SUPPLEMENTARY INFORMATION

Transcription

1 In the format provided by the authors and unedited. ARTICLE NUMBER: 68 DI:.38/NPLANTS.6.8 A role for leucoanthocyanidin reductase in the extension of proanthocyanidins Chenggang Liu,, Xiaoqiang Wang,, Vladimir Shulaev and Richard A. Dixon,* BioDiscovery Institute and Department of Biological Sciences, University of North Texas, Denton, TX *Author for correspondence: Richard A. Dixon, Richard.Dixon@unt.edu NATURE PLANTS 6 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.

2 DI:.38/NPLANTS.6.8 H H + H + L-Phenylalanine Leucoanthocyanidin ANS Anthocyanidin UGT Glc Anthocyanin LAR ANR H H (+)-Flavan-3-ol (Catechin) (-)-Flavan-3-ol (Epicatechin) xidative (?) polymerization ligomer and PA polymer H n H Supplementary Figure. Biosynthesis of proanthocyanidins. The classes of compound are indicated, with structures illustrating the precursors of catechin and epicatechin. ANS: anthocyanidin synthase, UGT: UDP-glucosyltransferase, LAR: leucoanthocyanidin reductase, ANR: anthocyanidin reductase. Glc: glucose NATURE PLANTS 6 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.

3 DI:.38/NPLANTS.6.8 a lar- lar- b c.. Lar Tub R8 lar- lar- Ratio (Lar/Tubulin) R8 lar- lar- Supplementary Figure. Identification of Tnt insertional mutants of LAR. a, Schematic of the LAR gene depicting Tnt insertion positions in lar- and lar-. Gene direction is from left to right. Boxes: exons, lines: Introns. Arrows: the positions of primers for qrt-pcr. b, RT-PCR for detecting full-length LAR transcripts in R8 (wild-type), lar- and lar-. PCR was run for 3 cycles. c, qrt-pcr for quantification of LAR transcripts in R8 (wild-type), lar- and lar-. Transcript levels are averages of 3 independent biological samples. Error bars are standard deviations. NATURE PLANTS Macmillan Publishers Limited, part of Springer Nature. All rights reserved.

4 DI:.38/NPLANTS.6.8 D 8 (mau) a 3 lar- b 3 3 lar- 3 min min c 8 6 R8 3 d Epi-phloro Epicatechin B min min e 6 f Epi-phloro R8 R Relative Abundance Abundance ( ) 6 6 Cat-phloro lar- lar- B B3 Relative Abundance lar- lar- B B m/z Supplementary Figure 3. Phloroglucinolysis of the insoluble PA fraction from R8 (wild-type) and lar mutants. Insoluble PAs from R8 and lar mutant seeds (3 DAP) were hydrolyzed in the presence of phloroglucinol-hcl. a-d, HPLC profiles of phloroglucinolysis products from lar- (a), lar- (b), wild-type R8 (c) and procyanidin B, providing standards for epicatechin-phloroglucinol ( min peak) and epicatechin (starter unit) (d). (e) EIC of released epicatechin phloroglucinol (Epi-phloro, m/z ± ppm). (f) Mass spectrum of epicatechin-phloroglucinol and catechin-phloroglucinol (Cat-phloro). Epicatechinphloroglucinol released from procyanidin B and catechin-phloroglucinol released from procyanidin B3 were analyzed for comparison in e and f. Phloroglucinolysis mixtures were separated by HPLC with UV detection in a-d, and by UPLC with accurate mass detection in e and f. All ions were detected in negative mode. Representative results of multiple biological replicate samples (a-d, n=3; e-f, n=) are presented. NATURE PLANTS 6 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.

5 DI:.38/NPLANTS.6.8 a anr- anr- Epicatechin equivalents (µg/g) 8 6 b R8 Soluble PA anr- Procyanidin B equivalents (mg/g) 3 3 c R8 Insoluble PA anr- Supplementary Figure. Measurement of soluble and insoluble PA contents in anr mutants. a, Schematic of the Medicago ANR gene depicting Tnt insertion positions in anr- and anr-. Gene direction is from left to right. Boxes, exons; lines, Introns. b, Soluble PAs in mature dry anr- seeds were quantified by the DMACA method and their contents expressed as epicatechin equivalents. c, Insoluble PAs quantified by the butanol/hcl method and their contents expressed as procyanidin B equivalents. anr- was not studied further due to poor growth and seed set, presumably the result of an additional Tnt insertion. NATURE PLANTS 6 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.

