Collaborative Conference on 3D & Materials Research June 2016 Songdo Convensia Incheon/Seoul, South Korea

Transcription

1 Collaborative Conference on 3D & Materials Research June 2016 Songdo Convensia Incheon/Seoul, South Korea

2 CC3DMR 2016 COMMITTEES & SCIENTIFIC TEAM CC3DMR Conference Chair Gregory J. Salamo University of Arkansas Fayetteville, AR, USA CC3DMR Conference Co-Chair Milko van der Boom Weizmann Institute of Science, Israel International Advisory Committee Zhiming Wang University of Electronic Science and Technology of China, China Simon Ringer - University of Sydney, Australia Magnus Willander - Linköping University, Norrköping, Sweden Richard Notzel - Technical University of Madrid, Spain Yong Zhang - University of North Carolina at Charlotte, USA Armando Rastelli Institute for Integrative Nanosciences, Germany Dongfeng XUE - Chinese Academy of Sciences, China Cardinal Warde - Massachusetts Institute of Technology, USA Toyohito Yatagai Utsunomiya University, Japan Lambertus Hesselink - Stanford University, United States Yasuhiro Takaki Tokyo University of Agriculture and Technology, Japan Ting-Chung Poon - Virginia Tech, USA Yongtian Wang Beijing Institute of Technology, China V. Michael Bove, Jr Massachusetts Institute of Technology Media Lab., USA I

3 CC3DMR 2016 COMMITTEES & SCIENTIFIC TEAM Scientific Program Committee George Barbastathis - Massachusetts Institute of Technology, USA Eli Brenner - Vrije Universiteit, Netherlands Yi-Pai Huang - National Chiao Tung University, Taiwan Osamu Matoba - Kobe University, Japan Nickolas S. Sapidis - University of Western Macedonia, Greece Georgios A. Triantafyllidis - Multimedia Technological Educational Institute of Crete, Greece Gerald Fuetterer - SeeReal Technology, Germany Masayuki Nakajima - Tokyo institute of Technology, Japan Pooi See Lee Nanyang Technological University, Singapore Alexander Govorov - Ohio University, USA Klemens Rumpf - Karl-Franzens-Universität Graz, Austria Wanlin Guo - Nanjing University, China Chunlei Guo - University of Rochester, USA Nigel Sammes Pohang University of Science and Technology, Korea International Organizing Committee Joseph Rosen - Ben-Gurion University of the Negev, Israel Christian Wöhler Technical University of Dortmund, Germany Tibor Balogh - Holografika (CEO), Hungary Hiroshi Yoshikawa - Nihon University, Japan Tiejun Huang - Peking University, China Takashi Kawai - Waseda University, Japan Xingjun Wang - Tsinghua University, China Jihoon Lee Kwangwoon University, South Korea Manuel Martinez-Corral - University of Valencia, Spain Mitsuteru Inoue - Toyohashi University of Technology, Japan Daniel Chua National University of Singapore, Singapore Emmanouil Lioudakis - Cyprus Institute, Cyprus II

4 CC3DMR 2016 COMMITTEES & SCIENTIFIC TEAM International Organizing Committee Li-Jun Wan Institute of Chemistry at Chinese Academy of Sciences, China Abdel Hadi Kassiba Universite du Maine, Le Mans, France Arunava Gupta University of Alabama, USA Gan Moog Chow National University of Singapore, Singapore Ahsanulhaq Qurashi King Fahd University of Petroleum and Minerals, Saudi Arabia Local Organizing Committee Yo-Sung Ho - Gwangju Institute of Science and Technology, South Korea Nam Kim - Chungbok National University, South Korea Jounghyun Kim - Korea University, South Korea Seokwon Yeom - Daegu University, South Korea Sungyoung Lee - Kyung Hee University, South Korea Jae-Hyeung Park - Inha University, South Korea In Kyu Moon Chosun University, South Korea Sin-Doo Lee - Seoul National University, South Korea Seung Hwan Ko Korea Advanced Institute of Science and Technology, South Korea Jaeha Ryu - Gwangju Institute of Science & Technology, South Korea Min-Chul Park - Korea Institute of Science and Technology, South Korea Conference Organizer Jihoon Lee - Kwangwoon University, Seoul, Korea III

5 CC3DMR 2016 COMMITTEES & SCIENTIFIC TEAM Host by Collaborative Conference on 3D & Materials Research Kwangwoon University, South Korea Sponsored by IV

6 Welcome to the CC3DMR 2016 It is our great pleasure to have you all for the Collaborative Conference on 3D and Materials Research 2016 (CC3DMR 2016) at the Convensia, Incheon/Seoul, South Korea during the 20 th - 24 th June On behalf of the Organizing Committees of CC3DMR 2016, we would like to express our sincere welcome to all the participants of this international meeting on diverse research fields. Especially, we are very grateful to those distinguished invited, oral and poster speakers for joining from nearly 30 countries including Austria, Brazil, Canada, China, Colombia, Finland, France, Germany, India, Ireland, Israel, Japan, Malaysia, Netherlands, Norway, Pakistan, Russia, Saudi Arabia, Singapore, Spain, Sweden, Switzerland, Taiwan, Turkey, United Kingdom, United State of America and South Korea. This international conference of CC3DMR series was first organized in 2011 and has been annually hosted by the CC3DMR and Kwangwoon University. The aim of this conference is collaboratively and internationally to discuss the worldwide state-of-the-art of 3D and Materials technologies. For this purpose, over 200 distinguished experts on 3D and materials research are invited all over the world. The CC3DMR has been already grown up to be the renowned global meeting on 3D and Materials research both in name and reality judging from the numbers of speakers and attending countries as well as the quality of the presented talks and papers. For all of us, it is an invaluable chance to share and exchange opinions and discuss future directions and strategies for further development of 3D and materials science and technology together with internationally renowned experts. We believe that this international meeting of CC3DMR 2016 will be a very precious opportunity in sharing and exchanging the recent development of 3D and material technologies as well as discussing the future trend. We are also confident that this meeting will be most rewarding and will be a good success. V

7 Welcome to the CC3DMR 2016 Lastly, we would like to extend our sincere regards to the internationally renowned invited speakers, participants of this collaborative meeting and all the related personals for preparing this momentous meeting. Especially, we would like to express our deep appreciation to Prof. Jihoon Lee of Kwangwoon University for his continuing volunteer-ship, endeavors and sacrifices for organizing this wonderful international meeting. Once again, thank you all for your supports and dedications! Prof. Gregory Salamo Conference Chair of the CC3DMR 2016 University of Arkansas, Fayetteville, AR, USA Prof. Milko van der Boom Conference Co-chair of the CC3DMR 2016 Weizmann Institute of Science, Israel VI

8 CC3DMR June 2016 Incheon/Seoul, Korea CC3DMR 2016 Conference Schedule 19 June Sunday 20 June Monday 21 June Tuesday 22 June Wednesday 23 June Thursday 24 June Friday On-site Registration, 2:00-5:00 PM (Carried on between at the registration desk) Full day oral presentations, 9.30 AM - 5:00 PM Poster Session from 5:30 PM Conference Reception from 6:00 PM - (Wine reception with buffet & live music show) Full day oral presentations, 9.30 AM - 5:00 PM Musical performance, from 7:20 PM PM (BIBAP at Tribowl, Tickets covered) Full day oral presentations, 9.30 AM - 5:00 PM Conference Banquet from 6:00PM Welcoming & congratulatory addresses Intro Session: Korean Spirit and Culture Series (Buffet with wine & live music show) Full day oral presentations, 9.30 AM - 5:00 PM All Day Tour, 08:00 AM 06:00 PM (Transportation, tickets & lunch covered) VII

9 Collaborative Conference on 3D & Materials Research (CC3DMR) June 2016 Songdo DAY 1 (Monday 20 June) Room 107 Time Page Speaker Talk Title 09:30-10:00 1 Say Chye Joachim LOO 10:00-10:30 3 Jae Woong Yoon Chair: Yingying Zong 10:30-11:00 Session Break Nanotheranostics and Nanotoxicology The Nexus of Nano & Bio Guided-mode resonance nanophotonics: Review and applications Chair: Say Chye Joachim LOO 11:00-11:30 5 Sang-Yup Lee 11:30-12:00 7 Chang-Dong Yeo Applications of Biomimetic Bolaamphiphile Molecules in Catalysis and Energy Harvesting Molecular Dynamics (MD) Modeling and Simulation to Investigate Bonding Preference of Outgassed Hydrocarbon Molecules to Lubricated and Bare Carbon Surfaces 12:30-14:00 Lunch Break Chair: Xucai Yu 14:00-14:30 9 Timur Shegai 14:30-15:00 12 Judy Wu 15:00-15:30 14 Zonghoon Lee Plasmonic nanoantennas for manipulating optics at nanoscale Controlling Interfaces in Photonic and Plasmonic Carbon Nanostructure Optoelectronics: Towards High Performance and Low Cost Atomic-scale Dynamics of Defect Formation in 2D Materials 15:30-16:00 Session Break Chair: Timur Shegai 16:00-16:30 15 Shih-Shuo Tung All-in-Focus and Depth from A Defocus Image 16:30-17:00 17 Xucai Yu Optical industry profile measurement based on laser lockin imaging 17:30-18:00 Poster Session (Ballroom in Convensia, 2F) 18:00- Night Conference Reception (Ballroom in Convensia, 2F) CC3DMR 2016 VIII

10 Collaborative Conference on 3D & Materials Research (CC3DMR) June 2016 Songdo DAY 1 (Monday 20 June) Room 108 Time Page Speaker Talk Title 09:30-10:00 18 Yongli Gao Chair: Hiroshi Fukuoka Interface Formation and Surface Degradation of Trihalide Perovskite Materials 10:00-10:30 19 Yoichi Okimoto Photonic phase control in cobalt perovskite 10:30-10:45 21 Yu-Yun Pan First-Principles Study on Electronic Structures of FAPbX3 (X = Cl, Br, I) Hybrid Perovskites 10:45-11:00 Session Break 11:00-11:30 22 Hiroshi Fukuoka 11:30-12:00 24 Serena A. Corr 12:00-12:30 26 Gabriel Luiz Cruz de Souza Chair: Yongli Gao 12:30-14:00 Lunch Break 14:00-14:30 27 Stuart H. Taylor 14:30-15:00 30 Tetsuo Tsuchiya 15:00-15:30 32 Yu-Chiang Chao Structure and Electrical Properties of Ge-substituted Rhodium and Cobalt Antimony Skutterudites Probing the structure and dynamics of nanomaterials for battery applications Probing electron scattering cross sections for molecules of technological importance Chair: Yousuke Ooyama 15:30-16:00 Session Break 16:00-16:30 33 Yousuke Ooyama 16:30-17:00 35 Tooru Tanaka Catalyst discovery using preparation by supercritical antisolvent precipitation: Georgite as a precursor for highly active copper zinc oxide catalysts Fabrication of the Flexible Oxide Films by Photo-Induced Chemical Solution Process The control of crystallinity in polymer and perovskite solar cells Chair: Yu-Chiang Chao Photovoltaic Performance of Dye-Sensitized Solar Cells Based on Diphenylamino-Carbazole Substituted BODIPY Dyes ZnTeO-based multiple band gap semiconductors for intermediate band solar cells 17:30-18:00 Poster Session (Ballroom in Convensia, 2F) 18:00- Night Conference Reception (Ballroom in Convensia, 2F) CC3DMR 2016 IX

11 Collaborative Conference on 3D & Materials Research (CC3DMR) June 2016 Songdo DAY 1 (Monday 20 June) Room 109 Time Page Speaker Talk Title Chair: Shlomo Berger 09:30-10:00 38 Young L. Kim Biogenic light trapping in natural fibers toward scalable photocatalysis 10:00-10:30 40 Xue Jiang Bottom-up design of 2D organic photocatalysts for visible-light driven hydrogen evolution 10:30-11:00 Session Break 11:00-11:30 41 Shlomo Berger 11:30-12:00 42 Yong Soo Cho Chair: Young L. Kim Formation and Characterization of Dielectric nano- Crystals for Highly Sensitive Pyroelectric Thermal Detectors Piezoelectric Energy Harvesting Performance of Nanofiber Composites 12:00-12:30 43 Andrew Grimsdale New Materials for charge storage applications 12:30-14:00 Lunch Break 14:00-14:30 44 Tetsuya Yamamoto 14:30-15:00 47 Satoshi Okuma 15:00-15:30 49 Tsofar Maniv Chair: Rolf Lortz 15:30-16:00 Session Break High-Hall-mobility transparent conductive oxide films: Key factors limiting carrier transport for wide applications Non-equilibrium Transitions in Driven Vortex Matter of Amorphous Superconducting Films Self-consistent Bogoliubov-de Gennes theory of strong type-ii superconductivity in 2D electron systems at high magnetic fields. Chair: Tetsuya Yamamoto 16:00-16:30 51 Rolf Lortz Large gap, a pseudogap and proximity effect in the Bi2Te3/Fe1+yTe interfacial superconductor 16:30-17:00 52 Masaru Aniya Evaluation of Grüneisen Parameters of Ionic Conductors 17:30-18:00 Poster Session (Ballroom in Convensia, 2F) 18:00- Night Conference Reception (Ballroom in Convensia, 2F) CC3DMR 2016 X

12 Collaborative Conference on 3D & Materials Research (CC3DMR) June 2016 Songdo DAY 1 (Monday 20 June) Room 110 Time Page Speaker Talk Title Chair: Thuat T. Trinh 09:30-10:00 53 Hiroshi Watanabe Practical Modeling of floating nanodot with no fitting parameter in Device Simulation 10:00-10:30 56 Masahiko Higuchi Energy band structures of the crystalline silicon immersed in the magnetic field 10:30-11:00 Session Break 11:00-11:30 58 Thuat T. Trinh 11:30-12:00 59 Shohei Watabe Chair: Hiroshi Watanabe The Small System Method To Compute Thermodynamic Data For 3D And 2D System Many-body theory of an interacting Bose-Einstein condensate at finite temperatures 12:00-12:30 60 Rongshan Qin 3D Visual Analyse of Materials Processing 12:30-14:00 Lunch Break Chair: Lan-Chang Liang 14:00-14:30 62 Ifat Kaplan-Ashiri SEM beyond imaging in situ SEM experiments 14:30-15:00 63 Salvador Pane i Vidal 15:00-15:30 65 Yan Jun Li 15:30-15:45 68 Quanzhen Zhang 15:45-16:00 Session Break 16:00-16:30 70 Lan-Chang Liang 16:30-17:00 71 Johann Faccelo Osma Cruz Magnetically Guided Micro- and Nanomachines Investigation of Pd nanoparticles on Al2O3/NiAl(110) under CO gas by AFM/ KPFM Systematic Control of the Size, Density and Configuration of Pt Nanostructures on Sapphire (0001) by the Variation of Deposition Amount and Dwelling Time Chair: Ifat Kaplan-Ashiri Synthesis of well-defined 3D printing and biocompatible polymers by living ring-opening polymerization Continuous stereolithographic bottom-up 3D printing by means of a liquid-liquid interface for manufacturing functionalized polymeric films 17:30-18:00 Poster Session (Ballroom in Convensia, 2F) 18:00- Night Conference Reception (Ballroom in Convensia, 2F) CC3DMR 2016 XI

13 Collaborative Conference on 3D & Materials Research (CC3DMR) June 2016 Songdo DAY 1 (Monday 20 June) Room 111 Time Page Speaker Talk Title Chair: Paz Vaqueiro 09:30-10:00 72 Eddie Cussen Solid State Lithium Conduction and Disorder in Complex Oxides 10:00-10:30 73 Hisashi Kitami Control of the ratio of incident flux of ions to neutral species onto substrates to achieve high-carrier-mobility transparent conductive oxide films deposited by a highgrowth-rate Reactive Plasma Deposition 10:30-11:00 Session Break 11:00-11:30 77 Paz Vaqueiro 11:30-12:00 79 Anthony V. Powell 12:00-12:30 82 Helmut Baumgart Chair: Eddie Cussen 12:30-14:00 Lunch Break 14:00-14:30 85 Reshef Tenne 14:30-15:00 86 Junichi Kurawaki 15:00-15:30 88 Shoko Kume Layered oxychalcogenides as promising thermoelectric materials Thermoelectric Materials for Energy Harvesting from Waste Heat Advances in Thermoelectric Materials with Improved Figure of Merit Chair: Masahiko Kondow 15:30-16:00 Session Break 16:00-16:30 90 Masahiko Kondow 16:30-17:00 92 Yasufumi Fujiwara Inorganic nanotubes and fullerene-like nanoparticles at the crossroad between materials science and nanotechnology and their applications Development of Novel Synthetic Method of Glucose- Binding Silver Nanoparticles and Biosensing Applications On-metal Framing of Organic-contact Cathode with High Proton Reduction Activity Chair: Reshef Tenne Stimulated emission from photonic crystal cavity with AlOx cladding layer Enhanced red emission from Eu ions embedded in a GaN resonant optical microcavity 17:30-18:00 Poster Session (Ballroom in Convensia, 2F) 18:00- Night Conference Reception (Ballroom in Convensia, 2F) CC3DMR 2016 XII

14 Collaborative Conference on 3D & Materials Research (CC3DMR) June 2016 Songdo DAY 2 (Tuesday 21 June) Room 107 Time Page Speaker Talk Title Chair: Nikolai Perov 09:30-10:00 96 Klaus Muller- Buschbaum Luminescent N-functionalized MOFs and Coordination Networks for Novel Sensing Applications and Lighting 10:00-10:30 99 Jwohuei Jou Good light based on candlelight OLED 10:30-11:00 Session Break Chair: Klaus Muller-Buschbaum 11:00-11: Nikolai Perov 11:30-12: Bingwu Wang 12:00-12: Masaki Nakano Ferromagnetic nanoparticles in topochemical transformations Theoretical Studies on the Slow Magnetic Relaxation of Single-Molecule Magnets PLD-fabricated Nd-Fe-B thick-film magnets deposited on Si substrates 12:30-14:00 Lunch Break Chair: Omar F. Mohammed 14:00-14: Hagay Shpaisman Directed Formation By Optical And Acoustic Forces 14:30-15: Michael F. Herman An Approximate Semiclassical Method that Uses Real Valued Trajectories for Time Dependent Tunneling Calculations 15:30-16:00 Session Break Chair: Hagay Shpaisman 16:00-16: :30-17: Omar F. Mohammed Hani E. Elsayed- Ali Mapping Carrier Dynamics on Material Surfaces in Space and Time using 4D Electron Microscopy Ultrafast electron diffraction studies of lattice dynamics of femtosecond laser-excited bismuth and antimony nanoparticles and thin films 19:20-21:00 Evening Activity (BIBAP at Tribowl) CC3DMR 2016 XIII

15 Collaborative Conference on 3D & Materials Research (CC3DMR) June 2016 Songdo DAY 2 (Tuesday 21 June) Room 108 Time Page Speaker Talk Title 09:30-10: Yonglai Lu 10:00-10: Yusheng Shi Chair: Takeo Hyodo 10:30-11:00 Session Break 11:00-11: Takeo Hyodo Carbon Nanotubes Reinforced Rubber Composites and Their Promising Application in High Performance Tires Polymer based composites for selective laser sintering additive manufacturing Chair: Yonglai Lu Development of gas sensors by utilizing well-developed porous materials 11:30-12: Yoke Leng Sim Nanoporous Biomaterials in Uremic Toxin Adsorption 12:00-12: Yingwei Zhang 12:30-14:00 Lunch Break Controllable construction of mesoscopic DNA pattern by combining precise magnetic manipulation and DNA-driven assembly Chair: Yiliang Liao 14:00-14: Gladius Lewis 14:30-15: Hideo Kaiju 15:00-15: Asif Mahmood Use of magnesium-based alloys for stents: current status and future research directions Large magnetocapacitance effect in magnetic tunnel junctions at room temperature Magnetic and photocatalytic response of Ag-doped ZnFeO nano-composites for photocatalytic degradation of reactive dyes in aqueous solution 15:30-16:00 Session Break Chair: Gladius Lewis 16:00-16: Yiliang Liao 16:30-17: Yasuya Nakayama The mechanisms of thermal engineered laser shock peening for enhanced fatigue performance Strain Mode of General Flow: Characterization and Implications for Flow Pattern Structures 19:20-21:00 Evening Activity (BIBAP at Tribowl) CC3DMR 2016 XIV

16 Collaborative Conference on 3D & Materials Research (CC3DMR) June 2016 Songdo DAY 2 (Tuesday 21 June) Room 109 Time Page Speaker Talk Title Chair: Akira Ishibashi 09:30-10: Seong Jin Koh Cold-Electron Transport at Room Temperature: Toward Ultralow Energy Consumption Electronics 10:00-10: Huizhen Wu CdTe/PbTe heterostructure: A new 2DEG system 10:30-11:00 Session Break Chair: Seong Jin Koh 11:00-11: E Rusli 11:30-12: Akira Ishibashi 12:00-12: Takefumi Kamioka Thin film Silicon Nanowire/PEDOT:PSS Hybrid Solar Cells with Surface Treatment Multi-striped Orthogonal Photon-Photocarrier- Propagation Solar Cells (MOP3SC) with Redirection Waveguide Next generation of high-efficient heterojunction crystalline silicon solar cells 12:30-14:00 Lunch Break Chair: Q. Jane Wang 14:00-14: Hong Wang 14:30-15: Fredrik Karlsson 15:00-15: Ching-Ling Hsu Analysis of Interface Thermal Stability of High-k ZrO2 on GaN and AlGaN InGaN quantum dots on GaN micropyramids for polarized photon emission Temperature-dependent morphology of annealed gold films on silicon surfaces 15:30-16:00 Session Break Chair: Hong Wang 16:00-16: Q. Jane Wang 16:30-17: Yu Yang Additive Manufacturing and Investigation of Novel Grooved Micro Heat Pipes Durable and Efficient Packing Materials for Green Subcritical Water Chromatography 19:20-21:00 Evening Activity (BIBAP at Tribowl) CC3DMR 2016 XV

17 Collaborative Conference on 3D & Materials Research (CC3DMR) June 2016 Songdo DAY 2 (Tuesday 21 June) Room 110 Time Page Speaker Talk Title Chair: Manohar Kumar 09:30-10: Katsuhiko Higuchi Pair-Density Functional Theory for Superconductors 10:00-10: Masayuki Hashisaka Fractional Quasiparticles in a Local Quantum Hall System 10:30-11:00 Session Break Chair: Masayuki Hashisaka 11:00-11: Manohar Kumar 11:30-12: Beat Braem 12:00-12: Makoto Sakurai Breakdown of quantum Hall effect in graphene: Noise studies Local Investigations in the Fractional Quantum Hall Regime using Scanning Gate Microscopy Toward quantum bit generation using single highly charged ion implantation 12:30-14:00 Lunch Break Chair: Alejandro Gomez Roca 14:00-14: Yujun Shi 14:30-15: Yasuhiro Sugawara 15:00-15: Mao Sui Growth of Crystalline Metal Carbides on the Catalyst Surface in Hot Wire Chemical Vapor Deposition Atomic-scale Imaging of Electronic Properties of the Surface by Electrostatic Force Microscopy Evolution of Pd Nanostructures on c-plane Sapphire by the Control of Annealing Temperature and Duration 15:30-16:00 Session Break Chair: Yujun Shi 16:00-16: Alejandro Gomez Roca 16:30-17: Hémadi Miryana Magneto-Plasmonic Nanostructures for Theranostic Applications Magnetic nanoparticles for drug internalization by the iron-acquisition pathway 19:20-21:00 Evening Activity (BIBAP at Tribowl) CC3DMR 2016 XVI

