Bioinformatique, Biostatistique et Biologie Intégrative C3BI USR 3756 Institut Pasteur & CNRS Reconstruire

More information

Introduction to MEGA

Introduction to MEGA Introduction to MEGA Download at: http://www.megasoftware.net/index.html Thomas Randall, PhD tarandal@email.unc.edu Manual at: www.megasoftware.net/mega4 Use of phylogenetic analysis software tools Bioinformatics

More information

Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks!

Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks! Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks! Paul has many great tools for teaching phylogenetics at his web site: http://hydrodictyon.eeb.uconn.edu/people/plewis

More information

Phylogenetics. BIOL 7711 Computational Bioscience

Phylogenetics. BIOL 7711 Computational Bioscience Consortium for Comparative Genomics! University of Colorado School of Medicine Phylogenetics BIOL 7711 Computational Bioscience Biochemistry and Molecular Genetics Computational Bioscience Program Consortium

More information

Chapter 7: Models of discrete character evolution

Chapter 7: Models of discrete character evolution Chapter 7: Models of discrete character evolution pdf version R markdown to recreate analyses Biological motivation: Limblessness as a discrete trait Squamates, the clade that includes all living species

More information

Bioinformatics 1. Sepp Hochreiter. Biology, Sequences, Phylogenetics Part 4. Bioinformatics 1: Biology, Sequences, Phylogenetics

Bioinformatics 1. Sepp Hochreiter. Biology, Sequences, Phylogenetics Part 4. Bioinformatics 1: Biology, Sequences, Phylogenetics Bioinformatics 1 Biology, Sequences, Phylogenetics Part 4 Sepp Hochreiter Klausur Mo. 30.01.2011 Zeit: 15:30 17:00 Raum: HS14 Anmeldung Kusss Contents Methods and Bootstrapping of Maximum Methods Methods

More information

EVOLUTIONARY DISTANCES

EVOLUTIONARY DISTANCES EVOLUTIONARY DISTANCES FROM STRINGS TO TREES Luca Bortolussi 1 1 Dipartimento di Matematica ed Informatica Università degli studi di Trieste luca@dmi.units.it Trieste, 14 th November 2007 OUTLINE 1 STRINGS:

More information

MOLECULAR SYSTEMATICS: A SYNTHESIS OF THE COMMON METHODS AND THE STATE OF KNOWLEDGE

MOLECULAR SYSTEMATICS: A SYNTHESIS OF THE COMMON METHODS AND THE STATE OF KNOWLEDGE CELLULAR & MOLECULAR BIOLOGY LETTERS http://www.cmbl.org.pl Received: 16 August 2009 Volume 15 (2010) pp 311-341 Final form accepted: 01 March 2010 DOI: 10.2478/s11658-010-0010-8 Published online: 19 March

More information

1. Can we use the CFN model for morphological traits?

1. Can we use the CFN model for morphological traits? 1. Can we use the CFN model for morphological traits? 2. Can we use something like the GTR model for morphological traits? 3. Stochastic Dollo. 4. Continuous characters. Mk models k-state variants of the

More information

Massachusetts Institute of Technology Computational Evolutionary Biology, Fall, 2005 Notes for November 7: Molecular evolution

Massachusetts Institute of Technology Computational Evolutionary Biology, Fall, 2005 Notes for November 7: Molecular evolution Massachusetts Institute of Technology 6.877 Computational Evolutionary Biology, Fall, 2005 Notes for November 7: Molecular evolution 1. Rates of amino acid replacement The initial motivation for the neutral

More information

Discrete & continuous characters: The threshold model

Discrete & continuous characters: The threshold model Discrete & continuous characters: The threshold model Discrete & continuous characters: the threshold model So far we have discussed continuous & discrete character models separately for estimating ancestral

More information

"PRINCIPLES OF PHYLOGENETICS: ECOLOGY AND EVOLUTION" Integrative Biology 200B Spring 2011 University of California, Berkeley

