BMI/CS 776 Lecture 4. Colin Dewey

Size: px
Start display at page:

Download "BMI/CS 776 Lecture 4. Colin Dewey"

Transcription

1 BMI/CS 776 Lecture 4 Colin Dewey

2 Outline Common nucleotide substitution models Directed graphical models Ancestral sequence inference

3 Poisson process continuous Markov process X t0 X t1 X t2 X tn Y t0 Y t1 Y t2 Y tn P[X ti+1 = x i+1 X ti = x i ] = e λ(t i+1 t i ) (λ(t i+1 t i )) x i+1 x i (x i+1 x i )! P[Y ti+1 = b Y ti = a, X ti+1 = x i+1, X ti = x i ] = (R x i+1 x i ) ab

4 Jukes-Cantor Model Π = Jukes-Cantor model R = P(t) = e λt 1 e λt 1 e λt 1 e λt 1 e λt 1 + 3e λt 1 e λt 1 e λt 1 e λt 1 e λt 1 + 3e λt 1 e λt 1 e λt 1 e λt 1 e λt 1 + 3e λt Jukes-Cantor model satisfies two important properties which a

5 Properties of Jukes- Cantor ergodic lim t P(t) = ΠJ time reversible ΠQ = Q T Π

6 Transitions vs. Transversions Transition purine purine pyrimidine pyrimidine Transversion pyrimidine purine purine pyrimidine Purines A G Pyrimidines C T

7 HKY85 R = 1 π G α π Y β π C β π G α π T β Q = π A β 1 π G α π R β π G β π T α π A α π C β 1 π A α π Y β π T β π A β π C α π G β 1 π C α π R β π G α π Y β π C β π G α π T β π A β π G α π R β π G β π T α π A α π C β π A α π Y β π T β π A β π C α π G β π C α π R β., Here α, β 0 and 0 α + 2β < 1 and π A + π C + π G + π T π R = π A + π G and π Y = π C + π T. = 1 with

8 Branch lengths What do the lengths of tree edges mean? Expected number of mutations per site time (t) and rate (λ) are not identifiable, only their product is: λt P(mutation event) = 1 x Σ π x R xx = 1 trace(πr) = trace(πq). Expected number of mutations = λt ( trace(πq)) Typically scale λ so that λt ( trace(πq)) = 1

9 Estimating branch length Given empirical P(t), can estimate branch length with the logdet transform logdet(p(t)) = log(det(p(t))) logdet(p(t)) = λt ( trace(q)).

10 Directed Graphical Models Same thing as Bayesian networks Directed graph G = (V, E) Vertices correspond to random variables Missing edges represent independence statements

11 X4 X2 Example DGM X6 X1 X4 X2 X1 X6 X5 X3 X3 X5

12 Tree model P[x 1, x 2,..., x 9 ] = π x9 P xi x j (t ij ) X9 L(data model) = (x i,x j ) E x 6,x 7,x 8,x 9 P(x 1, x 2,..., x 9 ) t97 t98 X8 data = (x 1, x 2, x 3, x 4, x 5 ) model = (T, P(t), Π) X7 t71 t72 t83 t64 t86 X6 t65 X1 X2 X3 X4 X5

13 Likelihood computation L k (a): Likelihood of subtree rooted by k with x k = a for each vertex k in a topological ordering: if k is a leaf: { 1 if xk = a set L k (a) = 0 otherwise else: let i and j be the child vertices of k set L k (a) = b,c P ab (t ki )L i (b)p ac (t kj )L j (c) return L(data model) = a π a L r (a), where r is the root vertex (Felsenstein s algorithm, sum-product algorithm)

14 Marginal reconstruction most likely character at root given the leaf characters compute L r (a) using the likelihood algorithm return argmax a π a L r (a)

15 Joint reconstruction character at root for most likely assignment to all interior vertices given the leaf characters V k (a): Likelihood of most likely interior vertex assignments for subtree rooted by k, with x k = a for each vertex k in a topological ordering: if k is a leaf: { 1 if xk = a set V k (a) = 0 otherwise else: let i and j be the child vertices of k set V k (a) = max b,c return argmax a P ab(t ki )V i (b)p ac (t kj )V j (c) π a V r (a), where r is the root vertex

Phylogenetics: Distance Methods. COMP Spring 2015 Luay Nakhleh, Rice University

Phylogenetics: Distance Methods. COMP Spring 2015 Luay Nakhleh, Rice University Phylogenetics: Distance Methods COMP 571 - Spring 2015 Luay Nakhleh, Rice University Outline Evolutionary models and distance corrections Distance-based methods Evolutionary Models and Distance Correction

More information

Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks!

Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks! Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks! Paul has many great tools for teaching phylogenetics at his web site: http://hydrodictyon.eeb.uconn.edu/people/plewis

More information

Markov Chains. Sarah Filippi Department of Statistics TA: Luke Kelly

Markov Chains. Sarah Filippi Department of Statistics  TA: Luke Kelly Markov Chains Sarah Filippi Department of Statistics http://www.stats.ox.ac.uk/~filippi TA: Luke Kelly With grateful acknowledgements to Prof. Yee Whye Teh's slides from 2013 14. Schedule 09:30-10:30 Lecture:

More information

Substitution = Mutation followed. by Fixation. Common Ancestor ACGATC 1:A G 2:C A GAGATC 3:G A 6:C T 5:T C 4:A C GAAATT 1:G A

Substitution = Mutation followed. by Fixation. Common Ancestor ACGATC 1:A G 2:C A GAGATC 3:G A 6:C T 5:T C 4:A C GAAATT 1:G A GAGATC 3:G A 6:C T Common Ancestor ACGATC 1:A G 2:C A Substitution = Mutation followed 5:T C by Fixation GAAATT 4:A C 1:G A AAAATT GAAATT GAGCTC ACGACC Chimp Human Gorilla Gibbon AAAATT GAAATT GAGCTC ACGACC

More information

Machine Learning for Data Science (CS4786) Lecture 24

Machine Learning for Data Science (CS4786) Lecture 24 Machine Learning for Data Science (CS4786) Lecture 24 Graphical Models: Approximate Inference Course Webpage : http://www.cs.cornell.edu/courses/cs4786/2016sp/ BELIEF PROPAGATION OR MESSAGE PASSING Each

More information

Maximum Likelihood Tree Estimation. Carrie Tribble IB Feb 2018

Maximum Likelihood Tree Estimation. Carrie Tribble IB Feb 2018 Maximum Likelihood Tree Estimation Carrie Tribble IB 200 9 Feb 2018 Outline 1. Tree building process under maximum likelihood 2. Key differences between maximum likelihood and parsimony 3. Some fancy extras

More information

Evolutionary Tree Analysis. Overview

Evolutionary Tree Analysis. Overview CSI/BINF 5330 Evolutionary Tree Analysis Young-Rae Cho Associate Professor Department of Computer Science Baylor University Overview Backgrounds Distance-Based Evolutionary Tree Reconstruction Character-Based

More information

Additive distances. w(e), where P ij is the path in T from i to j. Then the matrix [D ij ] is said to be additive.

Additive distances. w(e), where P ij is the path in T from i to j. Then the matrix [D ij ] is said to be additive. Additive distances Let T be a tree on leaf set S and let w : E R + be an edge-weighting of T, and assume T has no nodes of degree two. Let D ij = e P ij w(e), where P ij is the path in T from i to j. Then

More information

Reading for Lecture 13 Release v10

Reading for Lecture 13 Release v10 Reading for Lecture 13 Release v10 Christopher Lee November 15, 2011 Contents 1 Evolutionary Trees i 1.1 Evolution as a Markov Process...................................... ii 1.2 Rooted vs. Unrooted Trees........................................

More information

Evolutionary Models. Evolutionary Models

Evolutionary Models. Evolutionary Models Edit Operators In standard pairwise alignment, what are the allowed edit operators that transform one sequence into the other? Describe how each of these edit operations are represented on a sequence alignment

More information

Phylogenetics: Likelihood

Phylogenetics: Likelihood 1 Phylogenetics: Likelihood COMP 571 Luay Nakhleh, Rice University The Problem 2 Input: Multiple alignment of a set S of sequences Output: Tree T leaf-labeled with S Assumptions 3 Characters are mutually

More information

π b = a π a P a,b = Q a,b δ + o(δ) = 1 + Q a,a δ + o(δ) = I 4 + Qδ + o(δ),

π b = a π a P a,b = Q a,b δ + o(δ) = 1 + Q a,a δ + o(δ) = I 4 + Qδ + o(δ), ABC estimation of the scaled effective population size. Geoff Nicholls, DTC 07/05/08 Refer to http://www.stats.ox.ac.uk/~nicholls/dtc/tt08/ for material. We will begin with a practical on ABC estimation

More information

Sequence Analysis 17: lecture 5. Substitution matrices Multiple sequence alignment

Sequence Analysis 17: lecture 5. Substitution matrices Multiple sequence alignment Sequence Analysis 17: lecture 5 Substitution matrices Multiple sequence alignment Substitution matrices Used to score aligned positions, usually of amino acids. Expressed as the log-likelihood ratio of

More information

Lecture 4. Models of DNA and protein change. Likelihood methods

Lecture 4. Models of DNA and protein change. Likelihood methods Lecture 4. Models of DNA and protein change. Likelihood methods Joe Felsenstein Department of Genome Sciences and Department of Biology Lecture 4. Models of DNA and protein change. Likelihood methods p.1/36

More information

Massachusetts Institute of Technology Computational Evolutionary Biology, Fall, 2005 Notes for November 7: Molecular evolution

Massachusetts Institute of Technology Computational Evolutionary Biology, Fall, 2005 Notes for November 7: Molecular evolution Massachusetts Institute of Technology 6.877 Computational Evolutionary Biology, Fall, 2005 Notes for November 7: Molecular evolution 1. Rates of amino acid replacement The initial motivation for the neutral

More information

Reconstruire le passé biologique modèles, méthodes, performances, limites

Reconstruire le passé biologique modèles, méthodes, performances, limites Reconstruire le passé biologique modèles, méthodes, performances, limites Olivier Gascuel Centre de Bioinformatique, Biostatistique et Biologie Intégrative C3BI USR 3756 Institut Pasteur & CNRS Reconstruire

More information

How should we go about modeling this? Model parameters? Time Substitution rate Can we observe time or subst. rate? What can we observe?