18 Collaborative Conference on 3D & Materials Research (CC3DMR) June 2016 Songdo DAY 2 (Tuesday 21 June) Room 111 Time Page Speaker Talk Title Chair: Hendrik Heinz 09:30-10: W.G. van der Wiel Evolution of a designless nanoparticle network into reconfigurable Boolean Logic 10:00-10: Nobuhiko Nakano On-Chip Nonvolatile Memory for Standalone System using 0.18 μm Standard CMOS Technology 10:30-11:00 Session Break 11:00-11: Hendrik Heinz Chair: W.G. van der Wiel Understanding Molecular Recognition and Assembly at Biological-Inorganic Interfaces to Engineer New Functional Materials: Catalysts, Sensors, and Biominerals 11:30-12: Phillip Choi Molecular Dynamics Study of Diffusion in Polymers 12:00-12: Kuan-Syun Wang 12:15-12: Jeongsik Yun 12:30-14:00 Lunch Break 14:00-14: Masayoshi Higuchi 14:30-15: Yasufumi Enami 15:00-15: Takeharu Haino Magnetic Two-Dimensional Nanosheets for Rapid Separation of Water Pollutants How simple are the models of Na intercalation in aqueous media? Chair: Zerihun Assefa 15:30-16:00 Session Break 16:00-16: Zerihun Assefa 16:30-17: Tomoyasu Hirai Electrochromic Devices with Metallo-Supramolecular Polymers High Speed Electro-Optic Polymer/TiO2 Vertical Slot Waveguide Modulators Development of Supramolecular Polymers based on Unique Molecular Recognition Motifs Chair: Masayoshi Higuchi The designing of coordination polymers consisting of latetransition metals and lanthanide ions for luminescence enhancement Preparation of Polymer with Perylenediimide Side Chain and Characterization of Its Nanostructure 19:20-21:00 Evening Activity (BIBAP at Tribowl) CC3DMR 2016 XVII

19 Collaborative Conference on 3D & Materials Research (CC3DMR) June 2016 Songdo DAY 3 (Wednesday 22 June) Room 107 Time Page Speaker Talk Title Chair: Yong Hyub Won 09:30-10: Osman Bakr Hybrid Perovskite Single Crystals: Properties, Growth Design, and Device Applications 10:00-10: Jhinhwan Lee Atomic scale visualization of topological dynamics of plaquette antiferromagnetic order and interfacial phonons in tetragonal FeAs layer encapsulated in perovskite layers using spin-polarized STM 10:30-11:00 Session Break Chair: Osman Bakr 11:00-11: Yong Hyub Won 11:30-12: Hiroyuki Takagi Multiview 3D Display Using Varifocal Lenticular Liquid Lens Array Three-dimensional Magneto-optic Spatial Light Modulator Composed of Artificial Magnetic Lattice 12:00-12: HuiChi Chen Three-dimensional holographic optical tweezers 12:30-14:00 Lunch Break Chair: Yo Sung Ho 14:00-14: Lambertus Hesselink 14:30-15: Samuel Choi 15:00-15: Kohei SOGA Novel 3D Differential Phase Contrast Imaging System 3D Tomographic Measurement of Interior Surface Vibrations in Thick Biological Tissues Using Multifrequency Sweepable Optical Comb Application of Rare-Earth Doped Ceramics for Transparent Imaging Devices 15:30-16:00 Session Break Chair: Lambertus Hesselink 16:00-16: Yo Sung Ho 16:30-17: Norio Tagawa Analysis of 3D Reconstruction System Using Hand-held RGB-D Camera Selection of Consecutive Two Frames for Shape from Random Camera Motions 18:00- Night Conference Banquet (Ballroom in Convensia, 2F) CC3DMR 2016 XVIII

20 Collaborative Conference on 3D & Materials Research (CC3DMR) June 2016 Songdo DAY 3 (Wednesday 22 June) Room 108 Time Page Speaker Talk Title 09:30-10: Yasushi Morita 10:00-10: Leon L. Shaw Chair: Charles H. Patterson 10:30-11:00 Session Break Molecular Spin Battery Composed of Air-stable Neutral Radicals and Graphite Enhancing the Capacitive Energy Storage of Activated Carbon through Mechanical Activation Chair: Yasushi Morita 11:00-11: Charles H. Patterson 11:30-12: Masashi Hasegawa 12:00-12: Ming-Yu Li Au at the Si(111) surface: silicene and Au nanowires probed by optical spectroscopy Ultra-High Pressure Synthesis, Stability, Physical Properties and Electronic Structure of Nitrogen-rich Transition Metal Nitrides Evolution of Configuration and Size of Self-assembled Pt Nanoparticles on Sapphire (0001) Controled with a Systematic Varation of thermal treatment 12:30-14:00 Lunch Break Chair: Jong-in Hahm 14:00-14: Akira Yamakata 14:30-15: Giwan Yoon Behavior of Photogenerated Electrons and Holes on Anatase and Rutile TiO2 Powders Piezoelectric ZnO Thin Films & Their Application for Micro Energy Harvesting Devices 15:00-15: Edgar Knobloch Soft Matter Quasicrystals in Two and Three Dimensions 15:30-16:00 Session Break Chair: Akira Yamakata 16:00-16: Jong-in Hahm 16:30-17: Liqiang Wang Fundamental Study of Nanoscale Protein-Polymer Interactions and Potential Contributions to Solid-state Protein Nanoarrays Microstructural characteristics and mechanical properties of biomedical titanium alloy during friction stir processing 18:00- Night Conference Banquet (Ballroom in Convensia, 2F) CC3DMR 2016 XIX

21 Collaborative Conference on 3D & Materials Research (CC3DMR) June 2016 Songdo DAY 3 (Wednesday 22 June) Room 109 Time Page Speaker Talk Title Chair: Kenta Arima 09:30-10: Werner Karl Schomburg Ultrasonic fabrication of microfluidic systems from thermoplastic polymers 10:00-10: Guy Makov Thermodynamic properties from ab-initio calculations Ti and other case studies 10:30-11:00 Session Break Chair: Werner Karl Schomburg 11:00-11: Kenta Arima 11:30-12: Gerhard Eder Ion Segregation in Deliquesced Droplets of Alkali Halide Nanocrystals on SiO2 Approached by both Surface Science Techniques and Electrical Characteristics On the Existence of Stable Clusters in Polymer Melts: Consequences for Nucleation under Processing Conditions 12:30-14:00 Lunch Break Chair: Gyungsu Byun 14:00-14: Minoru Sasaki 14:30-15: Juan Wu 15:00-15: Li-Hsin Chan 3D devices realized by photolithography using spray coating of photoresist 4d Imaging of Polymer Electrolyte Membrane Fuel Cell Cathodes by Scanning Transmission X-Ray Microscopy Effect of Side Chains on Photovoltaic Performance of Two-Dimensional Conjugated Copolymers 15:30-16:00 Session Break Chair: Minoru Sasaki 16:00-16: Gyungsu Byun Energy-efficient I/O Interface and Clock Distribution for 3D-stacked Mobile Devices 16:30-17: Kyeong-Sik Min Memristor crossbars for pattern recognition 18:00- Night Conference Banquet (Ballroom in Convensia, 2F) CC3DMR 2016 XX

22 Collaborative Conference on 3D & Materials Research (CC3DMR) June 2016 Songdo DAY 3 (Wednesday 22 June) Room 110 Time Page Speaker Talk Title 09:30-10: Aliaksandr S. Bandarenka 10:00-10: Ghazanfar Abbas Chair: Louisa Meshi 10:30-11:00 Session Break 11:00-11: Louisa Meshi 11:30-12: Yuanfei Han 12:00-12: Yingying Zong Design of improved electrocatalysts for energy provision Electrochemical Study of Nano-composite Anode for Energy Conversion Applications (Solid Oxide Fuel Cell) Chair: Guy Makov 12:30-14:00 Lunch Break 14:00-14: Masao Nagase 14:30-15: Kibog Park Structure determination of aluminides applying state of the art electron crystallography methods Fabrication and characterization of laminated titanium matrix composite Research on the Elastic-Plastic Deformation Mechanism of Ti-H System Chair: Alok Shukla Single-crystal graphene growth on SiC by infrared rapid thermal annealing Epitaxial Graphene Grown on Hexagonal SiC at Reduced Temperature with Mo-Plate Capping: Crystallinity and Carrier Transport 15:00-15: Monica Craciun High quality graphene for advanced applications 15:30-15: Zong Han Lu 15:45-16:00 Session Break 16:00-16: Iddo Amit 16:15-16: Po Chen Wu 16:30-17: Alok Shukla Graphene oxidation fabricated by low damage atmospheric pressure plasma treatments Chair: Masao Nagase Controlling and Probing the Band-Gap of Graphene and Graphene-Related Materials Edges of Graphene Nanoribbons Healed by Low Damage Plasma Treatment for Future Nanoelectronic Devices Theory of Electronic, Optical, and Magnetic Properties of Graphene Nanodisks 18:00- Night Conference Banquet (Ballroom in Convensia, 2F) CC3DMR 2016 XXI

23 Collaborative Conference on 3D & Materials Research (CC3DMR) June 2016 Songdo DAY 3 (Wednesday 22 June) Room 111 Time Page Speaker Talk Title 09:30-10: Kuei-Fang Hsu 10:00-10: Fan Weijun Chair: Rebecca Cheung 10:30-11:00 Session Break New Nonlinear Optical Materials of Metal Chalcogenides with Promising SHG Signals Electrical and optical properties of GaAsNBi/GaAs quantum wells Chair: Kuei-Fang Hsu 11:00-11: Rebecca Cheung Micro-resonator devices and systems 11:30-12: Dao Hua Zhang Split ring resonators from Infrared to UV range 12:00-12: Toshihiro Okamoto Split-ring resonator metamaterial fabricated by nanosphere lithography 12:30-14:00 Lunch Break Chair: Huaming Li 14:00-14: Imane Khalil 14:30-15: Qi-Huo Wei 15:00-15: Qing-Hua Xu Uncertainty Quantification using Polynomial Chaos Expansion in Numerical Simulations of Spent Nuclear Fuel Assemblies Plasmonic Photopatterning of Topological Defects in Liquid Crystals as Templates for Directed Colloidal Assembly Plasmon Enhanced Two-photon Photoluminescence of Metal nanoparticles 15:30-16:00 Session Break Chair: Qi-Huo Wei 16:00-16: Huaming Li 16:30-17: Song-You Hong Thermodynamic properties by Equation of state of liquid sodium under pressure A new atmospheric model with a cubed-sphere grid for numerical weather prediction 18:00- Night Conference Banquet (Ballroom in Convensia, 2F) CC3DMR 2016 XXII

24 Collaborative Conference on 3D & Materials Research (CC3DMR) June 2016 Songdo DAY 4 (Thursday 23 June) Room 108 Time Page Speaker Talk Title Chair: Choon Young Lee 09:30-10: Kensuke Naka Element-Block Polymers Based on T8-caged Silsesquioxanes 10:00-10: Yun Yan Electrostatic self-assembly: Possibilities to retain the porphyrin monomer properties in aggregates 10:30-11:00 Session Break Chair: Kensuke Naka 11:00-11: Choon Young Lee Dendritic macromolecular antioxidants 11:30-12: Yongchang Han 12:00-12: Fatang Liu Molecular photoassociation and photodissociation dynamics by femtosecond lasers Robust Superhydrophobic Sponge with Excellent Anti- Icing Properties 12:15-12: Chen Ning Facile Fabrication of ultralight foams 12:30-14:00 Lunch Break 14:00-14: Xiangyu Quan 14:30-15: Yoonchan Jeong 15:00-15: Masaharu Oshima 15:30-15: Shao-Chieh Weng Chair: Masaharu Oshima 15:45-16:00 Session Break Application of a dual-excitation multi-modal digital holographic microscope to biological imaging On the Coherence Characteristics of Fiber-Based Noise- Like Pulsed Laser Sources Soft X-ray Resonant, Nano and Operando Spectroscopy for Lithium Ion Batteries Synthesis of MnOx/reduced graphene oxide nanocomposite as a negative electrode for lithium-ion battery Chair: Yoonchan Jeong 16:00-16: Pei Wenli 16:30-17: Puran Pandey Synthesis of one dimensional FePt nanomaterials under high magnetic field Fabrication and evolution of various configuration and size of Pt nanostructures on GaN (0001): Voids, Hillocks, Nanoparticles, Nanoclusters, Porous Pt Network and Porous GaN CC3DMR 2016 XXIII

25 Collaborative Conference on 3D & Materials Research (CC3DMR) June 2016 Songdo DAY 4 (Thursday 23 June) Room 109 Time Page Speaker Talk Title 09:30-10: Bing Yan 10:00-10: Wenzhi Li Chair: Kenneth K.W. Kwan 10:30-11:00 Session Break A Systematic Exploration of Nano-Bio Interactions: the Story of Carbon Nanotubes Electrochemical Lithiation of Individual Cobalt Sulfide Nanowire-filled Carbon Nanotube Chair: Bing Yan 11:00-11: Kenneth K.W. Kwan The Electrochemical Actuation of Nanoporous Nickel 11:30-11: Chin-Fung Su 12:00-12: Chia-Wei Chang Electrochemical Surface-Enhanced Raman Spectroscopy of detecting Endocrine disruptor chemicals Exfoliation of MoS2 via Sonication and Examination of MoS2 Nanosheets 12:30-14:00 Lunch Break Chair: Niklas Hedin 14:00-14: Alexander Brown New Phosphorescent Materials: Insights from Computational Chemistry 14:30-15: Charles Jaffe Transition States: The Geometry of Reaction Dynamics 15:00-15: Masatomo Yashima Precise Structure Analysis of Materials for Energy and Environment 15:30-16:00 Session Break Chair: Alexander Brown 16:00-16: Niklas Hedin 16:30-16: Qin Yan Microporous polymers for CO2 capture and heterogeneous catalysis Preparation of UV cured long fiber reinforced polymer films and Study on its laminate properties CC3DMR 2016 XXIV

26 Collaborative Conference on 3D & Materials Research (CC3DMR) June 2016 Songdo DAY 4 (Thursday 23 June) Room 110 Time Page Speaker Talk Title 09:30-10: Hiroshi Okamoto 10:00-10: Andreas Fissel Chair: Toshihiro Nakamura 10:30-11:00 Session Break Self-organized nanostructure formation of III-V and grope IV semiconductors by using bismuth Si twinning superlattices on atomically flat mesas: Epitaxial growth and electrical characterization Chair: Hiroshi Okamoto 11:00-11: Toshihiro Nakamura 11:30-12: Kazuaki Akaiwa 12:00-12: Masatomo Yashima Impedance spectroscopic study on metal-manganite interfaces exhibiting resistance switching Conductivity Control of Sn-Doped Coruncum-Structured Ga2O3 Films on Sapphire Novel Oxide-Ion Conductors based on a New Structure Family NdBaInO4 12:30-14:00 Lunch Break Chair: Fei Zeng 14:00-14: Koichi Yamaguchi 14:30-14: Yu-Shan Su Fabrication of Ultrahigh-Density GaAsSb/InAsSb Quantum Dots and Their Photovoltaic Applications Comparison of YPO4: Tb 3+, Yb 3+ and YVO4: Tb 3+, Yb 3+ Phosphors as Quantum Cutting by Cooperative Energy Transfer from Visible Light to Near Infrared emission 14:45-15: Yuan-Liang Zhong Triangular MoS2 Transistor 15:00-15: Pooi See Lee Flexible and Stretchable Conductors for Electrochemical Energy Conversion Devices 15:30-16:00 Session Break Chair: Koichi Yamaguchi 16:00-16: Fei Zeng Ion dependent frequency filtering and learning of semiconducting polymer/electrolyte composite 16:30-17:00 4 Yilong HAN Melting and Premelting of Colloidal Crystals CC3DMR 2016 XXV

27 Collaborative Conference on 3D & Materials Research (CC3DMR) June 2016 Songdo DAY 4 (Thursday 23 June) Room 111 Time Page Speaker Talk Title Chair: Masato Sone 09:30-10: Norio Kawakami Many-body proximity effects in f-electron superlattices 10:00-10: Philip Pong Spintronic Sensors, Internet of Things, and Smart Living 10:30-11:00 Session Break Chair: Norio Kawakami 11:00-11: Masato Sone 11:30-12: ZhiJun Liu Nanoscale Wiring by Cu Electrodeposition in Supercritical Carbon Dioxide Emulsified Electrolyte toward 3D Integrated Circuits Composite Right/Left-Handed Transmission-line Metamaterials in the Mid-IR Region 12:00-12: Sharif Iqbal Mitu Sheikh Novel Magnetically Tunable Microstrip Antenna 12:15-14:00 Lunch Break Chair: Katharine Moore Tibbetts 14:00-14: Katharine Moore Tibbetts Controlling the size and shape of uncapped Au nanostructures with femtosecond laser-assisted synthesis 14:30-15: Hong Li 15:00-15: Sundar Kunwar 15:15-15: Changjun Han Void shrinking and interfacial grain boundary migration in the diffusion bonding of 1Cr11Ni2W2MoV steel Configuration, size and density evolution of Pd nanostructures on sapphire (0001) by the control of deposition amount at various annealing temperature Preparation and characterization of pure titanium/hydroxyapatite nanocomposties manufactured via selective laser melting CC3DMR 2016 XXVI

28 (Room 107) 20 June 2016, 09:30-10:00 AM Nanotheranostics and Nanotoxicology The Nexus of Nano & Bio Say Chye Joachim LOO 1,2 1 School of Materials Science and Engineering, Nanyang Technological University, Singapore 2 Singapore Centre for Environmental Life Sciences Engineering, Nanyang Technological University, Singapore Abstract Nanotechnology has found its presence in many industries and applications, and one such promising application is in the biomedical arena. It has been exploited for the development of nanotheranostics, for drug delivery [1] and bioimaging purposes [2]. For example, drug delivery in the form of nanomedicine utilizes nano-sized particles to transport and release pharmaceutical compound into the body, to achieve the most desirable therapeutic outcome and in the safest possible manner. In this presentation, we will focus on how nanotechnology can be applied for nanotheranostics, i.e. drug delivery and bioimaging. The scope will be on the use of bottom-up approaches to develop various types of particles, and how these can be modified for targeted, controlled and sustained release of drugs in orthopedic [3], geriatric [4], and oncologic [5] applications. We will also review how multi-layered and hollow particles are currently developed to deliver multiple drugs and bioimaging probes [6] (Figure 1). At the same time, this presentation would also review the toxicological responses of some nanomaterial candidates, and how this would translate to developing safer nano-materials for biomedical applications (Figure 2). Fig 1. Ultrasmall nanocrystals with dual-modal bioimaging capabilities. [6] 1

29 Fig 2. Studying the cytotoxicity of ZnO nanoparticles and through the knowledge design safer nanoparticles. [7] Referernces 1. S.J. Xiong, X.X. Zhao, B.C. Heng, K.W. Ng, S.C.J. Loo, Biotechnology Journal 6, 501 (2011). 2. Y. Zhou, W.B. Pei, X. Hu, W.Q. Chen, J.S. Wu, C. Yao, L. Huang, H. Zhang, W. Huang, S.C.J. Loo, Q.C. Zhang, Biomaterials 54, 34 (2015). 3. K. Bastari, M. Arshath, Z.H.M. Ng, J.H. Chia, Z.X.D. Yow, B. Sana, M.F.C. Tan, S. Lim, S.C.J. Loo. Journal of Materials Science: Materials in Medicine 25, 747 (2014). 4. P.X. Wee, W.L. Lee, S.C.J. Loo. Journal of Materials Chemistry B 1, 1090 (2013). 5. W.L. Lee, W.M. Guo, V. Ho, A. Saha, H.C. Chong, N.S. Tan, E.Y. Tan, S.C.J. Loo. Acta Biomaterialia 27, 53 (2015). 6. G.K. Das, Y. Zhang, L. D Silva, P. Padmanabhan, B.C. Heng, S.C.J. Loo, S.T. Selvan, K.K. Bhakoo, T.T.Y. Tan. Chemistry of Materials 23, 2439 (2011). 7. K.W. Ng, P.K.S. Khoo, B.C. Heng, M.I. Setyawati, E.C. Tan, X.X. Zhao, S.J. Xiong, W.R. Fang, D.T. Leong, S.C.J. Loo. Biomaterials 32, 8218 (2011). 2

30 (Room 107) 20 June 2016, 10:00-10:30 AM Guided-mode resonance nanophotonics: Review and applications Jae Woong Yoon 1 and Robert Magnusson 2 1 Department of Physics, Hanyang University, Seoul , Korea 2 Department of Electrical Engineering, University of Texas at Arlington, Box 19016, Arlington, Texas 76019, USA Abstract We review nanophotonic device technology grounded in fundamental electromagnetic resonance effects in subwavelength or near-wavelength periodic thin films [1,2]. We present the physics behind resonance device operation, illustrate their design with rigorous methods, discuss fabrication processes, and present results of physical and spectral characterization. We indicate the application potential of this field, discuss some past device examples, and provide new and emerging aspects. In particular, we present new wideband resonant reflectors designed with gratings in which the grating ridges are matched to an identical material thereby eliminating local reflections and phase changes [3]. A single-layer reflector thus fashioned achieves a record 700-nm bandwidth at 99% reflectance. Resonance elements functioning as simultaneous spectral and focus-free spatial filters are introduced and substantiated with computed and experimental results that are in excellent agreement [4]. Single-layer bandpass filters [5,6] are presented and compared to their classic multilayer counterparts. An example bandpass filter with narrow transmission band made with a single periodic layer compares in functionality to a classic Bragg stack with ~30 layers. New concepts for unpolarized reflectors with wide bandwidths are demonstrated experimentally [7]. Other applications including laser mirrors, biosensors, solar-cell absorption enhancement, tunable filters, narrowband nanoelectromechanical display pixels, nonlinear conversion, surface-enhanced Raman spectroscopy, slow-light control, leaky-mode nanoplasmonics, resonant Rayleigh reflectors, etc. have been suggested in the past. The compact nature and high-efficiency operation of this device class renders attendant technology particularly interesting for terrestrial as well as space applications where minimal, robust, lightweight, and integration-friendly devices are desired [8]. The guided-mode resonance concept applies in all spectral regions, from the visible band to the microwave domain, with available low-loss materials. Referernces 1. Y. Ding and R. Magnusson, Opt. Express, 12, 5661 (2004). 2. J. W. Yoon, and R. Magnusson, Opt. Express 21, (2013). 3. R. Magnusson, Opt. Lett., 39, 4337 (2014). 4. M. Niraula, J. W. Yoon, and R. Magnusson, Opt. Express 23, (2015). 5. M. Niraula, J. W. Yoon, and R. Magnusson, Opt. Express 22, (2014) 6. M. Niraula, J. W. Yoon, and R. Magnusson, Opt. Lett. 40, 5062 (2015). 7. M. Niraula and R. Magnusson, arxiv: (2016). 8. J. W. Yoon, K. J. Lee, and R. Magnusson, Opt. Express, 23, (2015). 3

31 (Room 107) 20 June 2016, 11:00-11:30 AM Melting and Premelting of Colloidal Crystals Yilong Han Physics Department, Hong Kong University of Science and Technology, Hong Kong, China We experimentally studied the melting behaviors of superheated colloidal crystals composed of diameter tunable microgel spheres by video microscopy with single-particle dynamics [1,2]. The directly visualized nucleation precursors and homogeneous nucleation kinetics deviate from the classical nucleation theory as the degree of superheating increases up to the superheat limit. In the second part, we compared the surface premelting behaviors of monolayer and multilayer colloidal crystals composed of tunable attractive particles [3]. The abnormal blocked premelting in monolayer crystals is triggered by a bulk solid-solid transition and terminated by a mechanical-instability-induced bulk melting. These experiments provide the first visualization of homogenous melting and surface premelting at the single-particle level. Fig 1. Bulk melting of the colloidal crystal. Fig.2 Surface premelting of the colloidal crystal. Referernces 1. Ziren Wang, Feng Wang, Yi Peng, Zhongyu Zheng, and Yilong Han, Science 338, 87 (2012) 2. Ziren Wang, Feng Wang, Yi Peng, and Yilong Han, Nature Communications, 6, 6942 (2015) 3. Bo Li, Feng Wang, Di Zhou, Yi Peng, Ran Ni and Yilong Han, Nature, accepted (2016) /nature