6 DI:.38/NPLANTS.6.8 Abundance ( ) Catechin Catechin Epicatechin Epicatechin R8 lar- lar- anr- Standard Abundance ( 6 ) Epicatechin-3 -glc R8 lar- lar- anr Supplementary Figure. EIC of flavan-3-ols (89.78 ± ppm) and epicatechin-3ˊ-glucoside (. ± ppm) in DAP seeds of R8 (wild-type), lar-, lar- and anr- mutants. All ions were detected in negative mode. Representative results of multiple biological replicate samples (n=) are presented. NATURE PLANTS Macmillan Publishers Limited, part of Springer Nature. All rights reserved.

7 DI:.38/NPLANTS LAR ANR Relative expression level (gene/tubulin) GUS control MYB MYB Supplementary Figure 6. Quantification of LAR and ANR transcript levels in MYB and MYB over-expressing hairy roots by qrt-pcr. Medicago hairy roots transformed with the same vector harboring the GUS gene was used as vector control. The averages of three biological replicates are presented and error bars represent standard deviations. NATURE PLANTS Macmillan Publishers Limited, part of Springer Nature. All rights reserved.

8 DI:.38/NPLANTS.6.8 a b MYB MYB Abundance ( ) MYB Abundance ( ) MYB Relative Abundance Catechin Epicatechin Catechin Epicatechin Standard 6 8 Relative Abundance Standard 6 8 Supplementary Figure 7. EIC of epicatechin and catechin in extracts from MYB and MYB over-expressing Medicago hairy roots treated with recombinant LAR. a, Extracts treated with recombinant LAR. b, Extracts without LAR addition. All ions were detected in negative mode. Representative results of multiple biological replicate samples (n=3) are presented. NATURE PLANTS Macmillan Publishers Limited, part of Springer Nature. All rights reserved.

9 DI:.38/NPLANTS.6.8 epicatechin F F F Abundance ( ) F F3 F F 6 8 Supplementary Figure 8. Preliminary fractionation of the substrate of LAR. Extracts from MYB over-expressing Medicago hairy roots were separated on a Sep- Pak C8 column and eluted sequentially with increasing concentrations of methanol. F: % methanol fraction, etc. Fractions were then incubated with recombinant LAR. Data show EICs of epicatechin (m/z ± ppm). All ions were detected in negative mode. NATURE PLANTS Macmillan Publishers Limited, part of Springer Nature. All rights reserved.

10 DI:.38/NPLANTS.6.8 a Absorbance (D 8) Catechin Epicatechin b Abundance ( 6 ) 3 3min Elution time (min) Supplementary Figure 9. Analysis of fractions from MYB over-expressing Medicago hairy roots for the presence of the substrate of LAR. a, HPLC chromatogram of epicatechin and catechin indicating the elution times of the endogenous compounds. b, Fractions and from the Sep-Pak column (Supplementary Figure 8) were pooled and further separated on an analytical C8 column into 3 fractions (from min to 36 min), and every fraction was then incubated with recombinant LAR. Epicatechin production was quantified by UPLC/MS analyses with extracted ions. The epicatechin in Fractions and 6 is endogenous free epicatechin NATURE PLANTS 6 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.

11 DI:.38/NPLANTS.6.8 H Epi-Cys m/z 8.76 S N H H + + HS N H m/z 87.9 Neutral loss.97 Epi-GlcA m/z H H H + Glc H + m/z H H + C m/z 7. Glucuronic acid-derived moiety H H Epi-Glc-Cys m/z 7.83 S S m/z Glucose moiety Neutral loss 6.7 N H N H Supplementary Figure. Ions observed in epicatechin-producing fractions of MYB over-expressing hairy roots and their breakdown patterns. NATURE PLANTS 6 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.