How should we go about modeling this? Model parameters? Time Substitution rate Can we observe time or subst. rate? What can we observe? How should we go about modeling this? gorilla GAAGTCCTTGAGAAATAAACTGCACACACTGG orangutan GGACTCCTTGAGAAATAAACTGCACACACTGG Model parameters? Time Substitution rate Can we observe time or subst. rate? What

More information

Mutation models I: basic nucleotide sequence mutation models

Mutation models I: basic nucleotide sequence mutation models Mutation models I: basic nucleotide sequence mutation models Peter Beerli September 3, 009 Mutations are irreversible changes in the DNA. This changes may be introduced by chance, by chemical agents, or

More information

Lecture 27. Phylogeny methods, part 4 (Models of DNA and protein change) p.1/26

Lecture 27. Phylogeny methods, part 4 (Models of DNA and protein change) p.1/26 Lecture 27. Phylogeny methods, part 4 (Models of DNA and protein change) Joe Felsenstein Department of Genome Sciences and Department of Biology Lecture 27. Phylogeny methods, part 4 (Models of DNA and

More information

EVOLUTIONARY DISTANCES

EVOLUTIONARY DISTANCES EVOLUTIONARY DISTANCES FROM STRINGS TO TREES Luca Bortolussi 1 1 Dipartimento di Matematica ed Informatica Università degli studi di Trieste luca@dmi.units.it Trieste, 14 th November 2007 OUTLINE 1 STRINGS:

More information

Lecture 24. Phylogeny methods, part 4 (Models of DNA and protein change) p.1/22

Lecture 24. Phylogeny methods, part 4 (Models of DNA and protein change) p.1/22 Lecture 24. Phylogeny methods, part 4 (Models of DNA and protein change) Joe Felsenstein Department of Genome Sciences and Department of Biology Lecture 24. Phylogeny methods, part 4 (Models of DNA and

More information

Phylogenetic Tree Reconstruction

Phylogenetic Tree Reconstruction I519 Introduction to Bioinformatics, 2011 Phylogenetic Tree Reconstruction Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Evolution theory Speciation Evolution of new organisms is driven

More information

进化树构建方法的概率方法 第 4 章 : 进化树构建的概率方法 问题介绍. 部分 lid 修改自 i i f l 的 ih l i

进化树构建方法的概率方法 第 4 章 : 进化树构建的概率方法 问题介绍. 部分 lid 修改自 i i f l 的 ih l i 第 4 章 : 进化树构建的概率方法 问题介绍 进化树构建方法的概率方法 部分 lid 修改自 i i f l 的 ih l i 部分 Slides 修改自 University of Basel 的 Michael Springmann 课程 CS302 Seminar Life Science Informatics 的讲义 Phylogenetic Tree branch internal node

More information

Lecture Notes: Markov chains

Lecture Notes: Markov chains Computational Genomics and Molecular Biology, Fall 5 Lecture Notes: Markov chains Dannie Durand At the beginning of the semester, we introduced two simple scoring functions for pairwise alignments: a similarity

More information

Lecture 4 October 18th

Lecture 4 October 18th Directed and undirected graphical models Fall 2017 Lecture 4 October 18th Lecturer: Guillaume Obozinski Scribe: In this lecture, we will assume that all random variables are discrete, to keep notations

More information

UNDERSTANDING BELIEF PROPOGATION AND ITS GENERALIZATIONS

UNDERSTANDING BELIEF PROPOGATION AND ITS GENERALIZATIONS UNDERSTANDING BELIEF PROPOGATION AND ITS GENERALIZATIONS JONATHAN YEDIDIA, WILLIAM FREEMAN, YAIR WEISS 2001 MERL TECH REPORT Kristin Branson and Ian Fasel June 11, 2003 1. Inference Inference problems

More information

Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks!

Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks! Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks! Paul has many great tools for teaching phylogenetics at his web site: http://hydrodictyon.eeb.uconn.edu/people/plewis

More information

Bayesian Networks: Belief Propagation in Singly Connected Networks

Bayesian Networks: Belief Propagation in Singly Connected Networks Bayesian Networks: Belief Propagation in Singly Connected Networks Huizhen u janey.yu@cs.helsinki.fi Dept. Computer Science, Univ. of Helsinki Probabilistic Models, Spring, 2010 Huizhen u (U.H.) Bayesian

More information

Phylogenetics: Parsimony and Likelihood. COMP Spring 2016 Luay Nakhleh, Rice University

Phylogenetics: Parsimony and Likelihood. COMP Spring 2016 Luay Nakhleh, Rice University Phylogenetics: Parsimony and Likelihood COMP 571 - Spring 2016 Luay Nakhleh, Rice University The Problem Input: Multiple alignment of a set S of sequences Output: Tree T leaf-labeled with S Assumptions