32 (Room 107) 20 June 2016, 11:30-12:00 AM Applications of Biomimetic Bolaamphiphile Molecules in Catalysis and Energy Harvesting Min-Chul Kim, Jinyoung Kwak and Sang-Yup Lee Department of Chemical and Biomolecular Engineering, Yonsei University,Seoul, Korea Abstract Complex suprastructures in nanometer scale can be easily prepared through the self-assembly of amphiphilic molecules. A variety of micellar structures have been developed and used as templates for the fabrication of functional materials using the surfactant self-assemblies. However, the self-assembly of the surfactants has inherent disadvantage of mechanical instability under dry condition because the micellar structure is a thermodynamically stable structure and is sensitive to the presence of water. This mechanical instability can be overcome by using bolaamphiphilic molecule. Bolaamphiphilic molecule is an amphiphilic molecule that has two hydrophilic groups at both ends of central hydrophobic moiety [1]. It has a symmetric structure such that more complicate suprastructure can be created through the self-assembly process. Furthermore, mechanical strength can be endowed by introducing proper hydrophilic moieties. Recently, amino acid or short peptide have been applied as hydrophilic end groups for the creation of peptidic bolaamphiphilic molecules [1,2]. These peptidic bolaamphiphile selfassemblies had a lot of advantages compared to general surfactant assemblies; first, the mechanical strength increased remarkably because of the hydrogen bonds between peptide groups. The hydrogen bond between carbonyl and primary amine enhanced the mechanical strength of self-assembly notably high. Thus, the self-assembled structures of these peptidic bolaamphiphilic molecules can be utilized for engineering purposes without destroyment during handling. Second, the biochemical functional moiety of the peptidic bolaamphiphilie can be utilized to create a biomimetic substance. Extraordinary biochemical functionality can be expressed when the peptides are densely packed through the self-assembly process. Because of these peptidic moiety, most of the peptidic bolaamphiphile self-assembly displayed biocompatibility with low toxicity. In this presentation, applications of peptidic bolaamphiphile self-assemblies for the development of enzyme-mimetic catalyst and light-harvesting system were demonstrated exploiting such advantages of peptidic bolaamphiphilic molecules. A carbonic anhydrasemimetic catalyst was constructed using histidine-associated bolaamphiphile. This histidyl bolaamphiphilic molecules self-assembled and created triple histidine imidazole complexes and then cofactor of Zn ion was coordinated with them to generate catalytic active sites [3,4]. The histidyl bolaamphiphile could be applied further for the creation of proxidase-like catalyst through the association of other transition metal cofactor [5]. Another peptidic bolaamphiphilic molecule of tyrosyl bolaamphiphile was applied for the development of a light-harvesting system. From our previous study, the self-assembly of tyrosyl bolaamphiphile has an antenna effect enahncing light absorption and transferring the absorbed energy to the neighboring 5

33 substance [6,7]. This light-absorbing effect is mainly induced by the phenyl group of tyrosine. Exploiting this light-absorbing property the light-harvesting system was constructed. The absorbed light was transferred to a photosensitizer compound releasing an electron. The electron was transferred further to an electron mediator, and moved to other electron-absorbing substance. The amount of absorbed light energy was proportional to the amount of tyrosyl bolaamphiphile to convert more electron accepting compounds. These engineering applications demonstrated a novel usage of the peptidic bolaamphiphilie self-assemblies exploiting the surface-exposed biochemical functional groups. The outstanding stability and biochemical activity from the peptides would contribute to developments of biomedicine, sensors, and other functional hybrid materials in future. Fig 1. Illustration on the applications of peptidic bolaamphiphiles Referernces 1. J.-H. Fuhrhop and T. Wang, Chem. Rev (2004). 2. T. Shimizu, H. Minamikawa, M. Kogiso, M. Aoyagi, N. Kameta, W. Ding, and M. Masuda, Polym. J (2014). 3. M.-C. Kim and S.-Y. Lee, Chem. Eur. J (2014). 4. M.-C. Kim and S.-Y. Lee, ChemCatChem, (2015). 5. M.-C. Kim and S.-Y. Lee, Nanoscale, (2015). 6. J. Kwak, O. Choi, E. Sim, and S.-Y. Lee, Analyst, (2015). 7. J. Kwak and S.-Y. Lee, Langmuir, (2013). 6

34 (Room 107) 20 June 2016, 12:00-12:30 PM Molecular Dynamics (MD) Modeling and Simulation to Investigate Bonding Preference of Outgassed Hydrocarbon Molecules to Lubricated and Bare Carbon Surfaces Jingan Song, Chang-Dong Yeo Department of Mechanical Engineering, Texas Tech University, Lubbock, Texas, USA Abstract Outgassing is of critical concern for any electronic devices under high-vacuum or hightemperature environments such as space products, hard disk drive (HDD), medical systems and equipment [1 3]. In this study, we investigated the bonding mechanism and preference of outgassed hydrocarbon molecules to lubricated and bare carbon surfaces using molecular dynamics (MD) modeling and simulation. The lubricated surface was made of Z-Tetraol (composed of bi-functional endgroups and backbone) on top of diamond-like carbon (DLC) film, while hydrocarbon was modeled using alkane (C 6H 14). To examine the temperature effects on the bonding process, hydrocarbon molecules were approached and bonded to the lubricated surface at three different temperature conditions (i.e., 293K, 373K, and 473K). Alkane T = 293K DLC (a) Z-Tetraol (b) Figure 1(a) shows the initial structure of hydrocarbon chains, Z-Tetrao lubricants, and DLC film. The hycrocarbons were initially located above the partially lubricated disk surface with the same distance so as to avoid the distance effects on the following bonding process. Then, the equilibration (or energy minimization) was carried out at the three different temperatures. From the simulation results, it was observed that the hydrocarbon molecules were more likely moving and agglomerated around the backbone materials of the Z-Tetraol lubricants. Compared to the bonding to the functional endgroups of Z-Tetraol and the DLC surface, hydrocarbon molecules showed higher bonding preference to the backbone materials of Z- Tetraol. Based on the pair potential analysis, it was found that the fluorine atoms in the backbone of Z-Tetraol lubricants have higher attractive interactions with the carbon atoms of the hydrocarbons, which could lead to their stronger bonding. Lastly, the strong bonding preference of hydrocarbon to the backbone is more facilitated at higher temperature condition. 7

35 Referernces 1. J. H. Smith, IDEMA Tribology Symposium, 79 (1996). 2. E. Grossman and I. Gouzman, Nuclear Instruments and Methods in Physics Research B 208, 48 (2003). 3. I. Pollentier, Journal of Photopolymer Science and Technology 23, 605 (2010). 8

36 (Room 107) 20 June 2016, 14:00-14:30 PM Plasmonic nanoantennas for manipulating optics at nanoscale Timur Shegai 1, Gülis Zengin 1, Martin Wersäll 1, Tomasz Antosiewicz 1,2 and Mikael Käll 1 1 Department of Physics, Chalmers University of Technology, Göteborg, Sweden 2 Centre for New Technologies, University of Warsaw, Warsaw, Poland Abstract We discuss several examples of coupled plasmonic nanostructures that are able to perform useful functions such as directing and spectral shaping of light. These abilities are governed by interactions between nanostructural elements. The first class of interactions that will be considered is a far-field type of interaction, specifically designed here to result in highly directional emission. We show several examples of such kind of behavior in materially asymmetric Ag-Au and Pd-Au dimers as well as asymmetric Au-Au pairs and its applications for color-routing and various kinds of sensing (Fig. 1a-c). The second class of interactions that will be considered is a near-field type of interaction, in this case between plasmons and excitons. Here, we report experimental observation of exciton-induced transparency on individual silver nanorods covered by J-aggregates (Fig. 2). In the first part of the talk, we will discuss plasmonic interactions leading to directional emission. A pair of detuned dipolar emitters positioned at a proper distance with respect to each other is well-known to generate directional emission pattern. To detune plasmonic resonances in such nanostructure pairs one could either vary sizes and shapes of the objects (see e.g. Fig. 1c) or, alternatively, break the compositional symmetry of the dimer (Fig. 1a, b). Using these simple and compact antenna designs, we have recently demonstrated directional color-routing in bimetallic Ag-Au nanoantennas and utilized similar arguments for single-wavelength and selfreferenced hydrogen sensing in bimetallic Pd-Au dimers [1]. In the case of the color-router, we demonstrate spatial sorting of normally incident white light in accordance with its color (Fig. 1a). We also show that the effect of color-routing is polarization- and angle-dependent and that routing was only possible in heterometallic, but not in homometallic dimers. We have further utilized such material asymmetry concept for hydrogen sensing in the surrounding gas atmosphere by bimetallic Pd-Au dimers (Fig. 1b). Fig. 1. (a) Ag-Au subwavelength color router nanoantenna. Inset: SEM image of Au-Ag dimer (scale bar: 200nm), and experimental color-filtered 450nm and 700nm radiation patters 9

37 [1]. (b) Pd-Au single-wavelength self-referenced hydrogen sensor [2]. (c) asymmetric Au-Au dimers for refractive index based biosensing [3]. In the second part of the talk, we will discuss interaction between excitons and plasmons for the case of individual plasmonic nanoparticles interacting with excitons in organic dyes and their J-aggregates [4-7]. Several types of plasmonic nanoantennas have been studied. For the case of silver nanorods (Fig. 2a) strong suppression of scattering at the J-aggregate absorption line has been observed, implying strong plasmon-exciton interactions. Upon photodegradation of chromophores under laser illumination, a recovery to a single peak plasmon resonance of a nanorod occurred. We studied these hybrid systems as a function of geometrical parameters of the nanorods and found that for smaller rods the interaction was approaching the strong coupling limit due to efficient suppression of radiative damping. Fig. 2. (a) Single silver nanorod strongly interacting with a J-aggregate before and after photodegradation of the molecules [4]. (b) Theoretically studied plasmon-exciton interaction in core-shell geometry. In the limit of high oscillator strength a 3-peaked spectrum emerges [5]. (c) Single silver nanoprism gives rise to Rabi splitting of 300 mev at room temperature [6]. These findings have been further confirmed by numerical simulations, which showed emergence of transparency dips not only in scattering but also in absorption and extinction of a single nanoparticle [4, 5]. Extensive simulations using Mie theory, FDTD and analytical covered spheroid model have revealed that (i) spectral dips in scattering spectra and mode anticrossing cannot be used as undisputable argument of strong coupling, but rather it should be dips and anti-crossing in absorption and (ii) in the limit of high oscillator strength 3-peaked spectra emerge as a result of the core-shell structure resonating as a whole (Fig. 2b). We have further reduced the nanoparticle volume and thus suppressed radiative losses by using silver nanoprisms (Fig. 2c). In this study we have unambiguously shown that individual nanoparticle plasmons can reach the strong coupling limit with about excitons in molecular J-aggregates at room temperature [6]. Moreover, we have discussed the possibility to lower the number of excitons down to truly quantum regime. These findings open up prospects for room temperature quantum optics research and applications. Referernces 1. Shegai, T., et al., Nature Comm., 2, 481, (2011). 2. Shegai, T., et al., Nano Lett., 12, , (2012). 3. Wersäll, M., et al., J. Phys. Chem. C, 118, , (2014). 4. Zengin, G., et al., Sci. Rep., 3, 3074, (2013). 10

38 5. Antosiewicz, T.J., S.P. Apell, and T. Shegai, ACS Photonics, 1, , (2014). 6. Zengin, G., et al., Phys. Rev. Lett., 114, , (2015). 7. Zengin, G., et al., J. Phys. Chem. C, DOI: /acs.jpcc.6b00219, (2016). 11

39 (Room 107) 20 June 2016, 14:30-15:00 PM Controlling Interfaces in Photonic and Plasmonic Carbon Nanostructure Optoelectronics: Towards High Performance and Low Cost Judy Wu 1, Youpin Gong 1, Chunrui Ma 1, Qingfeng Liu 1, Rongtao Lu 1, Susobhan Das 2, Ron Hu 2, Ti Wang 1 and Wai-lun Chan 1 1 Deparment of Physics and Astronomy, University of Kansas, Lawrence, KS 66045, USA 2 Deparment of Electrical Engineering, University of Kansas, Lawrence, KS 66045, USA Abstract Photonic and plasmonic graphene and carbon nanotube (CNT) nanohybrid structures provide a fascinating platform to exploration of new photonic and optoelectronic devices that take advantages of the superior light-solid interaction and charge mobility. The interfaces in these nanohybrids play a critical role in controlling the optoelectronic process including photon absorption, exciton dissociation, charge transfer and transport. In this talk, we investigate the role of interfaces in examplery nanohybrids based on carbon nanostructures, which are designed for applications in energy and sensors. Several examples of nanohybrids have been studied including: 1) CNT/P3HT and CNT/biomolecule heterojunctions; 2) photonic ZnO QDs/graphene and GaSe-nanosheet/graphene; and 3) plasmonic Ag and Au nanoparticle/graphene nanohybrids. We show controlling the interfaces in these photonic and plasmonic nanohybrids is the key to high-performance optoelectronics, which enables many low-cost, flexible device applications in photovoltaics, photodetectors, bio/chemical sensors. Acknowledgements The authors acknowledge support in part by NASA contract NNX13AD42A, ARO contract Nos. W911NF , and W911NF , and NSF contracts Nos. NSF-DMR , NSF-DMR , and NSF-DMR Referernces 1. R.T. Lu, Jianwei Liu, Hongfu Luo, Viktor Chikan and Judy Z. Wu, Sci. Rep. 6, (2016) 2. Chunrui Ma, Youpin Gong, Rongtao Lu, Allan Elliot, Melisa Xin, Emery Brown, Beihai Ma, Jun Li and Judy Wu, Nanoscale 7, (2015). (cover article) 3. Qingfeng Liu, Youpin Gong, Ti Wang, Wai-lun Chan, Judy Wu, Carbon 96, 203 (2015). 4. Judy Wu, SPIE Nanoscience+Engineering 95530Z, Low-dimensional Materials Devices, 95530Z-9, (2015). 5. Youpin Gong, Qingfeng Liu, Jamie Samantha Wilt, and Judy Wu, Sci. Rep. 5 (2015). doi: /srep S. Das, A. Salandrino, J. Wu, and R. Hui, Optics Letters 40, No. 7, (2015) 7. F. Xu, S. Das, Y. Gong, Q. Liu, H.-C. Chien, H.-Y. Chiu, J. Wu, and R. Hui, Applied Physics Letters 106, (2015). 8. Guowei Xu, Rongtao Lu, Jianwei Liu, Hsin-Ying Chiu and Judy Wu, Advanced Optical Materials 2, 729, (2014). 12

40 9. Rongtao Lu, Caleb Christianson, and Judy Wu, ACS Applied Materials and Interfaces 5, (2013). 10. Jianwei Liu, Rongtao Lu, Guowei Xu, Judy Wu, Prem Thapa, David Moore, Advanced Functional Materials 23, 4941 (2013) 11. Rongtao Lu, Caleb Christianson, Shenqiang Ren, and Judy Wu, Nano Letters 12, 6244 (2012). 12. Guowei Xu, Jianwei Liu, Qian Wang, Ronqing Hui, Zhijun Chen, Victor A. Maroni, Judy Z. Wu, Advanced Materials 24, OP 71-76, (2012). 13

41 (Room 107) 20 June 2016, 15:00-15:30 PM Atomic-scale Dynamics of Defect Formation in 2D Materials Zonghoon Lee 1,2 1 School of Materials Science and Engineering, Ulsan National Institute of Science and Engineering (UNIST), Ulsan, S. Korea 2 Center for Multidimensional Carbon Materials, Institute for Basic Science (IBS), Ulsan, S. Korea Abstract The unique properties of 2D materials significantly rely on the atomic structure and defects. Thus defect study at atomic scale is crucial for in-depth understanding of 2D materials and provides insights into its future applications. Using aberration-corrected transmission electron microscopes, atomic resolution imaging of individual atoms has been achieved even at a low kv. Ongoing optimization of aberration correction improves the spatial resolution better than angstrom and moreover boosts the contrast of light atoms. I present the recent progress of the study on the atomic structure and defects of monolayer and multilayer graphene, hbn and MoS 2. Furthermore, the dynamic defect formation mechanisms of graphene, hexagonal boron nitride and MoS 2 are discussed at atomic scale. [1-5] Referernces 1. G.H. Ryu, H.J. Park, J. Ryou, J. Park, J. Lee, G. Kim, H.S. Shin, C.W. Bielawski, R.S. Ruoff, S. Hong and Z. Lee, Nanoscale, 7, (2015). 2. J.H. Kim, K. Kim and Z. Lee, Scientific Reports, 5, (2015). 3. J.M. Yuk, H.Y. Jeong, N.Y. Kim, H.J. Park, G. Kim, H.S. Shin, R.S. Ruoff, J.Y. Lee and Z. Lee, Carbon, 80, , (2014). 4. J.G. Song, G.H. Ryu, S.H. Hwang, S. Sim, C.W. Lee, T. Choi, H. Jung, Y. Kim, Z. Lee, J.M. Myoung, C. Dussarrat, C. Lansalot-Matras, J. Park, H. Choi and H. Kim, Nature Communications, 6:7817 (2015). 5. H.J. Park, G.H. Ryu and Z. Lee, Applied Microscopy, 45(3), (2015). 14

42 (Room 107) 20 June 2016, 16:00-16:30 PM All-in-Focus and Depth from A Defocus Image Shih-Shuo Tung, and Wen-Liang Hwang Institute of Information Science, Academia Sinica, Taiwan Abstract In the current work, we have proposed a novel blurring and deblurring approach for the depthfrom-defocus (DfD) problem. The approach involves application of a sequence of blurring and deblurring on a point to determine the depth of the point. Compared to previously reported approaches, the novelty of our proposed approach is that it does not assume the scene property to resolve the ambiguity in DfD approach. Thus, our method can obtain better depth discriminations of complex images whose depths are more than two layers: foreground and background. The depth of an edged and textured point is estimated via a multiscale approach and that in a smooth region is obtained by propagation of the estimated depths in other area. Since applications involving depth map manipulation can be achieved by first obtaining all-infocus images through a deblurring operation and then blurring the all-in-focus images, we have presented methods to derive all-in-focus images from our depth maps. To overcome the instability of a deblurring operation and preserve the sharpness in an all-in-focus image at the same time, we proposed methods to update the ourliers, whose depths were over-estimated, and compensate any depth estimation errors in the deblurring process. Figure 1(a) was the image captured from a ramp of brick wall. As the camera was focused on the leftmost part of the image, the blurriness of the brick wall progressively increased from the left part of the image to the right. The depth maps derived by our method, Zhang and Cham s method [1], and Bae and Durand s method [2] are shown in Figures 1(b), (c), and (d), respectively. Our depth map had the largest depth extension and showed a continuous gradient of depth variation from the left to the right. For this image, the depth extensions of the compared methods were quite limited. Due to the limited depth extensions in the depth maps in Figures 1(c) and (d), we can hardly perceive the depth gradient variations. Moreover, Zhang and Cham s depth map tended to under-estimate the depth, as it contained many black regions than the other depth maps. By contrast, Bae and Durand s depth map over-estimated the depth, as there were many bright regions than the corresponding areas in the other depth maps. The allin-focus images are shown in Figures 1(e), (f), and (g), synthesized respectively from the depth maps in Figure 1(b), (c), and (d). The area within the box in Figure 1(f) is blurred and that in Figure 1(g) has ringing artifacts. Meanwhile, the slant in Figure 1(f) and (g) are obviously smaller than that in Figure 1(e) due to smaller depth extensions in the depth maps of Figure 1(c) and (d). The details of the highlighted boxes are shown in Figure 1(h), the left column is our result, middle is Zhuo and Sim s result, and right is Bae s result, respectively. 15

43 (a) (h) (b) (c) (d) (e) (f) (g) Fig1. The experiment of brick wall. Referernces 1. S. Zhuo and T. Sim Defocus map estimation from a single defocused image, Pattern Recognition, vol. 44, no. 9, pp , S. Bae and F. Durand, Defocus magnification, Computer Graphics Forum, vol. 26, no. 3, pp , July

44 (Room 107) 20 June 2016, 16:30-17:00 PM Optical industry profile measurement based on laser lock-in imaging Xuecai Yu, Xiaolong Cheng, Xingzhi zhang, Jianhua Zhou, Xiandong Jiang, and Lixun Zhang University of electronic Science and technology of China, School of Optical and Electronic Information Abstract The most common optical profile technique uses a line structured laser beam to illuminate surfaces, a camera to get a surface image, and a series of digital image algorithm to extract profiles. This optical profile technique based on digital image processing has been developed rapidly in the recent decade, and has broad application demands in industry. However, there have been technical bottleneck problems which limit industry applications of the optical profile technique. The widespread problems are influences of background lights on the image and common surfaces of industry products, which may be specular, dark, or transparent. In this paper, a technique, referred as to laser lock in imaging to solve the bottleneck problems, is introduced. The principle of the laser lock in imaging is presented and its powerful capability is verified experimentally. Furthermore, we use the laser lock-in imaging in measuring profiles of smooth surfaces of railway tracks and high temperature steel billets in working line to improve the reliability and stability of the optical profile technique. 17

45 (Room 108) 20 June 2016, 09:30-10:00 AM Interface Formation and Surface Degradation of Trihalide Perovskite Materials Yongli Gao Department of Physics and Astronomy, University of Rochester, Rochester, NY 14627,USA Abstract The progress is truly impressive in highly efficient solid-state hybrid solar cells based on organometal trihalide perovskite materials. This technology has the potential to produce solar cells with hightefficiencies while retaining lowest cost. We have measured the electronic structure, interface formation, and surface degradation of perovskite materials using ultraviolet photoelectron spectroscopy (UPS), inverse photoemission spectroscopy (IPES), x-ray photoelectron spectroscopy (XPS), small angle x-ray diffraction (XRD), and atomic force microscopy (AFM). The interface between CH 3NH 3PbI 3 and a number of different materials show interesting behaviors. It is observed that on CH 3NH 3PbI 3 the HOMO level of fullerene shifts to lower binding energy. The XPS results show a strong initial shift of core levels to lower binding energy in the perovskite, which indicates that electrons transfer from the perovskite film to fullerene molecules. The strongest electron transfer happened at 1/4 monolayer of fullerene.[1] The interface of CH 3NH 3PbI 3 with Au is inert, but that with MoO 3 is highly reactive.[2,3] We have also investigated the degradation of co-evaporated CH 3NH 3PbI 3 films exposed to oxygen, air and water, respectively. The results indicate that CH 3NH 3PbI 3 is not sensitive to oxygen. A reaction threshold of about L is found for H 2O exposure, below which no CH 3NH 3PbI 3 degradation takes place and the H 2O acts as an n- dopant. Above the threshold, the film begins to decompose, and the amount of N and I decrease quickly, leaving the surface with PbI2, hydrocarbon complex and O contamination. Referernces 1. Chenggong Wang, Congcong Wang, Xiaoliang Liu, John Kauppi, Yuchuan Shao, Zhengguo Xiao, Cheng Bi, Jinsong Huang, and Yongli Gao, Appl. Phys. Lett. 106, (2015). 2. X. Liu, C.G. Wang, L. Lyu, C.C. Wang, Z.G. Xiao, C. Bi, J.S. Huang, and Y. Gao, Phys. Chem. Chem. Phys. 17, 896 (2015). 3. Peng Liu, Xiaoliang Liu, Lu Lyu, Haipeng Xie, Hong Zhang, Dongmei Niu, Han Huang, Cheng Bi, Zhengguo Xiao, Jinsong Huang, and Yongli Gao, Appl. Phys. Lett. 106, (2015). 18