PRINCIPLES OF PHYLOGENETICS: ECOLOGY AND EVOLUTION Integrative Biology 200B Spring 2011 University of California, Berkeley "PRINCIPLES OF PHYLOGENETICS: ECOLOGY AND EVOLUTION" Integrative Biology 200B Spring 2011 University of California, Berkeley B.D. Mishler Feb. 1, 2011. Qualitative character evolution (cont.) - comparing

More information

Maximum Likelihood in Phylogenetics

Maximum Likelihood in Phylogenetics Maximum Likelihood in Phylogenetics June 1, 2009 Smithsonian Workshop on Molecular Evolution Paul O. Lewis Department of Ecology & Evolutionary Biology University of Connecticut, Storrs, CT Copyright 2009

More information

Integrative Biology 200 "PRINCIPLES OF PHYLOGENETICS" Spring 2018 University of California, Berkeley

Integrative Biology 200 PRINCIPLES OF PHYLOGENETICS Spring 2018 University of California, Berkeley Integrative Biology 200 "PRINCIPLES OF PHYLOGENETICS" Spring 2018 University of California, Berkeley B.D. Mishler Feb. 14, 2018. Phylogenetic trees VI: Dating in the 21st century: clocks, & calibrations;

More information

An Introduction to Bayesian Inference of Phylogeny

An Introduction to Bayesian Inference of Phylogeny n Introduction to Bayesian Inference of Phylogeny John P. Huelsenbeck, Bruce Rannala 2, and John P. Masly Department of Biology, University of Rochester, Rochester, NY 427, U.S.. 2 Department of Medical

More information

Who was Bayes? Bayesian Phylogenetics. What is Bayes Theorem?

Who was Bayes? Bayesian Phylogenetics. What is Bayes Theorem? Who was Bayes? Bayesian Phylogenetics Bret Larget Departments of Botany and of Statistics University of Wisconsin Madison October 6, 2011 The Reverand Thomas Bayes was born in London in 1702. He was the

More information

Bayesian Phylogenetics

Bayesian Phylogenetics Bayesian Phylogenetics Bret Larget Departments of Botany and of Statistics University of Wisconsin Madison October 6, 2011 Bayesian Phylogenetics 1 / 27 Who was Bayes? The Reverand Thomas Bayes was born

More information

The Idiot s Guide to the Zen of Likelihood in a Nutshell in Seven Days for Dummies, Unleashed

The Idiot s Guide to the Zen of Likelihood in a Nutshell in Seven Days for Dummies, Unleashed The Idiot s Guide to the Zen of Likelihood in a Nutshell in Seven Days for Dummies, Unleashed A gentle introduction, for those of us who are small of brain, to the calculation of the likelihood of molecular

More information

T R K V CCU CG A AAA GUC T R K V CCU CGG AAA GUC. T Q K V CCU C AG AAA GUC (Amino-acid

T R K V CCU CG A AAA GUC T R K V CCU CGG AAA GUC. T Q K V CCU C AG AAA GUC (Amino-acid Lecture 11 Increasing Model Complexity I. Introduction. At this point, we ve increased the complexity of models of substitution considerably, but we re still left with the assumption that rates are uniform

More information

Tree of Life iological Sequence nalysis Chapter http://tolweb.org/tree/ Phylogenetic Prediction ll organisms on Earth have a common ancestor. ll species are related. The relationship is called a phylogeny

More information

Phylogenetic Tree Reconstruction

Phylogenetic Tree Reconstruction I519 Introduction to Bioinformatics, 2011 Phylogenetic Tree Reconstruction Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Evolution theory Speciation Evolution of new organisms is driven

More information

Phylogenetic Inference using RevBayes

Phylogenetic Inference using RevBayes Phylogenetic Inference using RevBayes Substitution Models Sebastian Höhna 1 Overview This tutorial demonstrates how to set up and perform analyses using common nucleotide substitution models. The substitution