12 DI:.38/NPLANTS.6.8 Epi-cys.86 6 Abundance ( ) [Epi-GlcA NH ] + adduct 8.3 (Epi)catechin carbocation Epi-GlcA Epi-Glc-Cys m/z Supplementary Figure. UPLC/MS analysis in positive mode of ions in the fraction producing epicatechin upon LAR treatment. The same fraction as indicated in Fig. was analyzed with UPLC/MS in positive mode. Epi- Cys, epicatechin-cysteine conjugate; Epi-GlcA, epicatechin-glucuronic acid. Epi-Glc-Cys, epicatechin-3 -glucoside cysteine conjugate. NATURE PLANTS 6 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.

13 DI:.38/NPLANTS.6.8 Abundance ( ) Abundance ( 6 ) a 8 6 c m/z 63.9 m/z 7.3 Abundance ( ) Abundance ( 6 ) m/z b d m/z Supplementary Figure. SIM MS/MS analyses of epicatechin-glucuronic acid (m/z 63.9) and epicatechin-glucoside-cysteine (m/z 7.3) conjugates. a, SIM chromatogram of epicatechin-glucuronic acid, X axis is retention time. b, MS/MS spectrum of epicatechin-glucuronic acid, red indicating the characteristic ions of glucuronide (m/z 7.93) and epicatechin carbocation (m/z 87.6). c, SIM chromatogram of epicatechin-glucoside-cysteine, X axis is retention time. d, MS/MS spectrum of epicatechin-glucoside-cysteine, red indicating characteristic ions of epicatechin carbocation (m/z 87.6), epicatechin-cysteine (m/z 8.76) and epicatechin-glucoside carbocation (m/z 9.886). NATURE PLANTS Macmillan Publishers Limited, part of Springer Nature. All rights reserved.

14 DI:.38/NPLANTS.6.8 a KD b 7 37 Initial velocity (nm/min) Substrate concentration (µm) c Vmax (nm min - ) Km (µm) Kcat (min - ) Kcat/Km (min - M - ) 6.73 ± ± X 3 Supplementary Figure 3. Kinetic analysis of recombinant LAR with epicatechincysteine as substrate. a, SDS-PAGE gel of purified recombinant mutated LAR (MBP-LAR/K3G) and wild type LAR (MBP-LAR) fused with maltose binding protein (MBP) stained with Coomassie blue. b, Plot of initial velocity at different cysteinyl-epicatechin concentrations (with 3 analytical replicates). c, Kinetic parameters of wild-type recombinant LAR. NATURE PLANTS 6 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.

15 DI:.38/NPLANTS.6.8 a b Epi-Cys H K3 NADPH K3 NADPH H Epi-Cys Supplementary Figure. Molecular modeling of MtLAR. a, A modeled structure of MtLAR docked with NADPH and epicatechin-cysteine. b, The putative ligand-binding pocket. The ligands NADPH and epicatechin-cysteine, and catalytic residues Lys3 and His, are shown as bond models, and two water molecules as spheres. NATURE PLANTS 6 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.

16 DI:.38/NPLANTS.6.8 Abundance ( ) 3 3 MYB MYB Supplementary Figure. EIC of epicatechin-cysteine in MYB and MYB overexpressing hairy roots. Representative results of multiple biological replicate samples (n=3) are presented. Epicatechin Epicatechin-cysteine Blank D.7 D.3 D. Supplementary Figure 6. DMACA reactivity of epicatechin-cysteine. Five µl of mm epicatechin or epicatechin-cysteine were added to µl.% DMACA stain solution. D values are absorbance at 6 nm. Similar results were observed from three replicate experiments. NATURE PLANTS Macmillan Publishers Limited, part of Springer Nature. All rights reserved.