46 (Room 108) 20 June 2016, 10:00-10:30 AM Photonic phase control in cobalt perovskite Y. Okimoto 1, R. Fukaya 1, T. Ishikawa 1, K. Onda 1, S. Koshihara 1 and M. Azuma 2 1 Department of Materials Science, Tokyo Institute of Technology, Japan 2 Materials and Structures Laboratory, Tokyo Institute of Technology, Yokohama, Kanagawa , Japan Abstract Perovskite-type cobalt oxides have been of current interest due to the interesting magnetic and electric properties concerning the spin crossover phenomenon, and we have so far demonstrated the photonic controls of the electronic phase in several cobalt oxides systems 1-4. Among many cobaltites, BiCoO 3 (BCO) shows a polar crystal structure (crystal group P4mm), and Oka et al. have recently revealed that BCO shows the spin crossover change and the resultant structural transformation by applying external pressure 5. In this paper, we demonstrate our recent results concerning ultrafast photocontrol of the electronic structure in BCO in terms of pump-probe reflection and second harmonic generation spectroscopy using fs laser pulses. This type of research aiming at gigantic/ultrafast change of the optical constant driven by the photoinduced electronic change might be promising for some future applications of ultrafast communication etc. R/R) in BCO just after the photoexcitation with a 400 nm pulse, which excites charge transfer transition from the O 2p band to the empty Co 3d band. (Hereafter, all the measurements were done at room temperature.) In the inset, for comparison, we show static reflectivity spectrum before the photoexcitation. The spiky structure at around 0.01 ev is due to an optical phonon mode. Except for the phonon structure, reflectivity is flat reflecting the insulating behavior. Just after the photoexcitation, as shown by the black circles in Fig. 1, the broad peak appeared in the spectra R/R at about 0.7 ev. Taking account of the flat reflectivity, this result implies the photoexcitation gives birth to a novel photoexcited state with the mid-infrared absorption. To see change in the polarity of BCO after the photoexcitation, we observed second harmonic (SH) generation. The crystal structure of BCO does not have inversion symmetry and hence we can detect the SH signal and use the intensity as an index of the degree of the polarity after the photoirradiation. We display in Fig. 2 time profiles of the relative change of the SH intensity ( I SH /I SH ). Just after the photoirradiation, I SH /I SH showed sudden reduction by about 60 % at the pump fluence of ca. 8.4 mj, implying that the polarity was suppressed by the light irradiation on the time scale of subpicosecond. With decreasing the pump fluence, the magnitude of I SH /I SH gradually decreases. After the instant reduction, I SH /I SH showed slight decaying and flat time profile, indicating the long-lived state with suppression of the polarity. In summary, these ultrafast linear and nonlinear spectroscopic results suggest that the photoirradiation brought about a novel excited state with the mid-infrared absorption at ca. 0.7 ev and the large reduction of the polarity. This can be viewed as an example of not only the 19

47 photoinduced phase transition but also an ultrafast optical control of a ferroelectric polar material. Fig1. Transient spectrum of the relative change of reflectivity s ( R/R) in BCO just after the photoexcitation at about 0 ps. The inset shows the static reflectivity spectrum. Fig. 2. Time-profiles of the relative change of the second harmonic intensity ( I SH /I SH ) in BCO at selected pump fluence. Referernces 1. Y. Okimoto X. Peng, M. Tamura, T. Morita, K. Onda, T. Ishikawa, S. Koshihara, N. Todoroki, T. Kyomen, and M. Itoh, Phys, Rev. Lett. 103, (2009). 2. Y. Okimoto, M. Kurashima, K. Seko, T. Ishikawa, K. Onda, S. Koshihara, T. Kyomen, and M. Itoh, Phys, Rev. B 83, (R) (2011). 3. Y. Okimoto, T. Miyata, M.S. Endo, M. Kurashima, K. Onda, T. Ishikawa, S. Koshihara, M. Lorenc, E. Collet, H. Cailleau, and T. Arima, Phys. Rev. B, 84, (R) (2011). 4. Y. Okimoto et al., J. Phys. Soc. Jpn., 82, (2013). 5. K. Oka, et. al., J. Am. Chem. Soc. 132, (2010). 20

48 (Room 108) 20 June 2016, 10:00-10:45 AM First-Principles Study on Electronic Structures of FAPbX 3 (X = Cl, Br, I) Hybrid Perovskites Y. Y. Pan 1,2, Y. H. Su 1, C. H. Hsu 2, L. W. Huang 1,2, K. P. Dou 2, C. C. Kaun 2. 1 Department of Materials Science and Engineering, National Cheng Kung University, Tainan, Taiwan 2 Research Center for Applied Sciences, Academia Sinica.Taipei, Taiwan Abstract Using first principles calculations, we investigate the geometric and electronic structures of organic inorganic hybrid perovskite, FAPbX 3 (FA = NH 2CHNH 2; X = Cl, Br, I). Since the organic molecule in the centre of the 3D hybrid perovskite is the key material for its characteristics, here we compare FAPbX 3 with MAPbX 3 (MA = CH 3NH 3). The band gap of the former is smaller than the latter. Particularly, the calculated band gap of FAPbI 3, 1.40 ev, is close to the experimental data, 1.47 ev. [1] Furthermore, we use orbitals, density of states and the spatial distribution of the charges to show that FAPbX 3 can produce and transfer more excitons than MAPbX 3 does. Referernces 1. W. S. Yang, J. H. Noh, N. J. Jeon, Y. C. Kim, S. Ryu, J. Seo, S. Il Seok, High-performance photovoltaic perovskite layers fabricated through intramolecular exchange, Science, 348 (2015)

49 (Room 108) 20 June 2016, 11:00-11:30 AM Structure and Electrical Properties of Ge-substituted Rhodium and Cobalt Antimony Skutterudites Hiroshi Fukuoka Department of Applied Chemistry, Faculty of Engineering, Hiroshima University Abstract After the finding of the anomalous superconductivity of PrOs 4Sb 14 [1], a great many related filled and unfilled skutterudites were extensively studied. In the studies of skutterudites, interesting properties such as superconductivity, non-fermi liquid and heavy fermion behaviors, and promising thermoelectric properties have been reported [2-7]. Recently filled skutterudites, APt 4Ge 12, A = Sr, Ba, La, and Pr were discovered. They are superconductors with much higher Tcs than that of PrOs 4Sb 14 [8, 9]. Interesting studies about Ge-substituted Sb skutterudites AIr 4Ge 3Sb 9, A = La, Nd, and Sm, were also reported [10-12]. Those were the first skutterudites containing group 14 elements in the host X sites. Those findings dramatically expanded the chemistry of skutterudites. The possible number of the combination of A, T, and X is, however, enormous. I prepared some Ge-substituted Sb skutterudites, ARh 4Ge 3Sb 9, A = La, Ce, Pr, and Nd [13], and ACo 4Ge 3Sb 9, A = La, Ce, Pr, and Nd. These compounds were synthesized by reactions at 7 GPa and 800 C. The temperature dependence of the magnetic susceptibilities of those rhodium compounds followed Curie-Weiss law from 2 K to room temperature except for the La derivative. The oxidation sates of the guest ions are estimated to be +3 [13]. The cobalt compounds also showed a Curie-Weiss behavior except for the La analog. While the oxidation states of La and Ce were calculated to be +3, the Pr and Nd compounds showed much smaller Curie constants than the theoretical values for the trivalent ions. The Seebeck coefficient of RhSb 3 was reported to be 28 μv/k at room temperature [14]. The positive Seebeck coefficients of 26 and 11 μv/k were observed at room temperature for LaRh 4Ge 3Sb 9 and CeRh 4Ge 3Sb 9, respectively. While the value for the La compound was almost the same as that of RhSb 3, the Ce compound showed a much smaller value. As the oxidation state of La and Ce is +3, the smaller coefficient of the Ce compound is possibly owing to an effect of f electrons. It is interesting to compare these values with those of AIr 4Ge 3Sb 9. Though the Seebeck coefficient of IrSb 3 was 63 μv/k, the coefficients for the Ge substituted compounds were less than 8 μv/k [12]. I also discovered the first anion-filled skutterudite I 0.9Rh 4Sb 12 [15]. This compound is obtained only by high-pressure synthesis at higher than or equal to 5 GPa. The resistivity of the compound was almost constant from 300K (9.9 mωcm) to 2 K (8.9 mωcm). The band structure calculation showed that the Rh-p, Rh-d, and Sb-p orbitals mainly contributed to the conduction bands; the iodine contribution to them was not large [15]. Iodine filled skutterudites were obtained for the Co/Ir Sb systems by the similar high-pressure reactions. 22

50 Referernces 1. E. D. Bauer, N. A. Frederick, P.-C. Ho, V. S. Zapf, M. B. Maple, Phys. Rev. B 65, (2002). 2. A. F. Wells: Structural Inorganic Chemistry 5 th Ed. (Oxford University Press, Oxford 1984), Chap. 6, p G. P. Meisner, Physica B 108, 763 (1980). 4. I. Shirotani, T. Uchiumi, K. Ohno, C. Sekine, Y. Nakazawa, K. Kanoda, S. Todo, T. Yagi, Phys. Rev. B 56, 7866 (1997). 5. N. Takeda, M. Ishihara, Physica B 92, 259 (1999). 6. H. Sugawara, T.D.Matuda, K. Abe, H. Sato, S. Nojiri, Y. Inada, R. Setti, Y. Onuki, Phys. Rev. B 66, (2002). 7. K. Nouneh, R. Viennois, I.V.Kityk, F.Terki, S.Charar, S.Benet, S.Paschen. Physica Status Solidi B 241, 3069 (2004). 8. E. Bauer, A. Grytsiv, X-Q. Chen, N. Melnychenko-Koblyuk, G. Hilscher, H. Kaldarar, H. Michor, E. Royanian,G. Giester, M. Rotter, R. Podloucky, P. Rogl, P. Phys. Rev. Let., 99, (2007). 9. R. Gumeniuk, W. Schnelle, H. Rosner, M. Nicklas, A. Leithe-Jasper, Y. Grin, Phys. Rev. Lett., 100, (2008). 10. G. S. Nolas, G. A. Slack, T. Caillat, and G. P. Meisner, J. Appl. Phys., 79, 2622 (1996). 11. G. S. Nolas, G. A. Slack, D. T. Morelli, T. M. Tritt, and A. C. Ehrlich, J.Appl. Phys., 79, 4002 (1996). 12. T. M. Tritt, G. S. Nolas, G. A. Slack, A. C. Ehrlich, D. J. Gillespie, J. L. Cohn, J. Appl. Phys., (1996). 13. H. Fukuoka and S. Yamanaka, J. Alloys. Compd. 461, 547 (2008). 14. K. T. Wojciechowski, J. Alloys. Compd. 439, 18 (2007). 15. H. Fukuoka and S. Yamanaka, Chem. Matter. 22, 47 (2010). 23

51 (Room 108) 20 June 2016, 11:30-12:00 AM Probing the structure and dynamics of nanomaterials for battery applications Serena A. Corr School of Chemistry, University of Glasgow, Glasgow, G12 8QQ, United Kingdom Abstract Critical for advances in functional nanoparticles is an understanding of how the properties of materials operate on such limited length scales. Their complexity demands a combination of characterization methods in order to fully evaluate their behaviour. We have prepared a host of vanadate- and olivine-structured nanoparticles, which have potential applications as energy efficient materials and insertion electrodes. We can use a variety of bottom-up synthetic approaches including hydrothermal synthesis, co-precipitation, sol-gel and recently developed microwave-assisted methods, which allow us to prepare size- and shape-tailored nanoparticles of desired phases in a controlled manner. To intimately understand the structure-propertyfunction relationships in these materials, we make full use of a host of physical characterisation tools and facilities-based local structure techniques including muon spin relaxation and x-ray absorption spectroscopy (Fig 1). Such methods allow us to monitor, in detail, lithium diffusion processes and magnetic ordering in these nanoparticles, together with changes in local structure. Recently, we have also employed total scattering methods to study the lithium distribution and disorder in a range of manganese-containing olivines, which will also be presented. The combination of this variety of techniques builds a more complete picture of such disordered materials and is of huge importance in elucidating mechanistic information. We have also established microwave-synthetic routes to solid state electrolytes for the development of all solid-state batteries, which I will also present. Fig 1. Muon spin resonance studies on the garnet structure Li 6.5Al 0.25La 2.92Zr 2O 12 24

52 Referernces 1. M. Amores, T. E. Ashton, P. J. Baker, E. J. Cussen, S. A. Corr, J. Mater. Chem. A, 4, 1729 (2016) 2. T. E. Ashton, D. Hevia Borrás, A. Iadecola, K. M. Wiaderek, P, J, Chupas, K. W. Chapman and S. A. Corr, Acta. Cryst. B, B71, 722 (2015) 3. J. Vidal Laveda, V. Chandhok, C. A. Murray, G. W. Paterson and S. A. Corr, Chem. Commun., 2016, DOI: /c5cc07732j 25

53 (Room 108) 20 June 2016, 12:00-12:30 PM Probing Electron Scattering Cross Sections for Molecules of Technological Importance G. L. C. de Souza Department of Chemistry, Federal University of Mto Grosso, Cuiaba, Mato Grosso, Brazil Abstract Electron-molecule (e - -molecule) cross sections are important properties for supporting researches in both fundamental and applied-technological areas [1]. From the theoretical point of view, the utilization of optical potentials based methods present a practical manner of determining the referred quantities in a wide energy range. EPolyScat-D is a series of programs where the dynamics of e - -molecule interaction is described by a molecular complex optical potential (MCOP) that includes de static, exchange, correlation-polarization, and absorption contributions. The suite of codes was originally developed by Lucchese et al. [2] and after modified by de Souza et al. [3] and by Lee et al. [4]. The static and the exchange components are derived exactly by the molecular wave function while the correlation-polarization contribution is obtained in the framework of the free-electron-gas model [5]. At last, the absorption effects are taken into account by the use of the model absorption potential developed by Lee et al. [6]. The scattering equation with this optical potential is solved iteratively using the Pade's approximant method. In the past few years, the EPolyScat-D has been successfully applied in probing e - -molecule cross sections for several molecular targets [3,4,7,8]. In this work, as result of a very recent application, we present computed results of e - -molecule scattering cross sections for molecules related to technological processes. More specifically, Differential, Integral, Momentum Transfer, Total and Total of Absorption Cross Sections (DCS, ICS, MTCS, TCS and TACS, respectively) were calculated in the ev energy range. Referernces 1. N. Hansen et al., Prog. Eng. Combus. Sci. 35, 168 (2009). 2. F. A. Gianturco, R. R. Lucchese and N. Sanna, J. Chem. Phys. 102, 5743 (1995). 3. G. L. C. de Souza et al., Phys. Rev. A 82, (2010). 4. M.-T. Lee et al., J. Chem. Phys. 102, 136 (2012). 5. N. T. Padial and D. W. Norcross, Phys. Rev. A 28, 697 (1983). 6. M.-T. Lee et al., J. Electron. Spec. Rel. Phenom. 155, 14 (2007). 7. M. G. P. Homem et al., Phys. Rev. A 92, (2015). 8. G. L. C. de Souza et al., Chem. Phys. 393, 19 (2012). 26

54 (Room 108) 20 June 2016, 14:00-14:30 PM Catalyst discovery using preparation by supercritical antisolvent precipitation: Georgite as a precursor for highly active copper zinc oxide catalysts Stuart H. Taylor 1, Simon A. Kondrat 1, Paul J. Smith 1, Peter P. Wells 2, Philip A. Chater 3, James H. Carter1, David J. Morgan1, Thomas E. Davies 4, Elisabetta M. Fiordaliso 5, Jakob B. Wagner 5, Li Lu 6, Jonathan K. Bartley 1, Michael S. Spencer 1, Christopher J. Kiely 6, Gordon J. Kelly 7, Colin W. Park 7, Matthew J. Rosseinsky 4, Graham J. Hutchings 1 1 Cardiff Catalysis Institute, School of Chemistry, Cardiff University, Main Building, Park Place, Cardiff, CF10 3AT, U.K. 2 The UK Catalysis Hub, Research Complex at Harwell, Harwell, Oxon, OX11 0FA, U.K. 3 Diamond Light Source, Didcot, OX11 0DE, U.K. 4 Department of Chemistry, University of Liverpool, Crown Street, Liverpool, L69 7ZD, U.K. 5 Center for Electron Nanoscopy, Technical University of Denmark, Fysikvej 307, DK-2800 Kgs. Lyngby, Denmark 6 Department of Materials Science and Engineering, Lehigh University, 5 East Packer Avenue, Bethlehem, PA 18015, U.S.A. 7 Johnson Matthey, PO box 1, Belasis Avenue, Cleveland, TS23 1LB, U.K. Abstract Heterogeneous catalysts are used widely in many applications, from protection of the environment for emission control to manufacture of many important chemicals and intermediates. Around 80% of all manufactured goods will have employed a catalyst somewhere in one of the steps of their production; hence catalysts and their use contribute significantly to the world s economy. There are a number of methods available for catalyst preparation, and the method used will have an important influence on the catalyst composition, structure and morphology. These factors are crucial in determining the performance of a catalyst, and hence the method of catalyst preparation will have a direct influence on the catalyst performance. For the preparation of mixed metal oxide catalysts methods such as solid-state milling. Sol-gel or hydrothermal synthesis can all be used, but one of the most commonly used is coprecipitation. Coprecipitation is a relatively simple process to operate, and can be used to prepare catalyst precursors with well-mixed composition, and it is employed industrially. However, during and after coprecipitation the catalyst precursor remains in contact with the mother liquor, which can modify the precipitated material. This can be beneficial, but also it can make it difficult to control the final catalyst. Furthermore, coprecipitation results in large volumes of aqueous effluent that contains metal ions, nitrates and carbonates, and this has to be treated. We have pioneered an alternative catalyst preparation method that is supercritical anti-solvent (SAS) precipitation. SAS employs supercritical carbon dioxide as an anti-solvent. The precursors for the catalyst are dissolved in an organic solvent and then mixed with supercritical carbon dioxide. The fast diffusion of supercritical carbon dioxide into the solvent rapidly causes precipitation. The SAS process is able to produce materials with structures and morphologies 27

55 that cannot be made readily using other methods, providing a powerful tool to aid in the discovery of new catalysts. We have successfully applied the SAS process to prepare a range of catalyst materials, including catalyst supports [1,2], and catalysts of single [3] and mixed metal oxides [4,5]. We have applied the supercritical antisolvent precipitation method to the preparation of copper zinc oxide catalysts, which are important industrially for methanol synthesis and low temperature water gas shift reactions. Copper and zinc form a group of hydroxycarbonate minerals that include zincian malachite, aurichalcite and rosasite, widely found as natural deposits and they can be easily prepared using simple precipitation methods. Georgeite is also a member of this class of minerals but little is known about it, due to its exceptional rarity, low purity, instability and highly disordered nature. The inability to synthesise georgeite, or even to find mineralogical examples of georgeite with high purity, has led to it being largely ignored. In this work we show that stable georgeite can be readily synthesised using supercritical carbon dioxide as an anti-solvent in a precipitation process. We have developed methodology to prepare synthetic stable georgite using a carbon dioxide supercritical antisolvent precipitation process. Preparation of these precursors by conventional precipitation can involve the short-lived formation of amorphous georgeite although, when formed, it transforms rapidly to crystalline malachite. The synthetic georgeite is a precursor to highly active methanol synthesis and water gas shift catalysts with significantly superior stability in the low temperature water gas shift reaction when compared to catalysts prepared from crystalline malachite and an industrially relevant material (Figure 1). (c) Fig 1. Low temperature water gas shift activity at different gas hourly space velocities: ( ) zincian georgeite derived catalyst; ( ) co-precipitated zincian malachite derived catalyst; ( ) industrial catalyst: Reaction conditions: 220 C, 27.5 bar, H 2O:CO:CO 2:H 2:N 2 = 50:2:8:27.5:12.5 The high activity of the catalyst is related to the structure of the precursor, which is important in defining the structure of the final catalyst. Calcination of SAS prepared zincian georgeite produced disordered 3-4 nm nanocrystalline CuO/ZnO as observed by STEM and PDF analysis. 28

56 The extent of the disorder resulted in XRD and XANES analysis showing no discernible metal oxide contribution. This nanocrystallinity was found to persist until the residual high temperature carbonate decomposes to form XRD discernible CuO and ZnO phases at higher temperature. The improved activity and stability of the zincian georgeite catalyst can be attributed to the improved degree of interfacial contact between Cu and ZnO. In addition, the SAS method produces very pure zincian georgeite with low Na + ion content that does not require an aqueous washing step. This high purity could also be a contributing factor to both the high activity and stability of the zincian georgeite derived LTS catalyst. The structure of the catalyst precursor and the catalyst will be discussed in relation to the catalytic activity. This new synthetic route to stable georgeite will open up new opportunities for the use of this important material in a number of applications. Referernces 1. Z. Tang, A.F. Carley, J.K. Bartley, J.K. Edwards, S.H. Taylor, C.J. Kiely, G.J. Hutchings, J. Catal., 249, , (2007). 2. P.J. Miedziak, Z. Tang, T. E. Davies, D.I. Enache, J.K. Bartley, A.F. Carley, A.A. Herzing, C.J. Kiely, S.H. Taylor, G.J. Hutchings, J. Mater. Chem., 19, , (2009). 3. R.P. Marin, S.A. Kondrat, R.K. Pinnell, T.E. Davies, J.K. Bartley, G.J. Hutchings, S.H. Taylor, Appl. Catal. B, , , (2013). 4. Z. Tang, C.D. Jones, T.E. Davies, J.K. Bartley, A.F. Carley, S.H. Taylor, M. Allix, C. Dickinson, M.J. Rosseinsky, J.B. Claridge, Z. Xu, M.J. Crudace, G.J. Hutchings, ChemCatChem., 1, , (2009). 5. Z. Tang, S.A. Kondrat, C. Dickinson, J.K. Bartley, A.F. Carley, S.H. Taylor, T.E. Davies, M. Allix, M.J. Rosseinsky, J.B. Claridge, Z. Xu, S. Romani, M.J. Crudace, G.J. Hutchings, Catal. Sci. Technol., 1, , (2011). 29

57 (Room 108) 20 June 2016, 14:30-15:00 PM Fabrication of the Flexible Oxide Films by Photo-Induced Chemical Solution Process T. Tsuchiya, T. Nakajima, I. Yamaguchi, H. Matsui, T. Nakamura National Institute of Advanced Industrial Science and Technology (AIST), Higashi, Tsukuba, Ibaraki, Japan. Abstract To construct low carbon society more and more in the world, it is necessary to develop a high performances new green device such as a solar cell, a lithium battery, a power semiconductor, and light emitting diode (LED) lighting, superconducting device and so on. Metal oxides are expected to be key materials which are used for a new device by controlling metal composition, a crystal structure, orientation or multilayer of the film, a carrier, a spin, etc. In order to fabricate the new devices, their parameters controllable process would be effective. Another important problem is the development of the low cost and power saving process for constructing sustainable society in the world. For these purpose, chemical solution process (CSP) would be suitable because it does not require vacuum and high facility investments and any complicated etching process. In addition, precise metal composition control is possible when the materials are made from the more than 3 or 4 metal components. For the thin film processing, we have developed the photo-induced chemical solution process such as excimer laser-assisted metal organic deposition (ELAMOD) and photo reaction of nano-particle method (PRNP) for the preparation of the patterned metal oxide thin film on organic, glass and single crystalline substrates. Fig 1. Flexible resistor By using the PRNP process, ITO, rsisitor and phosphor thin films were prepared on glass, PET and PIM substrates at room temperature as sowin Fig. 1, 2. The luminescent thin film show higher luminescence compared with commercially available one. On the other hand, to prepare the epitaxial film, the use of the metal organic compound and single crystal substrate with large optical absorbance was found to be effective. By using the ELAMOD, epitaxial ITO, SnO 2, LSMO, PZT films were successfully obtained at low temperature in air as shown in Fig. 3. Also, we have scuseffully prepared VO 2 films with nonhysterisis. The TCR of the VO 2 films obtained by ELAMOD exhibit much higher than present uncooled IR sensor. Moreover, we have suceffuly obtained highly liminecent Y 2O 3: 30

58 Eu,Ga 2O 3:Eu phosper thin films by ELAMOD. In this presentation, we demonstrate a preparations of ITO, resistor and phosphor thin films on flexible substrates. Fig 2. ITO film on PET by PRNP Fig 3. epi. LSMO films Acknowledgement Part of this research is based on thecooperative Research Project of Research Institute of Electronics, Shizuoka University. Referernces 1. T. Tsuchiya et al., Appl. Surf. Sci., 186 (2002) T. Tsuchiya et al., Appl. Phys. A 99 (2010) T. Nakajima et al., Chem. Soc. Rev. 43 (2014)

59 (Room 108) 20 June 2016, 15:00-15:30 PM The control of crystallinity in polymer and perovskite solar cells Yu-Chiang Chao Department of Physics, Chung Yuan Christian University, Chung Li, Taiwan Abstract The influence of TESADT molecular doping in the hole transport layer will be presented for pseudo-bilayer polymer solar cells. The influence of NH 4Cl doping in perovskite solar cells will also be presented. We demonstrated that the precise control of doping ratio is important in both cases. 32