More information

4 : Exact Inference: Variable Elimination

4 : Exact Inference: Variable Elimination 10-708: Probabilistic Graphical Models 10-708, Spring 2014 4 : Exact Inference: Variable Elimination Lecturer: Eric P. ing Scribes: Soumya Batra, Pradeep Dasigi, Manzil Zaheer 1 Probabilistic Inference

More information

Quantitative Model Checking (QMC) - SS12

Quantitative Model Checking (QMC) - SS12 Quantitative Model Checking (QMC) - SS12 Lecture 06 David Spieler Saarland University, Germany June 4, 2012 1 / 34 Deciding Bisimulations 2 / 34 Partition Refinement Algorithm Notation: A partition P over

More information

2 : Directed GMs: Bayesian Networks

2 : Directed GMs: Bayesian Networks 10-708: Probabilistic Graphical Models 10-708, Spring 2017 2 : Directed GMs: Bayesian Networks Lecturer: Eric P. Xing Scribes: Jayanth Koushik, Hiroaki Hayashi, Christian Perez Topic: Directed GMs 1 Types

More information

Lecture 4: Hidden Markov Models: An Introduction to Dynamic Decision Making. November 11, 2010

Lecture 4: Hidden Markov Models: An Introduction to Dynamic Decision Making. November 11, 2010 Hidden Lecture 4: Hidden : An Introduction to Dynamic Decision Making November 11, 2010 Special Meeting 1/26 Markov Model Hidden When a dynamical system is probabilistic it may be determined by the transition

More information

Inferring Molecular Phylogeny

Inferring Molecular Phylogeny Dr. Walter Salzburger he tree of life, ustav Klimt (1907) Inferring Molecular Phylogeny Inferring Molecular Phylogeny 55 Maximum Parsimony (MP): objections long branches I!! B D long branch attraction

More information

Basic math for biology

Basic math for biology Basic math for biology Lei Li Florida State University, Feb 6, 2002 The EM algorithm: setup Parametric models: {P θ }. Data: full data (Y, X); partial data Y. Missing data: X. Likelihood and maximum likelihood

More information

Bayesian Graphical Models

Bayesian Graphical Models Graphical Models and Inference, Lecture 16, Michaelmas Term 2009 December 4, 2009 Parameter θ, data X = x, likelihood L(θ x) p(x θ). Express knowledge about θ through prior distribution π on θ. Inference

More information

EE562 ARTIFICIAL INTELLIGENCE FOR ENGINEERS

EE562 ARTIFICIAL INTELLIGENCE FOR ENGINEERS EE562 ARTIFICIAL INTELLIGENCE FOR ENGINEERS Lecture 16, 6/1/2005 University of Washington, Department of Electrical Engineering Spring 2005 Instructor: Professor Jeff A. Bilmes Uncertainty & Bayesian Networks

More information

CISC 889 Bioinformatics (Spring 2004) Hidden Markov Models (II)

CISC 889 Bioinformatics (Spring 2004) Hidden Markov Models (II) CISC 889 Bioinformatics (Spring 24) Hidden Markov Models (II) a. Likelihood: forward algorithm b. Decoding: Viterbi algorithm c. Model building: Baum-Welch algorithm Viterbi training Hidden Markov models

More information

3/1/17. Content. TWINSCAN model. Example. TWINSCAN algorithm. HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM

3/1/17. Content. TWINSCAN model. Example. TWINSCAN algorithm. HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM I529: Machine Learning in Bioinformatics (Spring 2017) Content HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM Yuzhen Ye School of Informatics and Computing Indiana University,

More information

4.1 Notation and probability review

4.1 Notation and probability review Directed and undirected graphical models Fall 2015 Lecture 4 October 21st Lecturer: Simon Lacoste-Julien Scribe: Jaime Roquero, JieYing Wu 4.1 Notation and probability review 4.1.1 Notations Let us recall

More information

Lecture 4: Evolutionary models and substitution matrices (PAM and BLOSUM).

Lecture 4: Evolutionary models and substitution matrices (PAM and BLOSUM). 1 Bioinformatics: In-depth PROBABILITY & STATISTICS Spring Semester 2011 University of Zürich and ETH Zürich Lecture 4: Evolutionary models and substitution matrices (PAM and BLOSUM). Dr. Stefanie Muff

More information

Molecular Evolution, course # Final Exam, May 3, 2006

Molecular Evolution, course # Final Exam, May 3, 2006 Molecular Evolution, course #27615 Final Exam, May 3, 2006 This exam includes a total of 12 problems on 7 pages (including this cover page). The maximum number of points obtainable is 150, and at least

More information

9 Forward-backward algorithm, sum-product on factor graphs

9 Forward-backward algorithm, sum-product on factor graphs Massachusetts Institute of Technology Department of Electrical Engineering and Computer Science 6.438 Algorithms For Inference Fall 2014 9 Forward-backward algorithm, sum-product on factor graphs The previous

More information

Using algebraic geometry for phylogenetic reconstruction

Using algebraic geometry for phylogenetic reconstruction Using algebraic geometry for phylogenetic reconstruction Marta Casanellas i Rius (joint work with Jesús Fernández-Sánchez) Departament de Matemàtica Aplicada I Universitat Politècnica de Catalunya IMA