17 DI:.38/NPLANTS.6.8 Abundance ( ) a PH. PH. PH 6. PH 7. PH 8. B Abundance ( ) b PH. PH. PH 6. PH 7. PH 8. B Supplementary Figure 7. EIC of procyanidin dimers formed from autopolymerzation between cysteinyl-epicatechin and epicatechin or epicatechin alone at various ph values. a, Dimers (77.3 ± ppm) formed from the incubation of µm cysteinylepicatechin and µm epicatechin. b, Dimers formed from the incubation of µm epicatechin alone. B: procyanidin B standard. All ions were detected in negative mode. Note the different scales for the Y axes in a and b. Representative results of multiple technical replicate experiments (n=3) are presented. NATURE PLANTS Macmillan Publishers Limited, part of Springer Nature. All rights reserved.

18 DI:.38/NPLANTS.6.8 a b PH. PH. PH. PH. Abundance ( ) PH 6. Abundance ( ) PH 6. PH 7. PH 7. PH 8. PH 8. C C Supplementary Figure 8. EIC of procyanidin trimers formed from autopolymerization between cysteinyl-epicatechin and epicatechin or epicatechin alone at various ph values. a,trimers (86.98 ± ppm) formed from the incubation of µm cysteinyl-epicatechin and µm epicatechin. b,trimers formed from the incubation of µm epicatechin alone. C: procyanidin C standard from Arabidopsis seed extracts. All ions were detected in negative mode. Representative results of multiple technical replicate experiments (n=3) are presented. NATURE PLANTS Macmillan Publishers Limited, part of Springer Nature. All rights reserved.

19 DI:.38/NPLANTS.6.8 a b 3 Abundance ( 3 ) Trimer Abundance ( ) Tetramer Relative Abundance 8 6 Relative Abundance 8 6 Supplementary Figure 9. EIC of trimers and tetramers formed from autopolymerization between cysteinyl-epicatechin and epicatechin after h incubation. a, EIC of trimers (86.98 ± ppm) from incubation of epicatechin with cysteinylepicatechin (top panel). EIC of procyanidin C from Arabidopsis seed extract was used as standard (bottom panel). b, EIC of tetramer (3.6 ± ppm) from incubation of epicatechin with cysteinyl-epicatechin (top panel). EIC of procyanidin tetramer from Arabidopsis seed extract was used as standard (bottom panel). All ions were detected in negative mode. Representative results of multiple technical replicate experiments (n=3) are presented. NATURE PLANTS Macmillan Publishers Limited, part of Springer Nature. All rights reserved.

20 DI:.38/NPLANTS.6.8 a Abundance ( ) Relative Abundance B+epi-cys B alone Trimer standard Abundance ( 3 ) Relative Abundance b B+epi-cys B alone Tetramer standard Supplementary Figure. EIC of trimer and tetramers formed from autopolymerization between cysteinyl-epicatechin and procyanidin B. a, EIC of trimers (86.98 ± ppm) from incubation of procyanidin B with (top panel) or without (middle panel) cysteinyl-epicatechin for h. EIC of procyanidin C from Arabidopsis seed extract was used as standard (bottom panel). b, EIC of tetramers (3.6 ± ppm) from incubation of procyanidin B with (top panel) or without (middle panel) cysteinyl-epicatechin for h. EIC of epicatechin tetramer from Arabidopsis seed extract was used as standard (bottom panel). All ions were detected in negative mode. Representative results of multiple technical replicate experiments (n=3) are presented. NATURE PLANTS 6 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.

21 DI:.38/NPLANTS.6.8 H Cysteinylepicatechin S H N + H 3 CH 3 3 CH CH Heavy Epicatechin H H 3 CH 3 3 CH CH H H 3 CH 3 H 3 CH C 3 CH 3 3 CH CH Light procyanidin B (M+3) H Heavy procyanidin B (M+6) H H 3 CH 3 3 CH CH Light procyanidin C (M+3) Supplementary Figure. Schematic showing auto-polymerization products from incubation of cysteinyl-epicatechin with stable 3 C isotope labeled epicatechin. NATURE PLANTS 6 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.