More information

Mutation models I: basic nucleotide sequence mutation models

Mutation models I: basic nucleotide sequence mutation models Mutation models I: basic nucleotide sequence mutation models Peter Beerli September 3, 009 Mutations are irreversible changes in the DNA. This changes may be introduced by chance, by chemical agents, or

More information

Inferring Complex DNA Substitution Processes on Phylogenies Using Uniformization and Data Augmentation

Inferring Complex DNA Substitution Processes on Phylogenies Using Uniformization and Data Augmentation Syst Biol 55(2):259 269, 2006 Copyright c Society of Systematic Biologists ISSN: 1063-5157 print / 1076-836X online DOI: 101080/10635150500541599 Inferring Complex DNA Substitution Processes on Phylogenies

More information

Letter to the Editor. Department of Biology, Arizona State University

Letter to the Editor. Department of Biology, Arizona State University Letter to the Editor Traditional Phylogenetic Reconstruction Methods Reconstruct Shallow and Deep Evolutionary Relationships Equally Well Michael S. Rosenberg and Sudhir Kumar Department of Biology, Arizona

More information

Lecture 4: Evolutionary Models and Substitution Matrices (PAM and BLOSUM)

Lecture 4: Evolutionary Models and Substitution Matrices (PAM and BLOSUM) Bioinformatics II Probability and Statistics Universität Zürich and ETH Zürich Spring Semester 2009 Lecture 4: Evolutionary Models and Substitution Matrices (PAM and BLOSUM) Dr Fraser Daly adapted from

More information

Molecular Evolution and Comparative Genomics

Molecular Evolution and Comparative Genomics Molecular Evolution and Comparative Genomics --- the phylogenetic HMM model 10-810, CMB lecture 5---Eric Xing Some important dates in history (billions of years ago) Origin of the universe 15 ±4 Formation

More information

What Is Conservation?

What Is Conservation? What Is Conservation? Lee A. Newberg February 22, 2005 A Central Dogma Junk DNA mutates at a background rate, but functional DNA exhibits conservation. Today s Question What is this conservation? Lee A.

More information

The Phylo- HMM approach to problems in comparative genomics, with examples.

The Phylo- HMM approach to problems in comparative genomics, with examples. The Phylo- HMM approach to problems in comparative genomics, with examples. Keith Bettinger Introduction The theory of evolution explains the diversity of organisms on Earth by positing that earlier species

More information

Molecular Evolution and Phylogenetic Tree Reconstruction

Molecular Evolution and Phylogenetic Tree Reconstruction 1 4 Molecular Evolution and Phylogenetic Tree Reconstruction 3 2 5 1 4 2 3 5 Orthology, Paralogy, Inparalogs, Outparalogs Phylogenetic Trees Nodes: species Edges: time of independent evolution Edge length

More information

Maximum Likelihood in Phylogenetics

Maximum Likelihood in Phylogenetics Maximum Likelihood in Phylogenetics 26 January 2011 Workshop on Molecular Evolution Český Krumlov, Česká republika Paul O. Lewis Department of Ecology & Evolutionary Biology University of Connecticut,

More information

"PRINCIPLES OF PHYLOGENETICS: ECOLOGY AND EVOLUTION" Integrative Biology 200 Spring 2018 University of California, Berkeley

PRINCIPLES OF PHYLOGENETICS: ECOLOGY AND EVOLUTION Integrative Biology 200 Spring 2018 University of California, Berkeley "PRINCIPLES OF PHYLOGENETICS: ECOLOGY AND EVOLUTION" Integrative Biology 200 Spring 2018 University of California, Berkeley D.D. Ackerly Feb. 26, 2018 Maximum Likelihood Principles, and Applications to

More information

Inferring phylogeny. Today s topics. Milestones of molecular evolution studies Contributions to molecular evolution

Inferring phylogeny. Today s topics. Milestones of molecular evolution studies Contributions to molecular evolution Today s topics Inferring phylogeny Introduction! Distance methods! Parsimony method!"#$%&'(!)* +,-.'/01!23454(6!7!2845*0&4'9#6!:&454(6 ;?@AB=C?DEF Overview of phylogenetic inferences Methodology Methods