More information

Mean-field dual of cooperative reproduction

Mean-field dual of cooperative reproduction The mean-field dual of systems with cooperative reproduction joint with Tibor Mach (Prague) A. Sturm (Göttingen) Friday, July 6th, 2018 Poisson construction of Markov processes Let (X t ) t 0 be a continuous-time

More information

Week 5: Distance methods, DNA and protein models

Week 5: Distance methods, DNA and protein models Week 5: Distance methods, DNA and protein models Genome 570 February, 2016 Week 5: Distance methods, DNA and protein models p.1/69 A tree and the expected distances it predicts E A 0.08 0.05 0.06 0.03

More information

Lecture 9: PGM Learning

Lecture 9: PGM Learning 13 Oct 2014 Intro. to Stats. Machine Learning COMP SCI 4401/7401 Table of Contents I Learning parameters in MRFs 1 Learning parameters in MRFs Inference and Learning Given parameters (of potentials) and

More information

HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM

HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM I529: Machine Learning in Bioinformatics (Spring 2017) HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM Yuzhen Ye School of Informatics and Computing Indiana University, Bloomington

More information

9/30/11. Evolution theory. Phylogenetic Tree Reconstruction. Phylogenetic trees (binary trees) Phylogeny (phylogenetic tree)

9/30/11. Evolution theory. Phylogenetic Tree Reconstruction. Phylogenetic trees (binary trees) Phylogeny (phylogenetic tree) I9 Introduction to Bioinformatics, 0 Phylogenetic ree Reconstruction Yuzhen Ye (yye@indiana.edu) School of Informatics & omputing, IUB Evolution theory Speciation Evolution of new organisms is driven by

More information

Tree of Life iological Sequence nalysis Chapter http://tolweb.org/tree/ Phylogenetic Prediction ll organisms on Earth have a common ancestor. ll species are related. The relationship is called a phylogeny

More information

Generative and Discriminative Approaches to Graphical Models CMSC Topics in AI

Generative and Discriminative Approaches to Graphical Models CMSC Topics in AI Generative and Discriminative Approaches to Graphical Models CMSC 35900 Topics in AI Lecture 2 Yasemin Altun January 26, 2007 Review of Inference on Graphical Models Elimination algorithm finds single

More information

Inference in Graphical Models Variable Elimination and Message Passing Algorithm

Inference in Graphical Models Variable Elimination and Message Passing Algorithm Inference in Graphical Models Variable Elimination and Message Passing lgorithm Le Song Machine Learning II: dvanced Topics SE 8803ML, Spring 2012 onditional Independence ssumptions Local Markov ssumption

More information

CSCI1950 Z Computa4onal Methods for Biology Lecture 4. Ben Raphael February 2, hhp://cs.brown.edu/courses/csci1950 z/ Algorithm Summary

CSCI1950 Z Computa4onal Methods for Biology Lecture 4. Ben Raphael February 2, hhp://cs.brown.edu/courses/csci1950 z/ Algorithm Summary CSCI1950 Z Computa4onal Methods for Biology Lecture 4 Ben Raphael February 2, 2009 hhp://cs.brown.edu/courses/csci1950 z/ Algorithm Summary Parsimony Probabilis4c Method Input Output Sankoff s & Fitch

More information

Factor Graphs and Message Passing Algorithms Part 1: Introduction

Factor Graphs and Message Passing Algorithms Part 1: Introduction Factor Graphs and Message Passing Algorithms Part 1: Introduction Hans-Andrea Loeliger December 2007 1 The Two Basic Problems 1. Marginalization: Compute f k (x k ) f(x 1,..., x n ) x 1,..., x n except

More information

Lecture 4: State Estimation in Hidden Markov Models (cont.)

Lecture 4: State Estimation in Hidden Markov Models (cont.) EE378A Statistical Signal Processing Lecture 4-04/13/2017 Lecture 4: State Estimation in Hidden Markov Models (cont.) Lecturer: Tsachy Weissman Scribe: David Wugofski In this lecture we build on previous

More information

Markov Models & DNA Sequence Evolution

Markov Models & DNA Sequence Evolution 7.91 / 7.36 / BE.490 Lecture #5 Mar. 9, 2004 Markov Models & DNA Sequence Evolution Chris Burge Review of Markov & HMM Models for DNA Markov Models for splice sites Hidden Markov Models - looking under

More information

Dynamic Approaches: The Hidden Markov Model

Dynamic Approaches: The Hidden Markov Model Dynamic Approaches: The Hidden Markov Model Davide Bacciu Dipartimento di Informatica Università di Pisa bacciu@di.unipi.it Machine Learning: Neural Networks and Advanced Models (AA2) Inference as Message

More information

Discrete & continuous characters: The threshold model

Discrete & continuous characters: The threshold model Discrete & continuous characters: The threshold model Discrete & continuous characters: the threshold model So far we have discussed continuous & discrete character models separately for estimating ancestral