60 (Room 108) 20 June 2016, 16:00-16:30 PM Photovoltaic Performance of Dye-Sensitized Solar Cells Based on Diphenylamino- Carbazole Substituted BODIPY Dyes Yousuke Ooyama Department of Applied Chemistry, Graduate School of Engineering, Hiroshima University, Higashi-Hiroshima , Japan Abstract Duraing the last two decades, dye-sensitized solar cells (DSSCs) have received considerable attention as one of the most promising sustainable photovoltaic devices. To further improve the photovoltaic performances of DSSCs, it is neceaary to develop photosensitizer possessing an intense light-harvesting property in the red/near-ir (NIR) region ( nm) of the solar spectrum. Boron dipyrromethene (BODIPY) dye is one of most promising red/nir photosensitizers for DSSCs because of their large photoabsorption coefficient in the visible and red/nir region of the solar spectrum, strong fluorescence properties, and electrochemical modifications through the introduction of electron-donating and electron-accepting groups onto the BODIPY core, as well as their high chemical stabilities and photostability, and high solubility in organic solvents. [1, 2] Fig 1 Diphenylamino-carbazole substituted BODIPY sensitizers YHO-1, YHO-2 and YH-1. Thus, in this work, as a new photosensitizer for DSSCs, we have designed and synthesized the non-alkylated BODIPY dye YHO-1 and the hexa-alkylated BODIPY dye sensitizer YHO-2 with carboxyhexyl group as an anchoring group on the carbazole ring (Fig1). [3] Moreover, D π A type BODIPY dye sensitizer YH-1 with two pyridyl groups as electron-withdrawinganchoring group at the end of the 3- and 5-positions and carbazole-diphenylamine moiety as an electron-donating group at the 8-position on the BODIPY core has been aslo developed. [4-6] We investigated the optical and electrochemical properties, and the photovoltaic performances for these BODIPY dye sensitizers. This work demonstrates that the fluorescent BODIPY dyes can inject electrons efficiently from the BODIPY core to the CB of the TiO 2 electrode, but the non-fluorescent BODIPY dyes result in lowering of photocurrent generation due to radiationless relaxation of the photoexcited dye. Furthermore, it was found that the expansion 33

61 of π-conjugated system by the introduction of not only carbazole-diphenylamine moiety and thiophene unit at the 8-position but also two thienylpyridines at the 3- and 5-positions on the BODIPY core can lead to red-shift and broadening of absorption band in the red/nir region. Referernces 1. Y. Ooyama, Y. Harima, Eur. J. Org. Chem., 18, 2903 (2009). (Review) (Cover Picture). 2. Y. Ooyama, Y. Harima, ChemPhysChem, 13, 4032 (2012). (Review) (Cover Picture). 3. Y. Ooyama, Y. Hagiwara et al., RSC Adv., 3, (2013). 4. Y. Ooyama, S. Inoue et al., Angew. Chem. Int. Ed., 50, 7429 (2011). 5. Y. Ooyama, N. Yamaguchi et al., Chem. Commun., 49, 2548 (2013). 6. Y. Ooyama, Y. Hagiwara et al., New J. Chem., 37, 2479 (2013). 34

62 (Room 108) 20 June 2016, 16:30-17:00 PM ZnTeO-based multiple band gap semiconductors for intermediate band solar cells Tooru Tanaka Department of Electrical and Electronic Engineering, Saga University, Saga, JAPAN Abstract The concept of multiband or intermediate band solar cell (IBSC) has recently attracted a renewed attention as a feasible approach to achieving high solar power conversion efficiencies [1]. Several approaches have been attempted to demonstrate the concept of IBSC including quantum dots and highly mismatched alloys (HMAs). HMAs are a class of materials whose fundamental properties are dramatically modified through the substitution of a relatively small fraction of host atoms with an element of very much different electronegativity, for example N in GaAs [2] and O in ZnTe [3,4]. The addition of a small amount of isoelectronic O into ZnTe leads to the formation of a narrow, O-derived band (E -) of extended states located well below the conduction band (E +) edge of the ZnTe [3,4] as a result of an anticrossing interaction between localized states of O and the conduction band of the ZnTe matrix. The energies of the three possible photon absorption edges between the valence, intermediate, and conduction band of ZnTe 1-xO x (ZnTeO) fit well into the entire solar spectrum providing a material envisioned for the multi-band, single junction, high efficiency photovoltaic devices. Here, we first report the growth and characterization of ZnTeO layers by radical-source molecular beam epitaxy (RS-MBE) on ZnTe substrates. Optical transitions associated with the lower (E -) and upper (E +) conduction subbands are characterized [4]. Then, we report photovoltaic properties of ZnTeO IBSCs using n-zno layers with and without a blocking barrier for intermediate band (IB) examined to demonstrate a photocurrent induced by a two-step photon excitation (TPE) process [5]. The cell structures and energy band diagrams are shown in Fig. 1. As shown in Fig. 2, the device with a blocked IB (BIB) exhibits a small external quantum efficiency (EQE) in photon energy range in which electron transitions from VB to IB take place, implying the electron accumulation in IB, whereas the device without the blocking barrier (UIB) shows a high EQE in the same energy range. The enhancement of EQE (inset of Fig. 2) is observed in TPE experiments as a result of electron transition from VB to CB via IB. The observed high optical transition rate from IB to CB clearly indicates the high potential of this HMA for the application of IBSCs. Finally, we report our challenges to improve the photovoltaic performances of ZnTeO IBSCs such as an open circuit voltage. Because there is a large conduction band offset between ZnTe blocking layer and n-zno window layer, the open circuit voltage for ZnTeO IBSCs using n-zno layer is as small as 0.36 V. In order to achieve higher open circuit voltage, it is necessary to develop a new n-window layer. ZnS has a large direct band gap of 3.7 ev with a smaller conduction band offset against ZnTe, and therefore, ZnS is a suitable n-window material for ZnTeO IBSC. We have grown n-type ZnS thin films by MBE, and demonstrated heterojunction ZnS/ZnTe solar cells with an improved 35

63 open circuit voltage. Based on the results, we have also fabricated ZnTeO IBSCs with n-zns window layer. Fig. 3 shows the current density-voltage (J-V) curves of ZnTeO IBSCs with n-zns or n-zno window layers. It is found that the open circuit voltage is increased almost twice by using the n-zns window layer. Fig. 1 (a) Solar cell structure of a BIB device with the intermediate band (IB) disconnected from the contacts. (b) Solar cell structure of an UIB device with the IB connected to the surface side contact. Fig 2. External quantum efficiency (EQE) curves for BIB and UIB devices at room temperature. The inset shows EQE spectra with and without IR illumination. 36

64 Fig 3. Current density-voltage (J-V) curves of ZnTeO-based IBSCs using n-zns or n-zno window layers. Referernces 1. Luque and A. Martí, Phys. Rev. Lett. 78, 5014 (1997). 2. N. Lopez, L. A. Reichertz, K. M. Yu, K. Campman, and W. Walukiewicz, Phys. Rev. Lett. 106, (2011). 3. K. M. Yu, W. Walukiewicz, J. Wu, W. Shan, J. W. Beeman, M. A. Scarpulla, O. D. Dubon, and P. Becla, Phys. Rev. Lett. 91, (2003). 4. T. Tanaka, S. Kusaba, T. Mochinaga, K. Saito, Q. Guo, M. Nishio, K. M. Yu, and W. Walukiewicz, Appl. Phys. Lett. 100, (2012). 5. T. Tanaka, M. Miyabara, Y. Nagao, K. Saito, Q. Guo, M. Nishio, K. M. Yu, and W. Walukiewicz, Appl. Phys. Lett. 102, (2013). 37

65 (Room 109) 20 June 2016, 09:30-10:00 AM Biogenic light trapping in natural fibers toward scalable photocatalysis Seung Ho Choi 1, Jung Woo Leem 1, Kwang-Ho Choi 2, and Young L. Kim 1,3,4 1 Weldon School of Biomedical Engineering, Purdue University, Indiana, 47907, USA 2 Department of Agricultural Biology, National Academy of Agricultural Science, Rural Development Administration, Jeonju, 54875, Korea 3 Department of Computer Science and Engineering, Kyung Hee University, Yongin, 17104, Korea 4 Purdue Quantum Center, Purdue University, Indiana, 47907, USA Abstract There is a strong need for scalable and eco-friendly manufacturing/production of nanoscale plasmonics materials for a variety of biomedical, energy harvesting, and quantum computing applications. Even though numerous nanoscale fabrication and synthesis methods have shown the possibilities of intriguing photonic nanomaterials and nanostructures, they are intrinsically limited for large scale, reliable, economical, and environmentally-friendly production. In addition, for energy-efficient/eco-friendly devices and clean renewable energy sources, actual manufacturing processes often consume large amounts of fossil fuel and raw materials. 1 Counterintuitively, partially irregular nanostructures, compared with perfectly ordered nanostructures, can provide unique advantages of enhanced light confinement, transport, and amplification (also known as random lasers 2-10 ), if light in such media is localized or confined spatially. As a result, nanomaterials of extremely high-refractive-indices with densely compressed nanostructures or highly packed waveguides are commonly used. Metallic nanoparticles are often incorporated to further exploit plasmonic effects. However, these approaches are not only restricted by industrially relevant scalability, but also deprive us of developing flexible devices. In this respect, would it be possible to obtain natural innocuous optical nanomaterials for light localization and plasmonics, while producing large quantities in an eco-friendly manner? Light in heterogeneous biological and natural tissue is known as freely diffusing. We show that this long-standing scientific perception is broken in natural protein fibers. As numerous nanofibrils inside a fiber can serve as individual scattering centers, their distribution, size, and refractive index contrast lead to light localization in a fabric (i.e. multi-fiber cluster). We computationally visualize localized modes and experimentally measure a fundamental localization parameter from optical transmission matrices, which support the idea that light waves in natural fiber can be localized near the Anderson regime. Further, transgenic integration of biomolecular gain can afford a whole natural resonance-gain system for biogenic coherent light. These findings will broaden our fundamental understanding of light transport in nano/ultrastructures of biomaterials. Light confinement in some natural fibers could potentially be building blocks for green manufacturing of biocompatible resonators and implantable light sources as well as hybridization platforms for multi-functional photocatalytic fabrics. 38

66 Fig 1. Lustrous and silvery reflections from natural silk fibers indicate mesoscopic interference originating from light localization, in which coherent effects are preserved with even structural irregularity (or disorder). Referernces 1. H. Sengul, T. L. Theis, and S. Ghosh, "Toward sustainable nanoproducts: An overview of nanomanufacturing methods," Journal of Industrial Ecology 12, (2008). 2. H. Cao, "Review on latest developments in random lasers with coherent feedback," Journal of Physics a-mathematical and General 38, (2005). 3. M. Noginov, Solid-state random lasers (Springer, 2005). 4. A. Tulek, R. C. Polson, and Z. V. Vardeny, "Naturally occurring resonators in random lasing of pi-conjugated polymer films," Nature Physics 6, (2010). 5. A. Tulek, R. C. Polson, and Z. V. Vardeny, "Naturally occurring resonators in random lasing of pi-conjugated polymer films," Nature Physics 6, (2010). 6. S. H. Choi, and Y. L. Kim, "Random lasing mode alterations by single-nanoparticle perturbations," Applied Physics Letters 100, (2012). 7. D. S. Wiersma, "Disordered photonics," Nature Photonics 7, (2013). 8. S. H. Choi, and Y. L. Kim, "Hybridized/coupled multiple resonances in nacre," Physical Review B 89, (2014). 9. S. H. Choi, and Y. L. Kim, "The potential of naturally occurring lasing for biological and chemical sensors," Biomedical Engineering Letters 4, (2014). 10. S. H. Choi, K. M. Byun, and Y. L. Kim, "Excitation of multiple resonances in 1d anderson localized systems for efficient light amplification," Optics Letters 40, (2015). 39

67 (Room 109) 20 June 2016, 10:00-10:30 AM Bottom-up design of 2D organic photocatalysts for visible-light driven hydrogen evolution Xue Jiang, Peng Wang, Jijun Zhao Key Laboratory of Materials Modification by Laser, Ion and Electron Beams (Dalian University of Technology), Ministry of Education, Dalian , China Abstract Since the graphene boom, great efforts have been devoted to the two-dimensional (2D) monolayer materials with exciting perspectives of applications. Most known 2D materials so far are inorganic. Using the covalent triazine framework (CTF) as a representative, here we explore 2D organic semiconductors using first-principles calculations. From a systematic study of the electronic band structures, work functions, CBM/VBM positions, and optical absorption spectra, we identified the CTF as a new class of 2D visible-light-driven organocatalyst for water splitting. To further design two dimensional (2D) organocatalysts, three series of covalent organic framework (COF) are constructed with bottom-up synthesis strategies, i.e., molecular selection, tunable linkage, and functionalization. First-principles calculations are performed to confirm their photocatalytic activity under visible light. Two of our constructed 2D COFs models are identified as visible-light-driven organocatalyst for water splitting. Controllable construction of such COF from suitable organic subunit, linkage, and functional groups paves a way to correlate band alignment and geometry parameters. Our theoretical prediction not only provide essential insights into designing 2D-COFs photocatalyst for water splitting, enriching the family of the organic counterparts of inorganic photocatalyst, but also would motivate scientists to further explore novel 2D organic materials with other technological applications. 40

68 (Room 109) 20 June 2016, 11:00-11:30 AM Formation and Characterization of Dielectric nano-crystals for Highly Sensitive Pyroelectric Thermal Detectors S. Berger Faculty of Materials Science and Engineering, Technion, Haifa Israel Abstract Highly sensitive thermal detectors are of high technological interest in numerous applications such as medical diagnosis, fire alarms, security surveillance and system control. Reducing the crystal size increases the thermal detection sensitivity. Nanocrystals, made of non-linear dielectric materials were grown inside alumina nanopores. The nano-crystals are characterized by a low dielectric permittivity required for high figure-of-merit values. Two examples will be given: Triglycine Sulfate (TGS) and Boracite (a magnesium borate rare mineral). The nano-crystals, which are grown with a preferred crystallographic orientation, show a better pyroelectric response and figureof-merit as compared to their bulk size. The talk is focused on the crystal growth process, the role of the pore walls on the nucleation site and temperature, the growth with a preferred crystallographic orientation and the pyroelectric response to thermal changes. 41

69 (Room 109) 20 June 2016, 11:30-12:00 AM Piezoelectric Energy Harvesting Performance of Nanofiber Composites Liu Kaihua, Han Byul Kang, Chansu Han and Yong Soo Cho Department of Materials Science & Engineering, Yonsei University, Seoul , Korea Abstract Composite fibers based on piezoelectric Pb(Zr,Ti)O 3 (PZT) and (Na,K)NbO 3 (NKN)- nanoparticles embedded in poly(vinylidene fluoride-trifluoroethylene) [P(VDF-TrFE)] polymer have been investigated in terms of their performance as energy harvesters. Perovskite nanoparticles with <60 nm in diameter were separately prepared by a combustion synthesis technique using polyacrylic acid (PAA) as a fuel. Surface modification of nanoparticles by tetradecylphosphoric acid (TDPA) was carried out to improve their dispersion and their adhesion with the polymer. The final fibers were prepared by means of electrospinning. Location-dependent piezoelectricity measurement confirmed that the region of embedded PZT or NKN filler particles exhibited greater piezoelectricity than the polymer matrix region. The enhanced energy harvesting performance of a flexible nanogenerator demonstrated a few voltage outcome with > 100 na output current. The results are analyzed as coming from the mixed effect of the dispersed nanoparticles in the fiber matrix. 42

70 (Room 109) 20 June 2016, 14:00-14:30 PM New Materials for charge storage applications Andrew C. Grimsdale School of Materials Science and Engineering, Nanyang Technological University, 50 Nanyang Avenue, Singapore Abstract There is an ongoing need to develop new methods for charge storage to help meet the need for more sustainable energy supplies and minimise use of fossil fuels. At NTU we have found that lithium solvated electron solutions (LiSESs) made from lithium and simple polycyclic hydrocarbons such biphenyl and cyclopentadienone show promise as possible liquid cathodes for batteries. 1,2 In this talk I report our recent progress in developing LiSESs based on PAHs for such applications. 1. Synthesis and characterisation of biphenyl-based lithium solvated electrons solutions. 2. Synthesis and assessment of new cyclopenta2,4-dienone derivatives for energy storage applications. Referernces 1. K. S. Tan, A. C. Grimsdale, R. Yazami, J. Phys. Chem. B, 116, 9056 (2012) 2. Z. B. Lim, K. S. Tan, A. V. Lunchev, H. Li, S. J. Cho, A. C. Grimsdale, R. Yazami, Synth. Met., 200, 85 (2015). 43

71 (Room 109) 20 June 2016, 14:00-14:30 PM High-Hall-mobility transparent conductive oxide films: Key factors limiting carrier transport for wide applications Tetsuya Yamamoto 1, J. Nomoto 1, H. Makino 1, H. Kitami 2, T. Sakemi 2 1 Materials Design Center, Research Institute, Kochi University of Technology, Kami-shi, Kochi, Japan. 2 Engineering Physics Department, Technology Research Center, Sumitomo Heavy Industries, Ltd., Yokosuka, Kanagawa, Japan Abstract We will discuss how to improve carrier transport of polycrystalline transparent conductive oxide (TCO) films such as Al- or Ga-doped ZnO and Sn-doped In 2O 3. Polycrystalline films comprise grains, or crystallites, and grain boundaries (GBs) between two grains. It has proven to be easy to change carrier concentration N with various contents of dopants, whereas it is very difficult to control the carrier transport. Hall mobility H determined by Hall effect measurements can be expressed as follows: 1/ H=1/ ig + 1/ GB. ig denotes carrier mobility in grains, intragrain mobility, and GB carrier mobility at GBs. [1,2] The best solution to achieve high H TCO films is to increase ig together with little contribution of GB scattering to carrier transport, ig/ GB. Even though in degenerate n-type Ga- or Al-doped ZnO and In 2O 3, the GBs disturb the transport of carrier electrons that move across between the grains, which gives rise to a large value of ig/ GB. [1-3] On the other hand, in the grains, the formation of oxygen vacancies gives rise to the lattice distortion in the vicinity of their lattice sites, resulting in the reduction in ig. Fig 1. XRD-reciplocal space map (left: AZO films by DC-MS, right:azo films by DC- MS/GZO films by IP) and pole figure of 0002 reflection. 44

72 First, we discuss the depsotion technique to tailor-make a texture of Al or Ga-doped ZnO (AZO or GZO) polycrystalline films for the improvement of carrier transport. Columnar grain growth is a process that occurs in continuous metal oxide films, in which c-axis-aligned and energyminimizing grains grow at the expense of other grains. In this study, we deposited the ZnO films by direct current magnetron sputtering (DC-MS) or ion plating with DC arc discharge (IP). To investigate systematically the relationship between factors limiting the texture evolution of AZO and GZO films and the contribution of GB scattering to the carrier transport, we developed a two-step deposition method: firstly 10-nm-thick AZO films by DC-MS or GZO films by IP were deposited on glass substrates at a substrate temperature of 200 ºC, then AZO or GZO films with various thicknesses ranging from 50 to 490 nm by DC-MS or IP on the above films. We found that the thinner GZO layers with a preferential c-axis orientation by IP play a critical role in producing AZO thicker films having a textured polycrystalline structure with a well-defined (0001) orientation by DC-MS. In the films comprising 490-nm-thick AZO films/10-nm-thick GZO films/glass substrates, a high H of 50.1 cm 2 /Vs with a N of cm -3 was achieved due to the drastic reduction in ig/ GB: Figure 1 shows XRD-reciplocal space map and pole figure of 0002 reflection. Next, we demonstrate a design of carrier transport of TCO films: 100-nm-thick cerium (Ce)- doped hydrogenated indium oxide (ICO:H) films with a superior H of cm 2 /Vs.[3] The ICO:H films deposited at 150 C by IP were post-annealed at 200 C. The relationship between H and N of the polycrystalline ICO:H films shows that the carrier transport is limited by an ionized impurity scattering mechanism inside the grains. The surfaces of the ICO:H films were found to be very smooth and clear grain-boundary areas were not observed. Table I proves that co-doping of H with Ce donors with an increasing H 2-gas flow ratio leads to an increase in H composition together with a slight decrease in the atomic ratio of O species. This indicates that the O composition of the ICO matrix can be systematically controlled by changing the H 2-gas flow ratio with Ce doping content during the deposition, combined with the post-annealing step. This technique, which is based on co-doping mixed with post-annealing, can work very well, because it can enhance the carrier transport due to intragranular microstructure improvements and it can reduce the contribution of GB scattering to the carrier transport (see Fig. 2). 45

73 Fig 2. Hall mobility H as a function of carrier density N for ICO, ICO:H, and IO:H films, which were all subjected to post-annealing at 200 C for 30 min in air. Note that the density of the oxygen vacancies can be reduced by doped CeO 2 with a large standard formation enthalpy when compared to In 2O 3, resulting in crystallinity improvements. In this work, we have clarified the effects of both hydrogen doping with incorporated Ce and post-annealing on the structural and electrical properties of ICO:H films. Referernces 1. T. Yamada, H. Makino, N. Yamamoto, T. Yamamoto, J Appl Phys, 107, (2010). 2. J. Nomoto, H. Makino, T. Yamamoto, J Appl Phys, 117, (2015). 3. E. Kobayashi, Y. Watabe, T. Yamamoto, Appl. Phys. Express, 8, (2015). 46

74 (Room 109) 20 June 2016, 14:30-15:00 PM Non-equilibrium Transitions in Driven Vortex Matter of Amorphous Superconducting Films S. Okuma, Y. Kawamura, S. Moriya, R. Nitta, D. Mihaly, S. Kaneko Department of Physics, Tokyo Institute of Technology, Tokyo, Japan Abstract When a magnetic field is applied perpendicular to the plane of type-ii superconductors, flux lines penetrate the sample in the form of quantized vortices. By injecting a transport current, they are driven and induce a voltage. Since the vortex motion gives rise to dissipation, the study of vortex dynamics is important for the practical application of superconductors. From a scientific point of view, the study of vortex matter is also of great importance for exploring new physics in interacting many-particle systems. Here, I will present recent progress in research on non-equilibrium phase transitions, which include a reversible to irreversible flow transition (RIT) [1] and plastic depinning transition [1,2], observed in vortex systems of amorphous (a-)mo xge 1-x films with weak random pinning. The RIT was first observed in slowly sheared colloidal suspensions placed between concentric cylinders [3]. When the colloidal particles with a random initial distribution are periodically sheared, they progressively self-organize to avoid future collisions. This process is named random organization. Interestingly, the displacement d of particles per cycle turned out to be a key parameter determining the final steady state. For d smaller than a critical value d c, all the particles return to their initial position after each periodic shear. This is called reversible flow. By contrast, when d >d c, some particles do not return to their initial position, which is called irreversible flow. A relaxation time for the system to settle into the steady state diverges as a power-law on both sides of d c with critical exponents slightly larger than unity [3]. We have also obtained evidence of RIT using a vortex system in a Corbino-disk (CD) of a-mo xge 1- x films, where the vortices are driven periodically in the circumferential direction by a large global shear induced by a radial current inversely proportional to the radius [1]. The results strongly suggest the universality of RIT. In previous experiments performed in colloidal and vortex systems, a large global shear was always present, while a numerical simulation has predicted the occurrence of RIT in a system where only a local shear is present [4]. We have recently verified this prediction using a stripshaped a-mo xge 1-x film with relatively strong pinning [5], in which the vortices are driven back and forth in a translational motion by feeling an ac force and a local shear originating from the random pinning. It is noted that, compared to the result for CD, the reversible phase was suppressed down to the experimental resolution and the relaxation time toward the steady state increases significantly. They are attributed to the stronger pinning strength for the particular sample used here than that for the CD sample used previously. In an effort to reduce the pinning strength for the study of the critical behavior in the reversible phase, we have conducted a further experiment using the same vortex system. Here, the vortices are driven by a constant dc force while the ac force with a varying period is superimposed on the dc force, thereby 47