22 DI:.38/NPLANTS.6.8 a b c Light dimer Heavy dimer Trimer µm µm µm Abandance ( ) 6. µm µm µm Abandance ( ) 6. µm µm µm Abandance ( ) 6. µm µm µm µm µm µm µm µm µm Supplementary Figure. EIC of dimers and light trimers formed from autopolymerization between cysteinyl-epicatechin and fixed concentration of 3 C- labeled epicatechin under different concentrations of cysteinyl-epicatechin. a, Light dimers (m/z 8. ± ppm) formed between cysteinyl-epicatechin and 3 C- labeled epicatechin at various concentration (from µm to µm) of cysteinylepicatechin and µm 3 C-labeled epicatechin. b, Heavy dimer (m/z 83.3 ± ppm) formed from condensation of 3 C-labeled epicatechin. c, Light trimers (m/z ± ppm) formed between cysteinyl-epicatechin and 3 C- labeled epicatechin at various concentrations of cysteinyl-epicatechin and µm 3 C-labeled epicatechin. Note the times difference of Y-axis scale between a and b. Triangles indicate the authentic procyanidin B and C elution times. All ions were detected in negative mode. Representative results of multiple technical replicate experiments (n=3) are presented. NATURE PLANTS 6 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.

23 DI:.38/NPLANTS.6.8 Abundance ( ) a b c Light dimer Heavy dimer Trimer µm µm 6. µm 6. µm µm µm µm µm Abundance ( ) Abundance ( ) µm 6. µm µm µm µm µm µm µm µm µm Supplementary Figure 3. EIC of dimers and light trimers formed from autopolymerization between cysteinyl-epicatechin and 3 C-labeled epicatechin at different epicatechin concentrations. a, Light dimers (m/z 8. ± ppm) formed between cysteinyl-epicatechin and 3 C- labeled epicatechin at various concentrations of 3 C-labeled epicatechin (from µm to µm) and µm cysteinyl-epicatechin. b, Heavy dimers (m/z 83.3 ± ppm) formed from 3 C-labeled epicatechin alone. c, Light trimers (m/z ± ppm) formed between cysteinyl-epicatechin and 3 C-labeled epicatechin at various concentration of 3 C-labeled epicatechin and µm cysteinyl-epicatechin. Note the times difference of Y-axis scale between a and b. Triangles indicate the authentic procyanidin B and C elution times. All ions were detected in negative mode. Representative results of multiple technical replicate experiments (n=3) are presented. NATURE PLANTS Macmillan Publishers Limited, part of Springer Nature. All rights reserved.

24 DI:.38/NPLANTS.6.8 Supplementary Methods Growth of Plant Materials lar- (NF987), lar- (NF8997), anr- (NF96) and anr- (NF8737) were obtained from The Noble Foundation, Ardmore, klahoma. Seeds were scarified with concentrated sulfuric acid (98%) for min, then washed five times with a large amount of water to remove sulfuric acid. Scarified seeds were sterilized with % bleach for min and then rinsed five times with sterile water. Sterilized seeds were vernalized at C for days on moist, sterile filter paper. Vernalized seeds were germinated on filter paper for days before transfer to soil in pots. The plants were grown in a growth chamber set at 6h/8h day/night cycle, C. Confirmation of Tnt insertions Tnt insertional mutants were confirmed by PCR with gene specific primers and a Tnt transposon specific primer. The following primers were used. For lar-; Tnt-F, ACAGTGCTACCTCCTCTGGATG and LAR-R, TCAACAGGAAGCTGTGATTGGCACT. For lar-; Tnt-R, TGTAGCACCGAGATACGGTAATTAACAAGA and LAR-R. For anr-, Tnt-F and ANR-R, TCACTTGATCCCCTGAGTCTTCAAATACT. For anr-; ANRGT-F, CCGTGTATGAGTCTATGCTTCATAGCTGT and Tnt-R. Primers for PCR analysis For regular RT-PCR, primers LAR-F: CACCATGGCACCATCATCATCAC and LAR-R: TCAACAGGAAGCTGTGATTGGCACT were used for amplification of full-length LAR transcripts. The primers Tub-F, TTTGCTCCTCTTACATCCCGTG and Tub-R, GCCATGGAGAGACCTCTAGG, were used for tubulin gene amplification. For qrt-pcr, LAR transcripts were quantified using the primers LARqpcr-F, CCGTTGGATCAATTGCACATC, and LARqpcr-R, GTAACAGTTGGTAGAGGGTCG, and tubulin transcripts were quantified using the primers NATURE PLANTS 6 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.