More information

An Introduction to Bayesian Networks: Representation and Approximate Inference

An Introduction to Bayesian Networks: Representation and Approximate Inference An Introduction to Bayesian Networks: Representation and Approximate Inference Marek Grześ Department of Computer Science University of York Graphical Models Reading Group May 7, 2009 Data and Probabilities

More information

Michael Yaffe Lecture #5 (((A,B)C)D) Database Searching & Molecular Phylogenetics A B C D B C D

Michael Yaffe Lecture #5 (((A,B)C)D) Database Searching & Molecular Phylogenetics A B C D B C D 7.91 Lecture #5 Database Searching & Molecular Phylogenetics Michael Yaffe B C D B C D (((,B)C)D) Outline Distance Matrix Methods Neighbor-Joining Method and Related Neighbor Methods Maximum Likelihood

More information

Lecture 4: Evolutionary Models and Substitution Matrices (PAM and BLOSUM)

Lecture 4: Evolutionary Models and Substitution Matrices (PAM and BLOSUM) Bioinformatics II Probability and Statistics Universität Zürich and ETH Zürich Spring Semester 2009 Lecture 4: Evolutionary Models and Substitution Matrices (PAM and BLOSUM) Dr Fraser Daly adapted from

More information

Conditional Random Field

Conditional Random Field Introduction Linear-Chain General Specific Implementations Conclusions Corso di Elaborazione del Linguaggio Naturale Pisa, May, 2011 Introduction Linear-Chain General Specific Implementations Conclusions

More information

Probabilistic Graphical Models: MRFs and CRFs. CSE628: Natural Language Processing Guest Lecturer: Veselin Stoyanov

Probabilistic Graphical Models: MRFs and CRFs. CSE628: Natural Language Processing Guest Lecturer: Veselin Stoyanov Probabilistic Graphical Models: MRFs and CRFs CSE628: Natural Language Processing Guest Lecturer: Veselin Stoyanov Why PGMs? PGMs can model joint probabilities of many events. many techniques commonly

More information

Estimating Phylogenies (Evolutionary Trees) II. Biol4230 Thurs, March 2, 2017 Bill Pearson Jordan 6-057

Estimating Phylogenies (Evolutionary Trees) II. Biol4230 Thurs, March 2, 2017 Bill Pearson Jordan 6-057 Estimating Phylogenies (Evolutionary Trees) II Biol4230 Thurs, March 2, 2017 Bill Pearson wrp@virginia.edu 4-2818 Jordan 6-057 Tree estimation strategies: Parsimony?no model, simply count minimum number

More information

arxiv: v1 [q-bio.pe] 4 Sep 2013

arxiv: v1 [q-bio.pe] 4 Sep 2013 Version dated: September 5, 2013 Predicting ancestral states in a tree arxiv:1309.0926v1 [q-bio.pe] 4 Sep 2013 Predicting the ancestral character changes in a tree is typically easier than predicting the

More information

Constructing Evolutionary/Phylogenetic Trees

Constructing Evolutionary/Phylogenetic Trees Constructing Evolutionary/Phylogenetic Trees 2 broad categories: istance-based methods Ultrametric Additive: UPGMA Transformed istance Neighbor-Joining Character-based Maximum Parsimony Maximum Likelihood

More information

Phylogenetic Inference and Hypothesis Testing. Catherine Lai (92720) BSc(Hons) Department of Mathematics and Statistics University of Melbourne

Phylogenetic Inference and Hypothesis Testing. Catherine Lai (92720) BSc(Hons) Department of Mathematics and Statistics University of Melbourne Phylogenetic Inference and Hypothesis Testing Catherine Lai (92720) BSc(Hons) Department of Mathematics and Statistics University of Melbourne November 13, 2003 Contents 1 Introduction 4 2 Molecular Phylogenetics

More information

Part I. C. M. Bishop PATTERN RECOGNITION AND MACHINE LEARNING CHAPTER 8: GRAPHICAL MODELS

Part I. C. M. Bishop PATTERN RECOGNITION AND MACHINE LEARNING CHAPTER 8: GRAPHICAL MODELS Part I C. M. Bishop PATTERN RECOGNITION AND MACHINE LEARNING CHAPTER 8: GRAPHICAL MODELS Probabilistic Graphical Models Graphical representation of a probabilistic model Each variable corresponds to a

More information

Graphical Models and Kernel Methods

Graphical Models and Kernel Methods Graphical Models and Kernel Methods Jerry Zhu Department of Computer Sciences University of Wisconsin Madison, USA MLSS June 17, 2014 1 / 123 Outline Graphical Models Probabilistic Inference Directed vs.