75 changing d in the moving frame. We again find the critical behavior similar to that of RIT observed in the rest frame. However, in the moving frame, the reversible phase is markedly enhanced, which enables us to examine the critical behavior on both sides of the transition. Furthermore, the relaxation time to the steady state is significantly suppressed. These results are reasonably explained in terms of the weakened effective pinning strength as a result of driving the vortex system with large dc velocities. We find an unexpected suppression of critical exponents from the values of = in the rest frame to around 0.7 in the moving frame, whose origin has not been specified yet. We propose two possible interpretations for this: One is that what we see in the moving frame is RIT with different pinning properties: the other is that in the moving frame we see a novel dynamic transition characterized by =0.7. Finally, I will present our recent progress on a general phenomenon of plastic depinning studied in the same vortex system. We have found clear evidence that the depinning transition is described as a non-equilibrium phase transition [1,2]. Let us consider a many-particle system, in which the particles are driven by a suddenly applied dc driving force F in the presence of the random pinning potential. The theory [6] predicts that regardless of their initial distribution, the final steady state is determined by the magnitude of F. When F is smaller than the critical driving force F d, all the particles remain pinned at the final steady state, while for F > F d, some particles are moving. The transition between the two states is identified with a depinning transition. Similarly to the case of RIT, a relaxation time for the system to settle into the steady state diverges as a power law at F d. Using the vortex system in the a-mo xge 1-x films, we have actually observed the critical behavior of the dc driven vortices near F d, thus demonstrating the non-equilibrium depinning transition [1,2]. Here, we extend the research to include depinning caused by ac drive. In particular, we focus on whether the critical behavior associated with the dc depinning transition is also observed for the ac drive. Our results clearly show that the critical behavior of the depinning transition is commonly observed for the ac drive and the critical exponents for the ac depinning transition is around =1.4, which are close to the ones obtained in the dc depinning transition and RIT. These results further support the theoretical prediction that the plastic depinning transition may fall into the same universality class as the RIT. Referernces 1. S. Okuma et al., Phys. Rev. B 83, (2011): J. Phys. Soc. Jpn. 81, (2012). 2. S. Okuma et al., Phys. Lett. A 377, 2990 (2013): New J. Phys. 14, (2012). 3. D. J. Pine et al., Nature 438, 997 (2005): L. Corte et al., Nat. Phys. 4, 420 (2008). 4. N. Mangan, C. Reichhardt, C. J. Olson Reichhardt, Phys. Rev. Lett. 100, (2008): PNAS 108, (2011). 5. R. Nitta et al., Phys. Procedia 65, 105 (2015). 6. C. Reichhardt, C.J. Olson Reichhardt, Phys. Rev. Lett. 103, (2009). 48

76 (Room 109) 20 June 2016, 15:00-15:30 PM Self-consistent Bogoliubov-de Gennes theory of strong type-ii superconductivity in 2D electron systems at high magnetic fields. Tsofar Maniv 1, Vladimir Zhuravlev 1 1 Schulich Faculty of Chemistry, Technion-Israel Institute of Technology, Haifa 32000, Israel Abstract We present a theory of strong type-ii superconductivity in 2D electron systems at high magnetic fields and low temperatures, where quasi particles propagation in the vortex lattice leads to creation of magnetic Bloch energy bands. Systematic self-consistent solutions of the Bogoliubov-de Gennes (BdG) equations, for parameters characteristic of the surface superconductivity observed recently in the topological insulator Sb2Te 3, [1] have been obtained numerically and used for investigating the interplay between the quasi-particle Landau bands and the vortex lattice structures under a varying magnetic field. Novel Fermi surface resonant features of the quasi-particle spectrum, appearing at certain magnetic field intensities in the high field region, due to scattering at vortex-lattice core regions, [2,3] are found to influence the spatial distribution of the superconducting order parameter in the 2D vortex lattice state. Furthermore, the genuine magnetic field dependence of the superconducting order parameter amplitude in the high-fields region, where the quasi-particle spectrum undergoes a crossover from a Landau band-structure to a continuous spectrum, including the opening of the superconducting energy gap, is calculated. The resulting field dependence in the region below the crossover field, which coincides with the semi-classical Helfand-Werthamer (HW) H c2, [4] is found to agree well with the semi-classical Gorkov-Ginzburg-Landau field-dependence, used commonly in non-self-consistent approaches (see Fig.1). However, in the high fields region above the crossover field the self-consistent theory deviates markedly from the non-selfconsistent semi-classical theory, yielding small, but non-vanishing order parameter amplitudes in certain regions around half integer filling factors nf 1/ 2 above the HW H c2. Remarkably, this high fields, low order-parameter region above the crossover field is found to extend dramatically upon decreasing the Debye cutoff frequency,,or the effective electron pairing potential parameter,, creating a novel mixed state of weak 2D superconductivity (see Fig.1). D Fig 1. Self-consistent order-parameter amplitude (blue dotes) as a function of n E / ( F F F c E -the Fermi energy and c eh / m c -the electronic cyclotron frequency), calculated by 49

77 solving the BdG equations for a 2D electron system, using the BCS s-wave pairing Hamiltonian at high perpendicular magnetic field, neglecting Zeeman spin splitting. The parameters used 4 are: the Debye cutoff frequency: D / EF 0.2, the temperature kbt / EF 10, and the electron pairing coupling constant The dotted pink line represents the best fitting HW semi-classical HW formula 0 / c 1.76 nf / nc 2 1 nc 2 / nf HW nc 2 EF / c Hc2 parameters: 5.6 and n 2 86., where, to the self-consistent order parameter amplitude, with the best fitting c The resulting field-dependent order-parameter amplitude, calculated within a simple model of a 2D electron system, is used in analyzing experimental data reported for the high field surface superconducting state observed recently in the topological insulator Sb2Te 3, [1]. Good agreement is found between the asymptotic ( H 0 nf ) order-parameter amplitude, obtained by fitting the HW order-parameter to the calculated self-consistent pair-potential in the low-field region (see Fig.1), and the experimentally measured superconducting gap reported in Ref.[1]. Furthermore, the small order-parameter amplitude (on the scale of the cyclotron energy c ), found in the extended region above the crossover field to well defined Landau bands structure, seems to account for the puzzled, virtually normal state damping of the de Haas van Alphen (dhva) oscillation measured in this system below the experimentally determined H ( 3T [1], n 12 in Fig.1). c2 F Referernces 1. Lukas Zhao et al., nature communications DOI: /ncomms T. Maniv and V. Zhuravlev, arxiv: v1 [cond-mat.supr-con] (2014). 3. V. Zhuravlev and T. Maniv, Phys. Rev. B 85, (2012). 4. E. Helfand and N.R. Werthamer, Phys. Rev. 147, 288 (1966). 50

78 (Room 109) 20 June 2016, 16:00-16:30 PM Large gap, a pseudogap and proximity effect in the Bi 2Te 3/Fe 1+yTe interfacial superconductor M. Q. He 1, J. Y. Shen 1, A. P. Petrovic 2, Q. L. He 1, H. C. Liu 1, Y. Zheng 1, C. H. Wong 1, Q. H. Chen 1, J. N. Wang 1, K. T. Law 1, I. K. Sou 1 and R. Lortz 1 1 Department of Physics, The Hong Kong University of Science and Technology, Clear Water Bay, Kowloon, Hong Kong S. A. R., China. 2 CorreLab, Gerbang Institute for Complex Matter, Nusajaya, Johor, Malaysia Abstract At the atomically-sharp interface between the non-superconducting parent compound Fe 1+yTe of the Fe-based high temperature superconductors and the topological insulator Bi 2Te 3, twodimensional interfacial superconductivity is found. This heterostructure is of high interest since the 2D superconductivity appears directly at the edge of Bi 2Te 3 where the toplogical surface state is formed. The heterostructure thus offers ideal conditions to realize a toplogical superconducting state with exotic Majorana edge states. Here we report directional point contact spectroscopy data on such a Bi 2Te 3/Fe 1+yTe heterostructure with a Bi 2Te 3 thickness of 9 quintuple layers, fabricated by van der Waals epitaxy. The data reveals that the interfacial superconducting state is as complex as in the cuprate high temperature superconductors: A pronounced pseudogap is observed up to 40 K in the normal state above the superconducting temperature at 12 K. Below the superconducting critical temperature, the pseudogap is replaced by a very large twin-gap structure. The larger gap shows the characteristics of unconventional order parameter symmetry and is attributed to a thin layer of FeTe in direct proximity to the interface. The smaller gap is associated with proximity-induced superconductivity in the topological insulator Bi 2Te 3, thus providing the necessary ingredients for a topological superconducting state. A pronounced zero-bias conductance peak is observed, which is likely related to nodal order parameter symmetry. 51

79 (Room 109) 20 June 2016, 16:30-17:00 PM Evaluation of Grüneisen Parameters of Ionic Conductors Eita Hirano, Masaru Aniya Department of Physics, Graduate School of Science and Technology, Kumamoto University, Kumamoto , Japan Abstract In recent years, much attention have been devoted to ionic conductors due to their potential applicability in energy related devices such as lithium ion batteries. However, concerning fundamental properties of ionic conductors, our understanding is far to be complete. For instance, knowledge on the Grüneisen parameter, which reflects the anharmonicity of lattice vibrations of the materials is quite limited. In a recent study, a comparative study of the temperature dependence of the Anderson-Grüneisen parameter in different materials was reported [1]. There, it was shown that the Anderson-Grüneisen parameter of ionic conductors exhibit anomalously large temperature dependence. This observation is very suggestive to understand the properties of ionic conductors, because it is known that in most materials, the temperature dependence of the Anderson-Grüneisen parameter is weak. In order to reinforce the above finding and gain further understanding on ionic conductors, we evaluated the Grüneisen parameter from elastic constants and other methods. Our result show that the Grüneisen parameters of AgCl, AgBr and superionic glasses such as (AgI) x(agpo 3) 1-x increase with the increase of temperature. However, in other cases such as PbF 2, it decreases with the temperature. Furthermore, it has been found that in ionic conductors, the Grüneisen parameter exhibit strong mode dependence. For instance, in AgCl, the Grüneisen parameter of the transverse ( 110 ) mode exhits a strong temperature dependence, whereas for the other transverse and longitudinal modes the temperature dependence is weak. In contrast, in NaCl, the temperature dependence of the Grüneisen parameter is negligible regardless of the mode. These findings indicate that systematic studies of Grüneisen parameters could provide useful information to understand the physical backgrounds that are behind ion transport properties of the materials. Referernces 1. H. Sadakuni and M. Aniya, Physica B 410, 81 (2013). 52

80 (Room 110) 20 June 2016, 09:30-10:00 AM Practical Modeling of floating nanodot with no fitting parameter in Device Simulation Hiroshi Watanabe 1, Jerry Lin, Kira Yao, Andy Lee, Sinjyn Lin Department of Electrical and Computer Engineering, National Chiao Tung University, Hsinchu, Taiwan, ROC Abstract Semiconductor nanostructures are expected to play a central role of new technologies (biotechnologies, quantum computing, optics ) other than the Neumann architecture computing. The dimensionality of such nanostructures is quite different from bulk structure (3- dimensional) which has been assumed in the modeling of the conventional electron devices. By this way, the conventional TCAD/SPICE modeling may become invalid to those nanostructures; and then many challenges to investigate such nanostructures has been carried out with the first principle calculation, the tight-binding method, molecular dynamics, and so forth. However, nanodevices comprised of plurality of nanostructures would not be independent and should then work in system. The simulation of the system having huge number of nanostructures would require huge computational resource. Demanded is therefore more practical modeling of nanostructures, which must be fundamentally different from the conventional modeling. In this short talk, we may briefly review and discuss the practical modeling of floating nanodot among those nanostructures. Floating islands are illustrated in Fig. 1. The floating gate (FG) larger than 10nm has been used in non-volatile memories. The size of nanodots may be regarded as from 2nm to 10nm. Less than 2nm and larger than several angstroms may be regarded as molecular dots. The size of local trap which comes from dangling bond in dielectrics is a few angstroms. The largest and the smallest in Fig. 1 are today s engineering topics [1], while the others are expected to come in near future. First of all, we grab the common essential feature among those floating islands so as to make the practical modeling of nanodots. This means that we may remove molecular level details related to nanodots from the first modeling. If we assume that a floating nanodot has a level in dielectrics, as illustrated in Fig. 2, then the potential energy of the dot level is fluctuated by ΔE/2 with or without electron. An electron can tunnel from the left electrode to the dot level with tunneling time being 1. If that electron is captured by dot; then he may emit to the right electrode with tunneling time being 2. As long as 2 is shorter than ħ/2δe, this electron can be captured for a while and then hops to the right electrode. This is similar to a trap-assisted tunneling [2]. Otherwise, we can regard that the elctron hopping is prohibitted by the Coulomb Blockade [3]. It should be noteworthy to say that we have used no fitting parameter to selfconsistently model both of the Coulomb Blockade and the trap-assisted tunneling, as long as we can calculate 1 and 2. 53

81 Fig 1. Very Small Floating Islands Fig 2. Practical Modeling of Coulomb Blockade in Very Small Floating Islands. (a) (b) Fig 3. Simulation Result with no fitting parameter. Fig. 3 is the simulation result with no fitting parameter. The spin freedom is also considered. The simulated structure is a silicon nanodot surrounded by oxide, sandwitched by two electrodes (right and left). The diameter of nanodot is 6 angstroms and the left electrode is grounded. The initial number of captured electrons in nanodot is 3. In (a), 0.3V is applied on the right electrode. Those electrons emit to the right electrode while no electrons tunnel from the left electrode to the nanodot. After all electrons emit to the right, the potential of nanodot (Vdot) arrives at a constant and then we have no tunneling after 10 pico-seconds. This is a result of the Coulomb Blockade. In (b), 3V is applied on the right electrode. The electrons initially 54

82 put on nanodot emit to the right electrode and then another electron tunnels from the left electrode to the nanodot. By this way, the Coulomb oscillation occurs after 10 pico-second; that is, electroncs comes from the left to the nanodot one-at-time and then emits from there to the right one-at-time. And, a next electron comes from the left to the nanodot and then continuing the oscillation. This is similar to trap-assisted tunneling. Referernces 1. H. Watanabe, IEEE Trans. Electron Device, vol. 57, no. 8, pp , Aug P. J. Jerry Lin, et. al., SISPAD, Yokohama, Sept. 17, 2014, pp M. H. Devoret and H. Grabert, Introduction to single charge tunneling, in Single Charge Tunneling Coulomb Blockade Phenomena in Nanostructures, 294, Ed. Bergzabern, Germany: NATO, 1992, ch

83 (Room 110) 20 June 2016, 10:00-10:30 AM Energy band structures of the crystalline silicon immersed in the magnetic field Masahiko Higuchi 1, Katsuhiko Higuchi 2 1 Department of Physics, Shinshu University, Matsumoto, Japan 2 Graduate School of Advanced Sciences of Matter, Hiroshima University, Higashihiroshima, Japan Abstract The softening in elastic constants of the crystalline silicon has attracted much attention because the density of silicon vacancies can be evaluated from the behavior of the elastic softening [1]. It is also reported that the elastic softening is suppressed by an external magnetic field in the boron-doped silicon[1]. Several authors have studied this phenomena theoretically by using a kind of the model which includes the adjustable or phenomenological parameters in the Hamiltonian[2-7]. It is pointed out that the spin-orbit interaction, which is one of relativistic effects, plays an important role as well as the Zeeman effect[2-7]. In this study, in order to reveal the mechanism of the suppression of the elastic softening, we develop the magnetic-field-containing-relativistic tight-binding approximation method (MFRTB method) [8,9]. This method the first-principles calculation method that enables us to calculate electronic structures of various kinds of crystalline materials immersed in a uniform magnetic field with taking both relativistic and magnetic field effects into account [8,9]. In order to check the validity of the MFRTB method, we apply the MFRTB method to the twodimensional square lattice that is immersed in a uniform magnetic field. It is shown by comparing the present results with Hofstadter s ones [10] that the MFRTB method includes Hofstadter s method [8,9]. Namely, if the spin Zeeman term are neglected, then the MFRTB method reproduces the magnetic-field-dependent energy diagram that is so-called Hofstadter butterfly diagram [8,9]. We apply the present method to the crystalline silicon immersed in a uniform magnetic field, and reveal its energy-band structures that are defined in the magnetic first Brillouin zone [8]. It is found that the widths of energy-bands increase with increasing the magnetic field, which indicates the dependence of the appropriateness of the effective mass approximation on the magnitude of the magnetic field [8]. The recursive energy spectrum, i.e., butterfly patterns, can also be seen in the k -space plane ( kx - k y palne) perpendicular to the magnetic field [8], but such characteristic structures disappear in the bands [8]. k z axis due to the kz -dependence of energy Referernces 1. T. Goto, H. Yamada-Kaneta, Y. Saito, Y. Nemoto, K. Sato, K. Kakimoto, and S. Nakamura, J. Phys. Soc. Jpn. 75, (2006). 2. H. Matsuura and K. Miyake, J. Phys. Soc. Jpn. 77, (2008). 3. T. Yamada, Y Yamakawa and Y. Ono, J. Phys. Soc. Jpn. 78, (2006). 4. T. Ogawa, K. Tsuruta and H. Iyetomi, Solid State Comm. 151, 1605 (2011). 56

84 5. S. Baba, T. Goto, Y. Nagai, M. Akatsu, H. Watanabe, K. Mitsumoto, T. Ogawa, Y. Nemoto and H. Yamada-Kaneta, J. Phys. Soc. Jpn. 80, (2011). 6. K. Okabe, M. Akatsu, S. Baba, K. Mitsumoto, Y. Nemoto, H. Yamada-Kaneta, T. Goto, H. Saito, K. Kashima, and Y. Saito, J. Phys. Soc. Jpn. 82, (2013). 7. K. Mitsumoto, M. Akatsu, S. Baba, R. Takasu, Y. Nemoto, T. Goto, H. Yamada-Kaneta, Y. Furumura, H. Saito, K. Kashima, and Y. Saito, J. Phys. Soc. Jpn. 83, (2014). 8. K. Higuchi, D. B. Hamal and M. Higuchi, Phys. Rev. B 91, (2015). 9. D. Hamal, M. Higuchi and K. Higuchi, Phys. Rev. B 91, (2015). 10. D. R. Hofstadter, Phys. Rev. B. 14, 2239 (1976). 57

85 (Room 110) 20 June 2016, 11:00-11:30 AM The Small System Method To Compute Thermodynamic Data For 3D And 2D System Thuat T. Trinh, 1 Nora Eriksen, 1 Signe Kjelstrup, 1 Dick Bedeaux, 1 and Sondre Schell 2 1 Department of Chemistry, Norwegian University of Science and Technology, NTNU, Norway 2 Department of Chemistry and Materials Technology, Norwegian University of Science and Technology, NTNU, Norway Abstract We will give an introduction to a computational method, the so-called Small System Method (SSM) developed by Schnell et al. [1]. This method provides thermodynamic properties of macroscopic systems by extrapolating properties of systems of molecular dimensions. Appropriate scaling laws for small systems were derived using the method for small systems thermodynamics presented by Hill [2]. We will show how we can obtain the thermodynamic properties such as thermodynamic correction factor, chemical potential, activity coefficient, entropy and partial enthalpy directly from simulation. Some example of 3D system and 2D system with and without reactions will be presented. We employed the method for pure carbon dioxide (CO 2) and carbon dioxide mixtures with methane (CH 4) adsorbed in layers on a graphite surface[3, 4]. We also implemented a tool to compute Small System Method in the popular simulation package LAMMPS. A recent work combining SSM with reactive force field, ReaxFF, to study hydrogen reactions will also be discussed. Referernces 1. S.K. Schnell, T.J.H. Vlugt, J.-M. Simon, D. Bedeaux, S. Kjelstrup, Thermodynamics of a small system in a µt reservoir, Chemical Physics Letters, 504 (2011) T.L. Hill, Thermodynamics of small systems, DoverPublications. com, T.T. Trinh, T.S. van Erp, D. Bedeaux, S. Kjelstrup, C.A. Grande, A procedure to find thermodynamic equilibrium constants for CO 2 and CH 4 adsorption on activated carbon, Phys. Chem. Chem. Phys., 17 (2015) T. Trinh, D. Bedeaux, J.-M. Simon, S. Kjelstrup, Thermodynamic Characterization Of Two Layers Of CO 2 On A Graphite Surface, Chemical Physics Letters, 612 (2014)

86 (Room 110) 20 June 2016, 11:30-12:00 AM Many-body theory of an interacting Bose Einstein condensate at finite temperatures Shohei Watabe Depeartment of Physics, Tokyo University of Science, Shinjuku-ku, Tokyo, Japan Abstract Bose--Einstein Condensation is an interesting phenomenon strongly related to superfluidity. In an ideal Bose gas, the single-particle ground state is occupied by a macroscopic number of atoms. In an interacting Bose gas, this statement is modified, and the Bose--Einstein condensation is well defined by the off-diagonal long-range order. If we try to described this interacting Bose gas within the mean-field theory, we confront with some problems. In particular, the Hartree-Fock-Bogoliubov approximation, one of the mean-field theory, does not satisfy the Hugenholtz-Pines theorem, which leads the gapless excitation, and the Hartree-Fock- Bogoliubov-Popov approximation, also one of the mean-field theory, does not satisfy Nepomnyashchii--Nepomnyashchii identity, which leads the zoros of the off-diagonal selfenergy, specific to the BEC phase, in the low-energy limit. In this talk, we will introduce our theories beyond these mean-field approximations, and discuss which theory satisfy the Nepomnyashchii--Nepomnyashchii identity. I will also discuss the effect of the critical temperature shift caused by the repulsive interaction between bosonic atoms. This talk is based on our work [1,2]. Referernces 1. S.W., and Y. Ohashi, PHYSICAL REVIEW A 88, (2013). 2. S.W., and Y. Ohashi, PHYSICAL REVIEW A 90, (2014). 59

87 (Room 110) 20 June 2016, 12:00-12:30 PM 3D Visual Analyse of Materials Processing Rongshan Qin 1,2 1 Department of Engneering & Innovation, the Open University, Milton Keynes MK7 6AA,UK 2 Department of Materials, Imperial College London, Exhibition Road, London SW7 2AZ, UK Abstract We have developed a comprehensive visual analysis tool and associated computational code package to support the modelling of materials processing. The methods involving in the modelling include the mesoscopic multiphase and multicomponent hydrodynamic models such as lattice Boltzmann equation, dissipative particle dynamics and smoothed particle hydrodynamics [1, 2], the phase transition and microstructure simulation models such as the phase-field model [3], cellular automata [4] and information computing [5], and the electricthermo-mechanical processing models such as electropulsing treatment [6]. The 3D visual analysis package enables to bring forward all the scientific information in a virtual space [7]. This helps to understand the mechanism behind the processing and provide suggestions to the further development and optimization of the processing. I will demonstrate in this presentation our most recent advances in rocessing of novel materials using the package. This include the processing of super clean steel, engineering alloys regeneration and simulation of multicomponent reactive fluids. Figure 1 demonstrates the temperature profile causes by a passing electric current in a steel containing many inclusions. Fig 1. Electropulse-induced temperature profile in a metal containing inclusions. 60

88 Referernces 1. R.S. Qin, J. Chem. Phys., 126, (2007). 2. R.S. Qin, Phys. Rev. E, 73, (2006). 3. R.S. Qin and H.K.D.H. Bhadeshia, Mater. Sci. Technol., 26, 803(2010). 4. Y. Zhao, R.S. Qin, and D.F. Chen, J. Cryst. Growth, 377, 72 (2013). 5. A. Rahnama and R.S. Qin, Comp. Mater. Sci., 96, 102 (2015). 6. R.S. Qin, Mater. Sci. Technol., 31, 203 (2015)