More information

Using models of nucleotide evolution to build phylogenetic trees

Using models of nucleotide evolution to build phylogenetic trees Developmental and Comparative Immunology 29 (2005) 211 227 www.elsevier.com/locate/devcompimm Using models of nucleotide evolution to build phylogenetic trees David H. Bos a, *, David Posada b a School

More information

Phylogenetics and Darwin. An Introduction to Phylogenetics. Tree of Life. Darwin s Trees

Phylogenetics and Darwin. An Introduction to Phylogenetics. Tree of Life. Darwin s Trees Phylogenetics and Darwin An Introduction to Phylogenetics Bret Larget larget@stat.wisc.edu Departments of Botany and of Statistics University of Wisconsin Madison February 4, 2008 A phylogeny is a tree

More information

Lecture 4: Evolutionary models and substitution matrices (PAM and BLOSUM).

Lecture 4: Evolutionary models and substitution matrices (PAM and BLOSUM). 1 Bioinformatics: In-depth PROBABILITY & STATISTICS Spring Semester 2011 University of Zürich and ETH Zürich Lecture 4: Evolutionary models and substitution matrices (PAM and BLOSUM). Dr. Stefanie Muff

More information

"Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky

Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky MOLECULAR PHYLOGENY "Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky EVOLUTION - theory that groups of organisms change over time so that descendeants differ structurally

More information

Efficiencies of maximum likelihood methods of phylogenetic inferences when different substitution models are used

Efficiencies of maximum likelihood methods of phylogenetic inferences when different substitution models are used Molecular Phylogenetics and Evolution 31 (2004) 865 873 MOLECULAR PHYLOGENETICS AND EVOLUTION www.elsevier.com/locate/ympev Efficiencies of maximum likelihood methods of phylogenetic inferences when different

More information

Lecture 6 Phylogenetic Inference

Lecture 6 Phylogenetic Inference Lecture 6 Phylogenetic Inference From Darwin s notebook in 1837 Charles Darwin Willi Hennig From The Origin in 1859 Cladistics Phylogenetic inference Willi Hennig, Cladistics 1. Clade, Monophyletic group,

More information

7. Tests for selection

7. Tests for selection Sequence analysis and genomics 7. Tests for selection Dr. Katja Nowick Group leader TFome and Transcriptome Evolution Bioinformatics group Paul-Flechsig-Institute for Brain Research www. nowicklab.info

More information

KaKs Calculator: Calculating Ka and Ks Through Model Selection and Model Averaging

KaKs Calculator: Calculating Ka and Ks Through Model Selection and Model Averaging Method KaKs Calculator: Calculating Ka and Ks Through Model Selection and Model Averaging Zhang Zhang 1,2,3#, Jun Li 2#, Xiao-Qian Zhao 2,3, Jun Wang 1,2,4, Gane Ka-Shu Wong 2,4,5, and Jun Yu 1,2,4 * 1

More information

HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM

HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM I529: Machine Learning in Bioinformatics (Spring 2017) HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM Yuzhen Ye School of Informatics and Computing Indiana University, Bloomington

More information

Bayesian Models for Phylogenetic Trees

Bayesian Models for Phylogenetic Trees Bayesian Models for Phylogenetic Trees Clarence Leung* 1 1 McGill Centre for Bioinformatics, McGill University, Montreal, Quebec, Canada ABSTRACT Introduction: Inferring genetic ancestry of different species

More information

A Bayesian Approach to Phylogenetics

A Bayesian Approach to Phylogenetics A Bayesian Approach to Phylogenetics Niklas Wahlberg Based largely on slides by Paul Lewis (www.eeb.uconn.edu) An Introduction to Bayesian Phylogenetics Bayesian inference in general Markov chain Monte

More information

Homoplasy. Selection of models of molecular evolution. Evolutionary correction. Saturation