25 DI:.38/NPLANTS.6.8 TUBqPCR-F, TTTGCTCCTCTTACATCCCGTG and TUBqPCR-R, GCAGCACACATCATGTTTTTGG. ANR transcripts were quantified with primers ANRqpcr-F: CAACTTCTGGTCGATACATTTGC, and ANRqpcr-R: CTGAGGGTATCGTTTGCTGAG. Protein expression Transformed bacteria harboring the full length LAR cdna in pmal-cx vector were grown in LB medium supplemented with.% glucose to D 6 of., and isopropyl-β-thio-galactoside (IPTG) was added at.3 mm to induce protein expression. Two hundred ml of bacteria were harvested after h induction. LAR proteins were purified with amylose resin (NEB, E8) following the manufacturer s protocol. Briefly, bacteria were lysed by sonication at ºC in extraction buffer ( mm Tris ph 7., mm NaCl, mm dithiothreitol (DTT), mm phenylmethylsulfonyl fluoride (PMSF)). The bacterial lysates were centrifuged at, g for min at ºC. The supernatants were loaded on amylose resin which was washed with wash buffer (extraction buffer minus PMSF). Finally, proteins were eluted by elution buffer ( mm Tris ph 7., mm NaCl, mm DTT, mm maltose). Purified proteins were concentrated with an Amicon Ultra- Centrifugal Filter (Millipore) and aliquoted to store at -8 ºC. Measurement of PA content About mg of fresh seeds dissected from the indicated developmental stages, or dry seeds, were ground into powder in liquid nitrogen. The powder was extracted with ml of proanthocyanidin extraction solvent (PES; 7% acetone with.% acetic acid) by sonicating in a water bath for 3 min at room temperature. The resulting slurry was centrifuged at 3 g for min and supernatants were collected. The pellets were re-extracted twice, all supernatants were pooled, and pellets were saved for analysis of insoluble PAs. Equal volumes (3mL) of chloroform were added to pooled supernatants and the mixtures vortexed for 3 s, centrifuged at 3 g for min, and the supernatants further extracted twice with chloroform and twice with hexane. The resulting aqueous phase (soluble PA fraction) was lyophilized and NATURE PLANTS 6 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.

26 DI:.38/NPLANTS.6.8 re-dissolved in µl % aqueous methanol. PAs in the soluble fraction were quantified by the DMACA (p-dimethylaminocinnamaldehyde) method. Five µl of soluble PA fraction were mixed with µl of.% DMACA in methanol/concentrated HCl :, and the D at 6 nm was measured after min. Epicatechin was used as standard. Insoluble PA content was determined by the butanol/hcl method. The pellet after extraction with PES was lyophilized, ml of butanol/concentrated HCl (9:) was added, and the mixture was sonicated for h to re-suspend the pellet, followed by heating at 9 ºC for h. The mixture was then allowed to cool, centrifuged at, g for min, and the D at 3 nm was measured. Procyanidin B was used as standard and processed in parallel with experimental samples. Phloroglucinolysis of insoluble PA fractions The initial procedure was as described by Pang et al. for extraction of soluble PAs. The pellet after PES extraction was then lyophilized and µl phloroglucinolysis solution ( mg/ml phloroglucinol, mg/ml ascorbate acid,.n HCl in methanol) was added. The pellet was re-suspended by vortexing and incubated at ºC for min. The reaction was terminated by addition of an equal volume of. M sodium acetate, followed by centrifugation at, g for min. The supernatant was loaded onto a Sep-Pak C8 column (Waters, Sep-Pak Plus Light) to remove salts and eluted with % methanol. The eluted fraction was dried in a speed vacuum centrifuge, dissolved in water, and analyzed by UPLC/MS. Large scale extraction of the LAR substrate About g of MYB over-expressing Medicago hairy roots were grown on.7% agar plates containing Gamborg s B- medium supplemented with % sucrose. Hairy roots were ground to powder in liquid nitrogen and extracted with ml 8% methanol for 6 h at ºC. Tissue debris was filtered out through four layers of Miracloth (EMD Millipore), and methanol in the extract removed by rotary evaporation at NATURE PLANTS Macmillan Publishers Limited, part of Springer Nature. All rights reserved.