89 (Room 110) 20 June 2016, 14:00-14:30 PM SEM beyond imaging in situ SEM experiments Ifat Kaplan-Ashiri Department of Chemical Research support, Weizmann Institute of Science, Rehovot, Israel Abstract Scanning electron microscopy - SEM is extensively used in life, chemical and physical sciences. Its ability to image surface details and morphology at different length scales, from millimeter to nanometer, together with its remarkable depth of focus makes it an excellent imaging tool for a wide variety of samples. Nanoparticles are routinely imaged with electron microscopy, both scanning and transmission; where their properties such as size and shape can be easily observed. Characterization of nanoparticles mechanical and electrical properties can be achieved using designated tools like probe stations or tensile/bending testing systems on ensembles of nanoparticles. Performing electrical or mechanical measurement on a single nanoparticle is challenging and requires the fabrication of special devices. One of the approaches is to miniaturized experimental set-ups like bending or tensile test systems and place them inside the chamber of an electron microscope, such as SEM. This in-situ SEM approach enables simultaneously imaging and measurements of single nanoparticles. Several in-situ SEM experiments that were performed on single inorganic (WS 2) nanotubes and fullerene like nanoparticles will be presented. Tensile, bending, buckling, compression were all performed as well as wetting and adhesion studies. The special set-ups and the results will be discussed in details as well as the challenges and advantages of in-situ SEM measurements. 62

90 (Room 110) 20 June 2016, 14:30-15:00 PM Magnetically Guided Micro- and Nanomachines Salvador Pané Multi-Scale Robotics Lab, Institute of Robotics and Intelligent Systems (IRIS), ETH Zurich, CH-8092 Zurich, Switzerland Abstract Last decade has seen a significant progress in the fabrication of small unthetered micro- and nanomachines capable of swimming in several environments by means of different actuation approaches. The motion of these micro and nanoscale objects can be basically triggered by environmental chemical fuel, or by external power sources such as electrical fields, magnetic fields, or ultrasounds. However, rendering motion to micro- and nanoscale structures entails several challenges. One of the main obstacles is building the optimal shape, which can provide a specific kind of locomotion to the micro- or nanoswimmer. Additional hurdles arise when integrating functional components on-board. Electrochemical manufacturing techniques have been used in the fabrication of small robots [1 4]. In general, these fabrication methods enable the integration of several materials and they are highly compatible with other fabrication methods. Also, high troughput production can be accomplished with electrochemical manufacturing using organic or inorganic templates (Fig. 1). Besides, fine-tuning of materials composition and properties can be achieved in one-pot by changing, for instance, the potential deposition. In this work, we will introduce several twoand three-dimensional magnetic micro- and nanoagents that have been fabricated in our laboratory, in which electrochemical manufacturing has played a crucial role for their fabrication and development. The influence of shape and magnetic properties on the magnetic manipulation will be also presented. 2 µm Fig 1. Batch-fabricated alloy microhelices obtained by electrodepositing the material in threedimensional arrays. These templates are fabricated by means of two-photon polymerization. 63

91 Referernces 1. M. A. Zeeshan, R. Grisch, E. Pellicer, K. M. Sivaraman, K. E. Peyer, J. Sort, B. Ö zkale, M. S. Sakar, B. J. Nelson and S. Pané, Small 10, 1284 (2014). 2. S. Fusco, G. Chatzipirpiridis, K. M. Sivaraman, O. Ergeneman, B. J. Nelson and S. Pané, Adv. Healthcare Mat. 2, 1037 (2013). 3. S. Schuerle, S. Pané, E. Pellicer, J. Sort, M. D. Baró and B. J. Nelson, Small 8, 1498 (2012) 4. M. A. Zeeshan, S. Pané, S. K. Youn, E. Pellicer, S. Schuerle, J. Sort, S. Fusco, A. M. Lindo, H. G. Park and B. J. Nelson, Adv. Funct. Mat. 23, 823 (2013). 64

92 (Room 110) 20 June 2016, 15:00-15:30 PM Investigation of Pd nanoparticles on Al2O3/NiAl(110) under CO gas by AFM/ KPFM Yan Jun Li, Hirotaka Yokoyama, Tomohiro Watanabe, Masafumi Tada, Yoshitaka Naitoh, Yasuhiro Sugawara 1 Department of Applied Physics, Graduate School of Engineering, Osaka University, Yamadaoka 2-1, Suita, Osaka, , Japan Abstract Metal nanoparticles supported by a metal oxide are known to enhance the catalyst and those catalytic systems are widely used, such as the three-way catalyst. So far many researchers have investigated the specific behavior of metal nanoparticles and the influence of the substrate with CO molecules [1]. However, the details of electrons transfer are unknown and still remain challenge. In this study, we adsorb palladium nanoparticles (Pd NPs) on Al 2O 3/NiAl (110) using home-built evaporator and investigate Pd NPs under CO gas condition by AFM/ KPFM. We measure local contact potential difference (LCPD) for the adsorption of CO molecules on the interface between Pd NPs and Al 2O 3 thin film, and the results of LCPD demonstrate the back donation of electrons to CO molecules. Our experiments were performed in an UHV with a home-built RT microscope. We have selected as a probe the stiffest possible Si cantilever with the spring constant of 1000 N/m and the resonance frequency of 1 MHz. This setup is capable of small amplitude operation and of enhancing the short-range interaction force and hence also the spatial resolution. The Si tip apex was cleaned by Ar + ion sputtering in situ. As a substrate, we used a NiAl(110) single crystal, which first prepared by repeated cycles of Ar + ion sputtering and subsequent annealing. More details can be found in Ref. [2]. Second, Pd atoms were deposited on the alumina film using the electron-beam evaporation method. Finally, the CO gas was exposed under the pressure of 1x10-7 Torr. Fig 1. (a) Topographic image of Al 2O 3 on NiAl(110) surface, (b) side view and (c) line profile of Al 2O 3 thin film. 65

93 Figure 1 shows a straight and zigzag line defects were observed on Al 2O 3/NiAl(110) surface. The height of Al 2O 3 thin film is apprioximately 0.5nm, which is in agreement with the theoretical value. Generally, metal fine particles are predicted easy to adsorb on defects after the Pd atoms deposited on the Al 2O 3/NiAl(110) surface, we found that the Pd NPs were observed as bright spots on the line defects as shown in figure 2(a) by AFM. At the same time, the V LCPD image was measured by KPFM as shown in figure 2(b). We found that the V LCPD of Pd NPs increases with the size, and the Pd NPs are charged with electrons. The more electrons transfer from the NiAl(110) substrate to Pd NPs with the size increasing. Fig 2. Pd nanoparticles deposited on Al 2O 3 /NiAl(110) surface. (a) Topographic image, (b) V LCPD image, (c) large scale image of Pd cluster and (d) schematic view. Fig 3. Pd nanoparticles on Al 2O 3 /NiAl(110) surface under CO gas condition. (a) Topographic image, (b) schematic view, (c) line profile. Fig 4. Pd nanoparticles on Al 2O 3/NiAl(110) surface under CO gas condition. (a) Topographic image and line profile, (b) V LCPD image and line profile. 66

94 After CO gas revelation, the CO part which became dented (80pm) around Pd NPs was observed as shown in figure 3(a). And the LCPD of CO parts increase (see line profile of V LCPD image in figure 4(b)). We will suggest the model to explan the above result. References 1. Yoon et al., Science 307, 21 (2005). 2. Y. J. Li et al., Nanotech. 26, 50 (2015). 67

95 (Room 110) 20 June 2016, 15:30-15:45 PM Systematic Control of the Size, Density and Configuration of Pt Nanostructures on Sapphire (0001) by the Variation of Deposition Amount and Dwelling Time Quanzhen Zhang 1, Puran Pandey 1, Mao Sui 1, Ming-Yu Li 1, Sundar Kunwar 1 and Jihoon Lee 1, 2* 1 College of Electronics and Information, Kwangwoon University, Nowon-gu Seoul , South Korea 2 Institute of Nanoscale Science and Engineering, University of Arkansas, Fayetteville AR 72701, USA Abstract Fig 1. Evolution of Pt nanostructures on sapphire (0001) with the systematic variation of deposition amount (DA) between 1 and 100 nm and annealed at 900 ºC for 450 s. (a) (l) Atomic force microscopy (AFM) top-views. (a) (d) 1 1 µm 2. (e) (h) 3 3 µm 2. (i) (l) 5 5 µm 2. Metal nanoparticles with controllable size, density and configuration can significantly enhance the energy conversion efficiency, detection sensitivity and oxygen reduction reaction (ORR) as 68

96 witnessed in various optoelectronic, [1-3] optical sensing [4, 5] and electro-catalytic devices, [6-8] and the size, density and even the shape of the metal nanoparticles can significantly affect the performance of these devices. In this work, with the variation of deposition amount (DA) and dwelling time (DT), we systematically investigate the evolution of the size, density and configuration of Pt nanoparticles on sapphire (0001). In general, with the increased DA variation, four phases of Pt nanostructures are fabricated through atomic surface diffusion and homogeneous nucleation based on the Volmer-Weber growth model and surface energy minimization mechanism: (1) mini-droplets with the DA between 1 and 5 nm, (2) large-sized Pt droplets with the DA of 10 and 15 nm DA, and (3) irregular isolated Pt nanostructures with the DA of 20 and 30 nm, and (4) coalesced Pt nanostructures with the DA over 40 nm. On the other hand, with the increased dwelling time between 0 and 450 s, the size of the Pt nanopsrticles is grudally expanded accompanied with the descreased density, which the evolution can be explained by the Ostwald ripening. However, with the further increased dwelling time to 1800 s, the size of the Pt nanoparticles shows slightly expansion, which indicates that the growth of the Pt nanoparticles is saturated. Acknowledgements Financial support from the National Research Foundation of Korea (no and 2016R1A1A1A ), and in part by the research grant of Kwangwoon University in 2016 is gratefully acknowledged. Referernces 1. H. Sun, M. Yu, G. Wang, X. Sun, J. Lian, J. Phys. Chem. C 116, (2012). 2. L. Qiao, D. Wang, L. Zuo, Y. Ye, J. Qian, H. Chen, S. He, Appl. Energ. 88, (2011). 3. X. Chen, L. Zuo, W. Fu, Q. Yan, C. Fan, H. Chen, Sol. Energ. Mat. Sol. C. 111,1-8 (2013). 4. M. U. Qadri, A. F. D. Diaz, M. Cittadini, A. Martucci, M. C. Pujol, J. Ferre-Borrull, E. Llobet, M. Aguilo, F. Diaz, Sensors 14, (2014). 5. A. I. Kuznetsov, A. B. Evlyukhin, M. R. Gonçalves, C. Reinhardt, A. Koroleva, M. L. Arnedillo, R. Kiyan, O. Marti, B. N. Chichkov, Acs Nano 5, (2011). 6. K. J. J. Mayrhofer, B. B. Blizanac, M. Arenz, V. R. Stamenkovic, P. N. Ross, N. M. Markovic, J. Phys. Chem. B 109, (2005). 7. S. Garbarino, A. Pereira, C. Hamel, E. Irissou, M. Chaker, D. Guay, J. Phys. Chem. C 114, (2010). 8. C. Baldizzone, S. Mezzavilla, H. W. Carvalho, J. C. Meier, A. K. Schuppert, M. Heggen, C. Galeano, J. D. Grunwaldt, F. Schüth, K. J. Mayrhofer, Angew. Chem. Int. Edit. 53, (2014). 69

97 (Room 110) 20 June 2016, 16:00-16:30 PM Synthesis of well-defined 3D printing and biocompatible polymers by living ringopening polymerization Lan-Chang Liang Department of Chemistry, National Sun Yat-sen University, Kaohsiung 80424, Taiwan Abstract Poly( -caprolactone) (PCL) polymers are 3D priting materials that are biodegrable and biocompatible,. This report describes a successful development of well-defined PCLs having controlled architectures, molecular weights and molecular weight distributions by means of living ring-opening polymerization catalysis. In this regard, a series of group 4 metal complexes containing amine- or phosphine-bridged biphenolate ligands (Figure 1) was synthesized, structurally characterized, and employed to examine their catalytic activities with respect to ring-opening polymerization of -caprolactone.[1-5] Subtle changes on molecular compositions of catalysts, in particular ligands substituents and metallic elements, have shown dramatic impacts on catalysis, in terms of catalytic activities, polymeric material architectures, and propagating kinetics, etc. Several living polymerization processes derived from this specific system are exemplified. Fig 1. Representative amine- and phosphine-bridged phenolate chelating ligands Referernces 1. L.-C. Liang, S.-T. Lin, C.-C. Chien, Inorg. Chem. 52, 1780 (2013). 2. L.-C. Liang, C.-C. Chien, M.-T. Chen, S.-T. Lin, Inorg. Chem. 52, 7709 (2013). 3. L.-C. Liang, S.-T. Lin, C.-C. Chien, M.-T. Chen, Dalton Trans. 42, 9286 (2013). 4. L.-C. Liang, Y.-L. Hsu, S.-T. Lin, Inorg. Chem. 50, 3363 (2011). 5. L.-C. Liang, Y.-N. Chang, H.M. Lee, Inorg. Chem. 46, 2666 (2007). 70

98 (Room 110) 20 June 2016, 16:30-17:00 PM Continuous stereolithographic bottom-up 3D printing by means of a liquid-liquid interface for manufacturing functionalized polymeric films Natalia Lopez-Barbosa 1, Santiago Jumah 1, Nicolas Zuluaga 1, Johann F. Osma 1 1 CMUA, Department of Electrical and Electronics Engineering, University of los Andes, Cra. 1E No. 19 a 40, Bogota, DC , Colombia Abstract A stereolithographic 3D printer was used to fabricate functionalized polymeric films by means of a liquid-liquid interface, a dynamic mask and near UV radiation for continuous printing. The polymeric films were easily tuned to be either hydrophilic or hydrophobic by changing the length of the monomer in the resin polymer. Hydrophilic films showed to react towards polar liquids by folding in the opposite direction of the exposed surface so that the diacrylate groups of the polymer remaimed exposed to the polar liquid. In addition, the 3D printer tested resolution of about 8 m 3 allowed us to decrease the thickness of the films until a point where they were translucent to the naked eye. In this way, 3D printing was used as a tool for fabricating functionalized films that can be easily tuned to change their adhesion forces and hygroscopic properties. 71

99 (Room 111) 20 June 2016, 09:30-10:00 AM Solid State Lithium Conduction and Disorder in Complex Oxides E. J. Cussen 1, M. Amores, 1,2 I. Cascallana-Matias, 1,2 D.H. Gregory, 2 S. A. Corr 2 1 Department of Pure and Applied Chemistry, University of Strathclyde, Glasgow G1 1XL, UK 2 School of Chemistry, University of Glasgow, Glasgow G12 8QQ, UK Abstract The conventional model of a solid crystal portrays atoms as immobilised on well defined positions in space. This regular structure is evident in the highly defined order and symmetries of the diffraction patterns obtained from crystalline materials. However, there are a number of crystalline solids where a subset of the atoms show a high degree of mobility. In some of these phases, ions are able to move at speeds approaching those in molten salts or solutions. This ion mobility may be associated with very substantial disorder in the lattice and dramatic changes in the diffraction properties of the crystal. We will present work on fast lithium conducting solids where the mobility of Li+ makes these potential solid state electrolytes for improved lithium batteries. In addition to synthesising new materials, we use a combination of neutron diffraction, impedance analysis, solid state NMR and muon relaxation measurements to build a full picture of the origins and properties of lithium transport through these structures. Specific examples will be drawn from lithium stuffed garnet electrolytes [1] and highly disordered fast ion conductors based on LiBH 4.[2] Referernces 1. M. Amores, T.E. Ashton, P.J. Baker, E.J. Cussen and S.A Corr, Journal of Materials Chemistry A, 4, 1729 (2016). 2. I. Cascallana-Matias, D.A. Keen, E.J. Cussen and D.H. Gregory, Chemistry of Materials, 27, 7780, (2015). 72

100 (Room 111) 20 June 2016, 10:00-10:30 AM Control of the ratio of incident flux of ions to neutral species onto substrates to achieve high-carrier-mobility transparent conductive oxide films deposited by a high-growthrate Reactive Plasma Deposition Hisashi Kitami 1,2, J. Nomoto 2, T. Sakemi 1, H. Makino 2, Y. Aoki 1, T. Yamamoto 2, T. Kato 1 1 Sumitomo Heavy Industries, Ltd., Yokosuka-shi, Kanagawa, Japan. 2 Research Institute, Kochi University of Technology, Kami-shi, Kochi, Japan Abstract Reactive plasma deposition (RPD) is a commercially available ion plating system with dc arc discharge for thin film deposition. [1-3] The major application includes flat-panel displays and photovoltaic cells. The RPD method enables us with the growth of transparent conductive oxide (TCO) films exhibiting low electrical resistivity and high visible transmittance, such as indium tin oxide (ITO) and gallium doped zinc oxide (GZO) films, at a low substrate temperature (T s). The feature of RPD technique is to achieve TCO films with high quality at a high growth rate at any T s compared with that of the conventional sputtering technique. [2-5] As a qualitative research necessary to solve them, very recently, we have been developing an original analytical approach to clarify the characteristics of the incident particle flux that strongly depends on the deposition parameters; oxygen (O 2) gas flow rates (OFRs) and discharge current (I D). [5] The O 2 gas is introduced into the deposition chamber during the film growth to control the oxygenrelated point defects. In our previous work on ITO films, we demonstrated a quantitative analysis of ionization rates of incident particles, such as neutral particles and ions, using a massenergy analyzer (Hiden, EQP300) and a Langumuir probe during the deposition. [6] We had an issue to be resolved: Those ionization rates were estimated to be low limit because of an incident energy dependence of ions through the ionization chamber inside the mass-energy analyzer. In our present study, we present a resolution: We carried out a comparison of the incident fluxes of neutral particles with ions for each species onto the substrate. The incident particle flux and their energy were measured by the mass-energy analyzer. The characteristics of plasma outside the mass-energy analyzer were studied thorough theoretical analysis of the date obtained by the Langmuir probe measurements to determine the transmission efficiency of neutral particles and ions through the ionization chamber inside the mass-energy analyzer. In addition, we crosscheck the plasma potential measured by the mass-energy analyzer. In this study, to elucidate the influence of flying species on the structural and electrical properties of GZO films, we have investigated the factors limiting the deposition rate of GZO films deposited on glass substrates by RPD. We deposited GZO films on glass substrate at a T s of 200 C by RPD. The evaporation source was sintered ceramic ZnO containing the Ga 2O 3 contents of 4 wt.%. The flow rate of Ar gas was at 140 sccm. The OFRs and I Ds were varied from 0 to 20 sccm and from 100 to 140 A, respectively. We measured the incident particle flux of the neutral particles and ions for each species simultaneously at the substrate level during the deposition. Using the data obtained by 73

101 the simultaneous measurement with an energy separation in the mass-energy analyzer, we simulate the state of the deposition of neutral particles and ions on the substrate. Fig. 1 shows measurement flowchart of neutral particles and ions in the mass-energy analyzer. The ionization rates (R) of incident particles flux were caluculated using following equations: R = N i N i.cnt =, (1) N n + N i (N n.cnt /α(v S )) + N i.cnt α(v S ) = α n α i (V S ) = N i N n N n.cnt N i.cnt (V S ), (2) where N i and N n are the total number of ions and neutral particles incident on the mass-energy analyzer, respectively. The channel electron muliplier in the mass energy analyzer detected N i.cnt (= N i α i T Mass G Mass) and N n.cnt (= N n α n T Mass G Mass), where N i.cnt and N n.cnt are the number of counts for ions and neutral particles on the mass-energy analyzer, respectively. α is the transmission efficiency of incident particles for comparing the ions and neutral particles in the ionization chamber inside the mass-energy analyzer. V S is the plasma potential. α i and α n are the transmission efficiency of ions and neutral partcles in the ionization chanmber inside the mass-energy analyzer, respectively. T Mass is the transmission efficiency of each masses in the quadrupole mass filter, and G Mass is the gain of each masses in the channel electron multiplier. T Mass and G Mass are known to depend on the mass by Hiden. The detection of ions and neutral partciles with the same otptical condition enables us with the comparison of the ions with neutral particles for each species. Fig 1. Measurement flowchart of neutral particles and ions in the mass-energy analyzer. Figure 2 shows the growth rates with different I Ds as a function of OFR. We found that the growth rates tend to increase with increasing I D at any given OFR. For lower OFR values of 0 to 15 sccm, we observed that the growth rates were limited by the above two deposition parameters. With further increasing OFRs up to 20 sccm, I D became the dominant factor of the growth rates. At any given I D, we found a little difference in the growth rates between OFRs values of 15 and 20 sccm. 74

102 Fig 2. Growth rates of GZO films with different I Ds as function of OFR. Fig 3. Growth rates of GZO films with different I Ds as function of oxygen species. To obtain a better understanding of the behavior of growth rates as a function of I D at any given OFR, we compared growth rates with zinc species such as Zn and Zn + flux and oxygen species such as O, O + and O 2 + flux. The comparison provides us with the growth mechanisum of GZO films by RPD. The quantity of zinc particle species were found to change a little, from to a.u., at any OFR and I D. Then, we focus on the roles of the oxygen species on the growth rates. Figure 3 shows the growth rates as a function of oxygen species. The analysis shows the following characteristics of the growth-rates behavior of GZO films: The sum quantity of oxygen speicies such as O, O + and O 2 + play an important role on the film growth. At an OFR value of 0 sccm, the oxygen species are supplied only from the evaporation source and the growth rates slowly increases with increasing the sum quantity of oxygen species that is proportional to the I Ds. On the other hand, for OFRs ranging from 5 to 20 sccm, the increase 75

103 in the sum quantity of oxygen species which has the same I Ds dependency as that of OFR=0 sharply increases the growth rates. Considreing that the amount of zinc species flux hardly changed mentioned above, in such desosition conditions, oxygen-related point defects in intragrains and the number of oxygen trapped at grain boundaries in polycrystalline GZO films are expcted to change drastically. The important findings studied thorugh the theoretical analysis on the incident particle flux combined with the experimental results on the film growth rates are as follows: The behavior of the growth rates was determined by the incident fluxes of the minor oxygen-related particles. The above findings imply the strong relationship among growth rates, a microstructure with point defects associated with O species and electrical and optical properties of GZO films. We will discuss it in more detail. Referernces 1. T. Sakemi, M. Tanaka, U.S. Patent (1997). 2. M. Tanaka, H. Makino, R. Chikugo, T. Sakemi, K. Awai, J. Vac. Soc. Jpn. 44, 435 (2001). 3. K. Iwata, T. Sakemi, A. Yamada, P. Fons, K. Awai. T. Yamamoto, M. Matsubara, H. Tampo, S. Niki, Thin Solid Films 445, 274 (2003). 4. T. Yamamoto, T. Sakemi, K. Awai, and S. Shirakata, Thin Solid Films , 439 (2004). 5. J. Nomoto, H. Makino, T. Yamamoto, Thin Solid Films 601, 13 (2016). 6. H. Kitami, M. Miyashita, T. Sakemi, Y. Aoki, T. Kato, Jpn. J. Appl. Phys. 54, 01AB05 (2015). 76

104 (Room 111) 20 June 2016, 11:00-11:30 AM Layered oxychalcogenides as promising thermoelectric materials Paz Vaqueiro 1, Son D. N. Luu 1, Gabin Guélou 1, R. A. R. Al Orabi, 2 D. Wee, 3 M. Fornari 2 1 Department of Chemistry, University of Reading. Whiteknights, Reading RG6 6AD, UK 2. Department of Physics, Central Michigan University, Mt. Pleasant, MI 48859, USA. 3 Department of Environmental Science and Engineering, Ewha Womans University, Seoul, South Korea. Abstract Thermoelectric energy recovery enables the conversion of waste heat into useful electricity. The principal barrier to the widespread adoption of thermoelectric power generation is the relatively high cost per watt of electrical energy produced. The need for alternative energy generation technologies has led to a tremendous growth of research into materials with good thermoelectric performance, which would make thermoelectric power generation competitive with other technologies. The performance of a thermoelectric material is expressed in terms of a figure of merit, ZT, related to the Seebeck coefficient (S), electrical conductivity ) and thermal conductivity ( ) by ZT = S 2 T/ Layered oxychalcogenides have recently emerged as highly promising thermoelectric materials. The alternation of ionic oxide and covalent chalcogenide layers found in these materials can result in remarkable electronic and thermal transport properties and also facilitates the tuning of their properties via chemical substitution at both layers. In particular, layered oxychalcogenides often have unusually low thermal conductivities, in the range found for amorphous materials, and this can result in excellent ZT values, as exemplified by Bi 0.95Pb 0.05OCuSe (ZT = 0.65 at only 673 K).[1] To date, the most promising thermoelectric performances have been reported for the family of [MO][CuQ] oxychalcogenides (M= rare earth element, Bi; Q = S, Se, Te), which are composed of alternating fluorite [A 2O 2] 2+ and antifluorite [Cu 2Q 2] 2- layers (Fig. 1a) and are p-type semiconductors. We present here our recent results on this family of materials,[1,2,3] including first principles calculations combined with analysis of neutron diffraction data, which demonstrate that weak bonding of copper atoms leads to an unexpected vibrational mode at low frequencies, which is likely to be a major contributor to low thermal conductivity.[4] We also present work on other structurally-related oxychalcogenides, including [Bi 2YO 4][Cu 2Se 2] (Fig. 1b), which is a p-type metal, and on the n-type semiconductor Bi 2O 2Te (Fig. 1c).[5] 77