Homoplasy. Selection of models of molecular evolution. Evolutionary correction. Saturation Homoplasy Selection of models of molecular evolution David Posada Homoplasy indicates identity not produced by descent from a common ancestor. Graduate class in Phylogenetics, Campus Agrário de Vairão,

More information

Assessing an Unknown Evolutionary Process: Effect of Increasing Site- Specific Knowledge Through Taxon Addition

Assessing an Unknown Evolutionary Process: Effect of Increasing Site- Specific Knowledge Through Taxon Addition Assessing an Unknown Evolutionary Process: Effect of Increasing Site- Specific Knowledge Through Taxon Addition David D. Pollock* and William J. Bruno* *Theoretical Biology and Biophysics, Los Alamos National

More information

Bayesian Analysis of Elapsed Times in Continuous-Time Markov Chains

Bayesian Analysis of Elapsed Times in Continuous-Time Markov Chains Bayesian Analysis of Elapsed Times in Continuous-Time Markov Chains Marco A. R. Ferreira 1, Marc A. Suchard 2,3,4 1 Department of Statistics, University of Missouri at Columbia, USA 2 Department of Biomathematics

More information

Are Guinea Pigs Rodents? The Importance of Adequate Models in Molecular Phylogenetics

Are Guinea Pigs Rodents? The Importance of Adequate Models in Molecular Phylogenetics Journal of Mammalian Evolution, Vol. 4, No. 2, 1997 Are Guinea Pigs Rodents? The Importance of Adequate Models in Molecular Phylogenetics Jack Sullivan1'2 and David L. Swofford1 The monophyly of Rodentia

More information

Inferring Speciation Times under an Episodic Molecular Clock

Inferring Speciation Times under an Episodic Molecular Clock Syst. Biol. 56(3):453 466, 2007 Copyright c Society of Systematic Biologists ISSN: 1063-5157 print / 1076-836X online DOI: 10.1080/10635150701420643 Inferring Speciation Times under an Episodic Molecular

More information

The Phylogenetic Handbook

The Phylogenetic Handbook The Phylogenetic Handbook A Practical Approach to DNA and Protein Phylogeny Edited by Marco Salemi University of California, Irvine and Katholieke Universiteit Leuven, Belgium and Anne-Mieke Vandamme Rega

More information

Biology 559R: Introduction to Phylogenetic Comparative Methods Topics for this week (Jan 27 & 29):

Biology 559R: Introduction to Phylogenetic Comparative Methods Topics for this week (Jan 27 & 29): Biology 559R: Introduction to Phylogenetic Comparative Methods Topics for this week (Jan 27 & 29): Statistical estimation of models of sequence evolution Phylogenetic inference using maximum likelihood:

More information

Mixture Models in Phylogenetic Inference. Mark Pagel and Andrew Meade Reading University.

Mixture Models in Phylogenetic Inference. Mark Pagel and Andrew Meade Reading University. Mixture Models in Phylogenetic Inference Mark Pagel and Andrew Meade Reading University m.pagel@rdg.ac.uk Mixture models in phylogenetic inference!some background statistics relevant to phylogenetic inference!mixture

More information

Week 8: Testing trees, Bootstraps, jackknifes, gene frequencies

Week 8: Testing trees, Bootstraps, jackknifes, gene frequencies Week 8: Testing trees, ootstraps, jackknifes, gene frequencies Genome 570 ebruary, 2016 Week 8: Testing trees, ootstraps, jackknifes, gene frequencies p.1/69 density e log (density) Normal distribution:

More information

Molecular Evolution & Phylogenetics Traits, phylogenies, evolutionary models and divergence time between sequences

Molecular Evolution & Phylogenetics Traits, phylogenies, evolutionary models and divergence time between sequences Molecular Evolution & Phylogenetics Traits, phylogenies, evolutionary models and divergence time between sequences Basic Bioinformatics Workshop, ILRI Addis Ababa, 12 December 2017 1 Learning Objectives

More information