More information

1. what conditional independencies are implied by the graph. 2. whether these independecies correspond to the probability distribution

1. what conditional independencies are implied by the graph. 2. whether these independecies correspond to the probability distribution NETWORK ANALYSIS Lourens Waldorp PROBABILITY AND GRAPHS The objective is to obtain a correspondence between the intuitive pictures (graphs) of variables of interest and the probability distributions of

More information

A Minimum Spanning Tree Framework for Inferring Phylogenies

A Minimum Spanning Tree Framework for Inferring Phylogenies A Minimum Spanning Tree Framework for Inferring Phylogenies Daniel Giannico Adkins Electrical Engineering and Computer Sciences University of California at Berkeley Technical Report No. UCB/EECS-010-157

More information

Probabilistic Graphical Networks: Definitions and Basic Results

Probabilistic Graphical Networks: Definitions and Basic Results This document gives a cursory overview of Probabilistic Graphical Networks. The material has been gleaned from different sources. I make no claim to original authorship of this material. Bayesian Graphical

More information

A (short) introduction to phylogenetics

A (short) introduction to phylogenetics A (short) introduction to phylogenetics Thibaut Jombart, Marie-Pauline Beugin MRC Centre for Outbreak Analysis and Modelling Imperial College London Genetic data analysis with PR Statistics, Millport Field

More information

Evolutionary Analysis of Viral Genomes

Evolutionary Analysis of Viral Genomes University of Oxford, Department of Zoology Evolutionary Biology Group Department of Zoology University of Oxford South Parks Road Oxford OX1 3PS, U.K. Fax: +44 1865 271249 Evolutionary Analysis of Viral

More information

CS Lecture 3. More Bayesian Networks

CS Lecture 3. More Bayesian Networks CS 6347 Lecture 3 More Bayesian Networks Recap Last time: Complexity challenges Representing distributions Computing probabilities/doing inference Introduction to Bayesian networks Today: D-separation,

More information

Probabilistic Graphical Models

Probabilistic Graphical Models Probabilistic Graphical Models Brown University CSCI 295-P, Spring 213 Prof. Erik Sudderth Lecture 11: Inference & Learning Overview, Gaussian Graphical Models Some figures courtesy Michael Jordan s draft

More information

1. Can we use the CFN model for morphological traits?

1. Can we use the CFN model for morphological traits? 1. Can we use the CFN model for morphological traits? 2. Can we use something like the GTR model for morphological traits? 3. Stochastic Dollo. 4. Continuous characters. Mk models k-state variants of the

More information

Phylogenetics: Building Phylogenetic Trees

Phylogenetics: Building Phylogenetic Trees 1 Phylogenetics: Building Phylogenetic Trees COMP 571 Luay Nakhleh, Rice University 2 Four Questions Need to be Answered What data should we use? Which method should we use? Which evolutionary model should

More information

13: Variational inference II

13: Variational inference II 10-708: Probabilistic Graphical Models, Spring 2015 13: Variational inference II Lecturer: Eric P. Xing Scribes: Ronghuo Zheng, Zhiting Hu, Yuntian Deng 1 Introduction We started to talk about variational

More information

11 The Max-Product Algorithm

11 The Max-Product Algorithm Massachusetts Institute of Technology Department of Electrical Engineering and Computer Science 6.438 Algorithms for Inference Fall 2014 11 The Max-Product Algorithm In the previous lecture, we introduced

More information

April 20th, Advanced Topics in Machine Learning California Institute of Technology. Markov Chain Monte Carlo for Machine Learning

April 20th, Advanced Topics in Machine Learning California Institute of Technology. Markov Chain Monte Carlo for Machine Learning for for Advanced Topics in California Institute of Technology April 20th, 2017 1 / 50 Table of Contents for 1 2 3 4 2 / 50 History of methods for Enrico Fermi used to calculate incredibly accurate predictions

More information

5. Sum-product algorithm

5. Sum-product algorithm Sum-product algorithm 5-1 5. Sum-product algorithm Elimination algorithm Sum-product algorithm on a line Sum-product algorithm on a tree Sum-product algorithm 5-2 Inference tasks on graphical models consider

More information

Artificial Intelligence

Artificial Intelligence ICS461 Fall 2010 Nancy E. Reed nreed@hawaii.edu 1 Lecture #14B Outline Inference in Bayesian Networks Exact inference by enumeration Exact inference by variable elimination Approximate inference by stochastic

More information

Announcements. CS 188: Artificial Intelligence Fall Causality? Example: Traffic. Topology Limits Distributions. Example: Reverse Traffic

Announcements. CS 188: Artificial Intelligence Fall Causality? Example: Traffic. Topology Limits Distributions. Example: Reverse Traffic CS 188: Artificial Intelligence Fall 2008 Lecture 16: Bayes Nets III 10/23/2008 Announcements Midterms graded, up on glookup, back Tuesday W4 also graded, back in sections / box Past homeworks in return

More information

Intelligent Systems:

Intelligent Systems: Intelligent Systems: Undirected Graphical models (Factor Graphs) (2 lectures) Carsten Rother 15/01/2015 Intelligent Systems: Probabilistic Inference in DGM and UGM Roadmap for next two lectures Definition

More information

Bayesian Analysis of Elapsed Times in Continuous-Time Markov Chains

Bayesian Analysis of Elapsed Times in Continuous-Time Markov Chains Bayesian Analysis of Elapsed Times in Continuous-Time Markov Chains Marco A. R. Ferreira 1, Marc A. Suchard 2,3,4 1 Department of Statistics, University of Missouri at Columbia, USA 2 Department of Biomathematics

More information

Sampling Rejection Sampling Importance Sampling Markov Chain Monte Carlo. Sampling Methods. Machine Learning. Torsten Möller.