27 DI:.38/NPLANTS ºC. The resulting aqueous phase was extracted twice with ethyl acetate to remove endogenous catechin and epicatechin, and aqueous phases were retained, lyophilized, re-dissolved in ml water and loaded on a Sep-Pak C8 column (Waters, Plus Light) pre-equilibrated with.% formic acid. The column was sequentially washed with.% formic acid, and then %, %, %, %, 3%, %, % methanol containing.% formic acid, ml each wash. Each fraction was lyophilized, re-dissolved in µl water and used as substrate in LAR assays. The fractions containing the most LAR substrate as determined by epicatechin formation (% and % methanol) were further separated by HPLC as described above, with fractions collected every min from min to 36 min. Each fraction was lyophilized and re-dissolved in µl water; half was used as substrate for LAR enzyme assay, and the remaining half was analyzed by UPLC/MS. Synthesis and assay of β-(s-cysteinyl)-epicatechin Two hundrend µg procyanidin B (Sigma) dissolved in methanol was dried under vacuum, and dissolved in µl lysis solvent containing 8 mg/ml cysteine base (Sigma),. N HCl in methanol. The lysis reaction was incubated at ºC for 3 min, and the reaction terminated by addition of µl cold water. β-(s-cysteinyl)-epicatechin was purified from the reaction mixture by HPLC using a mm x.6 mm, µm, C8 column. The fraction containing β-(s-cysteinyl)-epicatechin was lyophilized and dissolved in water. To show activity as a substrate for LAR, reaction mixtures containing mm Tris ph 7., µm NADPH, µm β-(s-cysteinyl)-epicatechin, and µg recombinant LAR protein in a total volume of µl were incubated for h at room temperature and terminated by addition of µl ethyl acetate. The ethyl acetate extract was dried under vacuum, dissolved in µl water and analyzed by UPLC/MS. Molecular modeling The comparative modeling program MDELLER 3 was used to generate models for MtLAR. The structure of Vitis vinifera LAR (PDB ID: 3I) was used as a template in the structural modeling experiment. The three dimensional model of MtLAR was obtained by optimally satisfying spatial NATURE PLANTS Macmillan Publishers Limited, part of Springer Nature. All rights reserved.

28 DI:.38/NPLANTS.6.8 restraints derived from the sequence alignment based on the CLUSTALX result and three dimensional structure. The co-factor NADPH structure model in MtLAR was obtained by superposition of the MtLAR model onto the VvLAR structure containing NADPH co-factor. For molecular docking of epicatechincysteine to MtLAR, an automated docking program GLD was used, and default genetic algorithm parameters for controlling the operation of the docking process were used. The docking calculation was restricted to the predicted binding pocket by defining the active site with residue Lys3. The structure of VvLAR bound with the alternative substrate catechin was used as reference. The structure model was analyzed and minor manual adjustments of the modeling solution were made using the graphics program CT. References Pang, Y., Peel, G. J., Wright, E., Wang, Z. & Dixon, R. A. Early steps in proanthocyanidin biosynthesis in the model legume Medicago truncatula. Plant physiology, 6-6 (7). Liu, C., Jun, J. H. & Dixon, R. A. MYB and MYB play pivotal roles in seed coat polymer biosynthesis in Medicago truncatula. Plant physiology 6, -39 (). 3 Fiser, A. & Sali, A. Modeller: generation and refinement of homology-based protein structure models. Methods in enzymology 37, 6-9 (3). Jones, G., Willett, P., Glen, R. C., Leach, A. R. & Taylor, R. Development and validation of a genetic algorithm for flexible docking. Journal of molecular biology 67, (997). Emsley, P. & Cowtan, K. Coot: model-building tools for molecular graphics. Acta Crystallograph D 6, 6 3 (). NATURE PLANTS Macmillan Publishers Limited, part of Springer Nature. All rights reserved.