Sampling Rejection Sampling Importance Sampling Markov Chain Monte Carlo. Sampling Methods. Machine Learning. Torsten Möller. Sampling Methods Machine Learning orsten Möller Möller/Mori 1 Recall Inference or General Graphs Junction tree algorithm is an exact inference method for arbitrary graphs A particular tree structure defined

More information

Letter to the Editor. Department of Biology, Arizona State University

Letter to the Editor. Department of Biology, Arizona State University Letter to the Editor Traditional Phylogenetic Reconstruction Methods Reconstruct Shallow and Deep Evolutionary Relationships Equally Well Michael S. Rosenberg and Sudhir Kumar Department of Biology, Arizona

More information

CPSC 540: Machine Learning

CPSC 540: Machine Learning CPSC 540: Machine Learning Undirected Graphical Models Mark Schmidt University of British Columbia Winter 2016 Admin Assignment 3: 2 late days to hand it in today, Thursday is final day. Assignment 4:

More information

Is the equal branch length model a parsimony model?

Is the equal branch length model a parsimony model? Table 1: n approximation of the probability of data patterns on the tree shown in figure?? made by dropping terms that do not have the minimal exponent for p. Terms that were dropped are shown in red;

More information

Phylogenetics: Bayesian Phylogenetic Analysis. COMP Spring 2015 Luay Nakhleh, Rice University

Phylogenetics: Bayesian Phylogenetic Analysis. COMP Spring 2015 Luay Nakhleh, Rice University Phylogenetics: Bayesian Phylogenetic Analysis COMP 571 - Spring 2015 Luay Nakhleh, Rice University Bayes Rule P(X = x Y = y) = P(X = x, Y = y) P(Y = y) = P(X = x)p(y = y X = x) P x P(X = x 0 )P(Y = y X

More information

POPULATION GENETICS Winter 2005 Lecture 17 Molecular phylogenetics

POPULATION GENETICS Winter 2005 Lecture 17 Molecular phylogenetics POPULATION GENETICS Winter 2005 Lecture 17 Molecular phylogenetics - in deriving a phylogeny our goal is simply to reconstruct the historical relationships between a group of taxa. - before we review the

More information

11. Learning graphical models

11. Learning graphical models Learning graphical models 11-1 11. Learning graphical models Maximum likelihood Parameter learning Structural learning Learning partially observed graphical models Learning graphical models 11-2 statistical

More information

CSC 412 (Lecture 4): Undirected Graphical Models

CSC 412 (Lecture 4): Undirected Graphical Models CSC 412 (Lecture 4): Undirected Graphical Models Raquel Urtasun University of Toronto Feb 2, 2016 R Urtasun (UofT) CSC 412 Feb 2, 2016 1 / 37 Today Undirected Graphical Models: Semantics of the graph:

More information

Hidden Markov Model. Ying Wu. Electrical Engineering and Computer Science Northwestern University Evanston, IL 60208

Hidden Markov Model. Ying Wu. Electrical Engineering and Computer Science Northwestern University Evanston, IL 60208 Hidden Markov Model Ying Wu Electrical Engineering and Computer Science Northwestern University Evanston, IL 60208 http://www.eecs.northwestern.edu/~yingwu 1/19 Outline Example: Hidden Coin Tossing Hidden

More information

Probabilistic Graphical Models

Probabilistic Graphical Models Probabilistic Graphical Models Lecture 11 CRFs, Exponential Family CS/CNS/EE 155 Andreas Krause Announcements Homework 2 due today Project milestones due next Monday (Nov 9) About half the work should

More information

Bayesian Inference for DSGE Models. Lawrence J. Christiano

Bayesian Inference for DSGE Models. Lawrence J. Christiano Bayesian Inference for DSGE Models Lawrence J. Christiano Outline State space-observer form. convenient for model estimation and many other things. Bayesian inference Bayes rule. Monte Carlo integation.

More information

Lecture 8: Bayesian Networks

Lecture 8: Bayesian Networks Lecture 8: Bayesian Networks Bayesian Networks Inference in Bayesian Networks COMP-652 and ECSE 608, Lecture 8 - January 31, 2017 1 Bayes nets P(E) E=1 E=0 0.005 0.995 E B P(B) B=1 B=0 0.01 0.99 E=0 E=1

More information

Statistical Approaches to Learning and Discovery

Statistical Approaches to Learning and Discovery Statistical Approaches to Learning and Discovery Graphical Models Zoubin Ghahramani & Teddy Seidenfeld zoubin@cs.cmu.edu & teddy@stat.cmu.edu CALD / CS / Statistics / Philosophy Carnegie Mellon University

More information

Bayesian Machine Learning - Lecture 7

Bayesian Machine Learning - Lecture 7 Bayesian Machine Learning - Lecture 7 Guido Sanguinetti Institute for Adaptive and Neural Computation School of Informatics University of Edinburgh gsanguin@inf.ed.ac.uk March 4, 2015 Today s lecture 1

More information