105 Fig 1. The crystal structures of (a) [BiO][CuQ] (b) [Bi 2YO 4][Cu 2Se 2] and (c) Bi 2O 2Te. Referernces 1. S.D.N. Luu, P. Vaqueiro, J. Mater. Chem. A 1, (2013). 2. P. Vaqueiro, G. Guélou, M. Stec, E. Guilmeau, A.V. Powell, J. Mater. Chem. A 1, 520 (2013). 3. S.D.N. Luu, P.Vaqueiro, Semicond. Sci. Technol. 29, (2014). 4. P. Vaqueiro, R. A. R. Al Orabi, S. D. N. Luu, G. Guélou, A. V. Powell, R. I. Smith, J.-P. Song, D. Wee, M. Fornari, Physical Chemistry Chemical Physics 17, (2015). 5. S. D. N. Luu, P. Vaqueiro, J. Solid State Chem. 226, 219 (2015). 78

106 (Room 111) 20 June 2016, 11:30-12:00 AM Themoelectric Materials for Energy Harvesting from Waste Heat Anthony V Powell, Jesus Prado-Gonjal, Gabin Guélou, Panagiotis Mangelis and Paz Vaqueiro Department of Chemistry, University of Reading, Whiteknights, Reading RG6 6AD, UK. Abstract Thermoelectric devices convert thermal energy directly into electricity, making them attractive candidates for energy harvesting applications. The device efficiency is determined by the performance of the constituent n- and -p-type semiconducting materials, embodied in a dimensionless figure-of-merit, related to the Seebeck coefficient (S), electrical conductivity ( ) and thermal conductivity ( ) by ZT = S 2 T/. Commercial thermoelectric modules, with ZT 1 at room temperature, are comprised of alloys of Bi 2Te 3. However the loss of performance and degradation that can occur at elevated temperatures renders Bi 2Te 3 unsuitable for use in power generators. In addition, the wide scale implementation of bismuth telluride based devices is restricted by the relatively low terrestrial abundance of Te. In the search for new high-efficiency thermoelectric materials containing earth-abundant elements, our research has focused on materials for power generation from waste heat at temperatures appropriate to vehicle exhaust streams and industrial processes. Here, we describe some of the approaches that we have adopted to address the challenge of simultaneously optimizing the three inter-dependent properties, S, and, that exhibit differing dependencies on charge carrier density. Skutterudites derived from CoSb 3 are attractive candidates for vehicle exhaust applications. The structure consists of vertex linked CoSb 6 octahedra. This generates a large cavity (Figure 1) into which weakly-bound filler species can be introduced. The resulting localized vibrational modes (rattling modes) of the filler, serve to scatter heat-carrying phonons, thereby reducing the lattice component ( L) of the thermal conductivity, without impairing the electrical properties. Recent work will be described, in which chemical substitution has been used to create a series of isoelectronic frameworks (Co 1-2xFe xni xsb 3). The mixed-frameworks exhibit marked reductions in thermal conductivity, even in the absence of filler species. Further improvements in thermoelectric performance have been achieved by the use of multiple filler species with different masses. This leads to rattling modes of different frequencies, which promotes phonon scattering over a wider range of the phonon spectrum. In an alternative strategy, we have sought to exploit the marked tendency of metal chalcogenides to adopt low-dimensional structures, which favours a highly structured density of states (DOS), in which there are sharp discontinuities. Tuning the Fermi level (E F) to such a discontinuity can significantly enhance the Seebeck coefficient, which is related to the derivative of the DOS at E F. We have investigated Fermi level tuning in shandite Co 3Sn 2S 2; a pseudo layered structure (Figure 2) containing Co 3Sn layers capped by sulphur atoms, with successive layers linked through additional Sn atoms. Chemical substitution at either the cobalt or tin sites can be used to tune E F [1, 2]. This produces a significant enhancement of the Seebeck 79

107 coefficient, markedly increasing ZT which reaches 0.32 at 673 K; amongst the highest values reported for a sulphide at this temperature. Improvements in the figure of merit can also be realized by intercalation of electropositive species into the inter-layer space of the layered sulphide, TiS 2 [3]. Intercalation leads to charge transfer from the cationic guest into the 3d-derived band of TiS 2 increasing the electrical conductivity. At high levels of intercalation, the increased charge-carrier density has an adverse impact on the thermal conductivity, owing to the increased electronic component ( el), and on the Seebeck coefficient, whilst L is also increased as the result of ordering of guest species. However, at low levels of intercalation, the increase in electrical conductivity is sufficient to offset any reduction in Seebeck coefficient, whilst the disordered arrangement of guest species reduces the lattice component of the thermal conductivity, L. Together, these effects produce a 25 % increase in the figure of merit over that of the parent TiS 2 phase. Fig 1. The skutterudite structure consisting of vertex-linked CoSb 6 octahedra (pink) with filler species (blue) located in the cavities. Fig 2. The low-dimensional structures of (left) shandite, with cobalt, tin and sulphur atoms shown in blue, red and yellow respectively and (right) TiS 2, with TiS 6 octahedra denoted in blue. 80

108 Referernces 1. J. Corps, P. Vaqueiro and A.V. Powell, J. Mater. Chem. A, 1, 6553, (2013). 2. J. Corps, P. Vaqueiro, A. Aziz, R. Grau-Crespo, W. Kockelmann, J-C. Jumas and A.V. Powell, Chem. Mater., 27, 3946, (2015). 3. G. Guelou, P. Vaqueiro, J. Prado-Gonjal, T. Barbier, S. Hebert, E. Guilmeau, W. Kockelmann and A.V. Powell, J. Mater. Chem. C, in press, DOI: /C5TC04217H. 81

109 (Room 111) 20 June 2016, 12:00-12:30 PM Advances in Thermoelectric Materials with Improved Figure of Merit Helmut Baumgart 1,2, Xin Chen 1,2, Kai Zhang 1,2, 1 Department Electrical and Computer Engineering, Old Dominion University, Norfolk, Virginia, USA 2 ODU-Applied Research Center at Thomas Jefferson National Accelerator Labs, Newport News, Virginia 23606, USA Abstract Nanostructured materials provide a promising engineering approach for improving the figure of merit ZT by lowering the thermal conductivity due to phonon scattering at the pore walls of nanoporous materials. In this study we used nanoporous Si templates with roughly circular pores of 1µm diameter, which were photolithographically aligned with a mask and photoresist into a regular square pattern as shown in Fig. 1. The thermoelectric material was deposited by Atomic Layer Deposition (ALD) technology in an absolute conformal fashion hugging the complex surface morphology of the nanoporous Si template. In order to further enhance phonon scattering multiple PbTe/PbSeTe nanolaminates were deposited on regular flat silicon substrates and on porous Si templates by a thermal ALD system [1, 2]. It is noted that the formation of the PbSe quantum dots is facilitated by the prevailing Volmer-Weber island growth mode during ALD synthesis. Lead bis(2,2,6,6-tetramethyl-3,5-heptanedionato) (Pb(C 11H 19O 2) 2), (trimethylsilyl) telluride ((Me 3Si) 2Te) and (trimethylsilyl) selenide ((Me 3Si) 2Se) were employed as the chemical ALD precursors for lead, tellurium and selenium, respectively. Typically 20 sccm N 2 was used as a carrier gas to transport the chemical precursors into the ALD reaction chamber. The ALD growth temperature was 170 o C. The solid lead precursor was volatilized at a temperature of 140 o C, the liquid Te precursor required heating to 40 o C, and the liquid Se precursor was kept at room temperature. The chamber base pressure was kept at 30 mtorr. The Seebeck coefficient in horizontal direction of double layered PbTe/PbSe, triple layered PbTe/PbSe/PbTe, and multiple layered PbTe/PbSe nanolaminate structures was measured by an MMR Seebeck System. In addition, the Seebeck coefficient was also determined in the vertical direction of the multiple layered PbTe/PbSe nanolaminate structure. The results of the Seebeck measurements clearly indicate that the multiple layered PbTe/PbSe nanolaminate structures grown on porous silicon templates exhibit significantly increased Seebeck coefficients in both horizontal and vertical directions in stark contrast to the case when the same ALD TE nanolaminates are grown on regular planar Si substrates. As theoretically anticipated an enhanced Seebeck coefficient was measured for the case of ALD nanolaminate coatings of porous Si templates and thin porous membranes as seen in Fig. 2, which concomitantly reduce the thermal conductivity even more due to the high air hole porosity with less Si remaining. Because of the larger mean free path of phonons only phonon transport is affected by nanostructuring porous Si templates, while there is negligible effect on electron transport. The combined effect of phonon scattering at the surface of the pore walls of 82

110 the nanopores, plus at the nanolaminate interfaces and at the grain boundaries of ALD synthesized polycrystalline thermoelectric films reduces the thermal conductivity and thus helps to improve ZT. This approach of synthesizing layered nanolaminates of polycrystalline PbTe and PbSe thermoelectric material on nanoporous Si membranes by atomic layer deposition (ALD) technology promises high potential for further improvements of the Seebeck coefficient and the figure of merit ZT. [3] Top view Bottom view Fig 1. FE-SEM micrograph of top and bottom view of porous Si membrane defined Templates are defined with a Mask, photoresist & Photolithography. Fig 2. Top view by FE-SEM of porous Si substrate, where a nanolaminate of 12 alternating layers of PbTe / PbSe (1000 / 1000 cycles) was synthesized by atomic layer deposition ALD technology. The polycrystalline thermoelectric nanolaminate thickness is around 540 nm. 83

111 Referernces 1. K. Zhang, A. D. R. Pillai, M. Tangirala, D. Nminibapiel, K. Bollenbach, W. Cao, H. Baumgart, V. S. K. Chakravadhanula, Christian Kübel, V. Kochergin, Phys. Status Solidi A 211 (6) 1329 (2014). 2. D. Nminibapiel, Kai Zhang, M. Tangirala, Helmut Baumgart, V. S. K. Chakravadhanula, Christian Kübel, Vladimir Kochergin, ECS Journal of Solid State Science and Technology, 3 (4) P95 (2014). 3. A. D. Ramalingom Pillai, K. Zhang, K. Bollenbach, D. Nminibapiel, W. Cao, H. Baumgart, V. S. K. Chakravadhanula, Christian Kübel, V. Kochergin, ECS Journal of Solid State Science and Technology, 3 (6) P207 (2014). 84

112 (Room 111) 20 June 2016, 14:00-14:30 PM Inorganic nanotubes and fullerene-like nanoparticles at the crossroad between materials science and nanotechnology and their applications R. Tenne Department of Materials and Interfaces, Weizmann Institute, Rehovot 76100, Israel Abstract This presentation is aimed at demonstrating the progress with the high-temperature synthesis and characterization of new inorganic nanotubes (INT) and fullerene-like (IF) nanoparticles (NP) from 2-D layered compounds. Two important categories of new IF/INT nanostructures will be discussed in particular: 1. Synthesis of Doped IF/INT of WS 2 (MoS 2) by rhenium and niobium; 2. Synthesis of IF and in particular INT from the ternary misfit compounds, like PbS- TaS 2, CaCoO-CoO 2 and numerous others. [1] The synthesis of 1-D nanostructures (nanotubes) from this vast group of layered materials is particularly promising. Major progress has been achieved in elucidating the structure of INT and IF using advanced microscopy techniques, like aberration corrected TEM and electron tomography. Recent optical, electrical and mechanical measurements of WS 2 nanotubes will be discussed. Re-doped IF- MoS 2 NP exhibit superior solid lubrication behavior in different environments and can find numerous applications in e.g. medical technology, which will be briefly demonstrated. [2] Applications of the IF/INT as superior solid lubricants and for reinforcement of polymer, as well as other nanocomposites, which gained a lot of momentum in recent times, will be briefly discussed. Few recent studies indicate that this brand of nanoparticles is non-toxic and biocompatible. With expanding product lines, manufacturing and sales, this generation of superior lubricants is becoming gradually an industrial commodity. Referernces 1. L.S. Panchakarla et al., J. Phys. Chem. Lett. 5, 3724 (2014) 2. A. Sedova et al., Nanomater. & Energy, 4, 30 (2014) 85

113 (Room 111) 20 June 2016, 14:30-15:00 PM Development of Novel Synthetic Method of Glucose-Binding Silver Nanoparticles and Biosensing Applications Junichi Kurawaki, R. Hanada, A. Kaminaga, Y. Niidome Department of Chemistry and Bioscience, Kagoshima University, Kagoshima , Japan Abstract Silver nanoparticles (AgNPs) have a unique property depending on the size, shape, and surface structure. In addition, their applications for the high sensitive biosensors and spectroscopic analysis techniques are expected because of AgNPs illustrates absorption band derived from surface plasmon and significant electric field enhancement phenomena. AgNPs is generally prepared by two-step synthesis, adding a reductant and a protecting agent stepwise to silver nitrate solution. We have developed a facile one-pot synthesis method of AgNPs by using a p-sulfanilic aniline derivative (C9-Glc, Fig.1) which has functionality, protection ability and reduction ability at the same time. Based on the results of absorption spectra and TEM images, particle size of monodispersed AgNPs was determined to be about 22.7 nm. In addition, a surface state of AgNPs was confirmed as polycrystalline Ag by EDX, electronic diffraction, and XPS. Fig 1. Molecular structure of p-sulfanilic aniline derivative (C9-Glc). Fig 2. Absorption spectra of AgNPs in the absence (a) and the presence (b) of Con A, and SEM image of Con A binding AgNPs. 86

114 Moreover, we carried out the detection limit detection of the model protein using C9-Glubinding AgNP We used these AgNPs as a biosensor to monitor molecular interaction between C9-Glc and concanavalin A (Con A) using absorption and vibrational spectroscopic techniques. When we added Con A to monodispered AgNPs prepared, they became into the aggregated state. Intensity of absorption peak around 420 nm was decreased and shifted toward longer wavelength with addition of Con A. Aggregation of AgNPs was also confirmed by SEM and TEM images. As shown in Fig. 2, the absorbance of AgNPs was decreasing, and a broad band is appearing around 600nm. In the SEM image of Fig. 2, AgNPs were aggregated upon addition of Con A. Our results suggested the molecular interaction between AgNP and Con A, and detailed discussion on the interactin is now in progress. 87

115 (Room 111) 20 June 2016, 15:00-15:30 PM On-metal Framing of Organic-contact Cathode with High Proton Reduction Activity Shoko Kume Department of Chemistry, Graduate School of Science, Hiroshima University Abstract The reactivity of metal surfaces as electrocatalysts has applied to various molecular conversions. Though an organic structure on metal surfaces potentially improve their activity and selectivity, dense molecular adsorption on metal active sites often causes deactivation. We have developed a novel organic-copper contact surface, constructed by an on-surface CuAAC reaction (Figure 1). The rigid network of organic covalent bond is expected to prevent a dense coverage of surface, to keep a space for copper atoms to activate substrates. Fig 1. Copper electrode modified with an organic network by on-surface CuAAC. A mechanically polished polycrystalline copper lectrode was modified by repeated anodic scanning in a solution containing a 3-way ethynyl monomer and an azide monomer. The scanning causes a gradual decrease of copper redox waves. Both of the monomers were required to form the anticorrosive layer, indicating the expected triazole formation forms an insoluble organic layer. Fig 2. Proton reduction voltammograms of copper electrodes in acidic aqueous electrolyte (0.1M HClO 4 in 0.1 M NaBF 4, 0.1 Vs -1 ). Copper electrodes were modified in advance by an anodic scanning in acetonitrile electrolyte solutions containing monomers. 88

116 The proton reduction activity of the modified electrode in an acidic aqueous solution showed twice as large cathodic current as that of the unmodified one (Figure 2). The voltammogram shape and the scan rate dependence indicates a ET-limited catalytic cycle on the modified electrode. The following chemial processes (i.e. H-H bond formation and release), which is the limited process on an unmodified electrode seems to be significantly accelerated by the modification. The presence of the organic layer does not prevent the proton reduction process on copper surface, as the onsets of the cathodic current are very similar in these electrodes. The hydrogenation of 2-cyclohexenone in aqueous electrolyte showed a suppressed activity in the modified electrode (Figure 3). The activation of an olefin group on the copper surface seems to be inhibited by the presence of an organic layer, while the proton reduction process is promoted by modification. Fig 3. Electroreduction of 2-cyclohexenone on copper electrodes upon constant-current electrolysis in 0.1 M NaBF 4aq. The modified lectrode was prepared by anodic scanning in dichloromethane electrolyte solutions containing both of the monomers. 89

117 (Room 111) 20 June 2016, 16:00-16:30 PM Stimulated emission from photonic crystal cavity with AlOx cladding layer Masahiko Kondow, Xiuyu Zhang, Yifan Xiong, and Masato Morifuji Graduate School of Engineering, Osaka University, 2-1 Yamada-oka, Suita, Osaka , Japan Abstract The amount of data transferred through the computer network is rapidly increasing. New devices for optical-interconnections with larger transmission capacity and smaller footprint are required. Next and ultimate research target is intra-chip optical-interconnections. For this application, high-density optical modules with 10 Pbps/cm 2 are required. [1] 2-dimensional photonic crystal (2D-PC) is expected as a solution. We proposed a laser diode with an entirely novel structure made of 2D-PC in which current for the electrically-driving is injected vertically in the same way as conventional laser diodes. (LDs) [2] So the footprint of our proposed laser is as small as a tiny cavity. In this LD, the employment of AlO x cladding layer is technically a key. We also proposed a high-density light source with 10 Pbps/cm 2 for the intra-chip opticalinterconnections using our proposed PC-LDs. [1] The laser-cavity is circular in the triangular lattice. Only a whispering galley mode with 9 wavelengths can stably exist there, because the cavity is surrounded by 18 air holes. The light in the cavity is outputted through the line-defect waveguide which is optically coupled with the cavity. The lasing wavelength in each cavity can be varied by changing the radius of the circular cavity. When cavities with different lasing wavelengths are placed near an output waveguide, wavelength division multiplex (WDM) can be realized without a conventional optical multiplexer. Each laser can operate at a speed of above 50 Gbps, hopefully 100 Gbps due to small cavity volume. So WDM with channels results in transmission capacity of 1 Tbps. Since footprint of the proposed light source is 100 m squire, the density of 10 Pbps/cm 2 can be realized. Fig 1. Lasing spectrum by optical pumping 90

118 In the proposed high-density light source, each laser must operate in a single longitudinal mode to realize WDM. As mentioned above, single mode operation has been shown by simulations. In this study, we demonstrate it experimentally. Figure1 shows a lasing spectrum measured under the room-temperature continuous wave (RT-CW) condition by using a spectrometer with high-sensitivity but low-resolution of 0.5 nm. Figure1 shows the single mode operation clearly. Line width of the peak was investigated by a spectrometer with high-resolution of 0.07 nm. Measured width was 0.07 nm. Therefore, actual width of lasing mode should be less than the resolution of 0.07 nm. The actual peak intensity should be about 10 times higher than that shown in Fig. 1. In summary, we experimentally demonstrate single mode operation in a circular laser-cavity formed in the 2D-PC triangular lattice. This result confirms the feasibility of our proposed highdensity light source. Referernces 1. Kondow et al Collaborative Conference on 3D & Materials Research, Tu M. Morifuji et al., IEEE Photonics Technol. Lett. 21 (2009)

119 (Room 111) 20 June 2016, 16:30-17:00 PM Enhanced red emission from Eu ions embedded in a GaN resonant optical microcavity Yasufumi Fujiwara 1, Tomohiro Inaba 1, Takanori Kojima 1, Brandon Mitchell 2, Antonio Capretti 3, Tom Gregorkiewicz 3, and Atsushi Koizumi 1 1 Division of Materials and Manufacturing Science, Graduate School of Engineering, Osaka University, 2-1 Yamadaoka, Suita, Osaka , Japan 2 Department of Physics and Astronomy, University of Mt. Union, 1972 Clark Ave, Alliance, OH, 44601, USA 3 Van der Waals-Zeeman Institute, University of Amsterdam, Science Park 904, 1098 XH Amsterdam, The Netherlands Abstract Since the invention of blue and green light-emitting diodes (LEDs), one of the targets of researchers has been to extend emission to shorter and longer wavelengths. Historically, this has been realized by varying the composition of the alloys used for making these solid-state emitters, but more recently it has involved changes to the thickness or the stoichiometry of the quantum wells. We have focused on Eu ions that have been widely used as an activator for red phosphor, and have succeeded in developing the world s first red LED that operates at room temperature using Eu-doped GaN (GaN:Eu) as the active layer [1]. Light output power of the LED has been growing steadily up to sub-milliwatts in these years [2]. However, further increase in light output power by just one order is strongly desired for practical applications. In this talk, I will present results of our investiagtions on the Eu radiative lifetime in an Eu,Ocodoped GaN (GaN:Eu,O) sample embedded into a resonant optical microcavity. We demonstrate substantial enhancement of the spontaneous emission rate of the Eu ions which we assign to the increase of the optical mode density in the microcavity and/or the resulting surface plasmon resonance (SPR). All samples were grown on double-side polished (0001) sapphire substrates by OMVPE. Ardiluted O 2 was used for oxygen co-doping, which is known to improve the Eu incorporation and luminescence properties. For samples that included a microcavity, the structure consisted of an undoped GaN layer, followed by a 10 pairs of AlN/Al 0.25Ga 0.75N (8/22 nm) superlattices (SLs), a 10.5 pairs of GaN/Al 0.4Ga 0.6N (75/60 nm) distributed Bragg reflector (DBR), a 250 nm GaN:Eu,O layer, a 15 nm GaN cap layer and Ag. The SLs was inserted to fabricate the DBR with extremely smooth surface, which has the maximum reflectance of approximately 50% in the Eu emission range ( 622 nm). Furthermore, to separate the effects of SPR at the Ag/GaN interface, samples without DBR/SLs were also prepared. These samples were grown with a different GaN cap layer thickness of 7.5, 15, 50, 85, and 120 nm to investigate the influence of SPR on the radiative lifetimes. In order to measure the enhancement of the Eu transition probability by SPR, time-resolved photoluminescence (TR-PL) measuerements were performed in the GaN:Eu,O samples with different GaN spacer thicknesses without the cavity structure. A dye laser operating at the resonant energy of the majority Eu-related emitting center OMVPE4 [3] was used as 92

120 an excitation source. The GaN spacer thickness dependence of radiative lifetime for the Eu emission obtained by experiment and calculation is shown in Fig. 1. The circle and square symbols correspond to structures with and without Ag, while black and red colors represent calculation and experiment, respectively. The radiative lifetimes for the samples with Ag and GaN spacer thicknesses of 7.5, 15, 50, 85 and 120 nm were determined as 234, 243, 258, 268 and 283 µs, respectively. The lifetimes measured for the structures without Ag were all approximately 285 µs, as shown by the dotted line in Fig. 1. On the other hand, the radiative lifetimes obtained by calculation for the samples with Ag and GaN spacer thicknesses of 7.5, 15, 50, 85 and 120 nm were 240, 247, 273, 285 and 285 µs, respectively. The radiative lifetimes become shorter as the spacer thickness decreases, in good agreement with calculations. The reduction in radiative lifetime for spacer thicknesses less than 40 nm is consistent with the surface plasmon-eu ion coupling, which decreases rapidly with distance from the metal surface. Fig 1. Radiative lifetime as a function of spacer layer thickness in samples with an Ag layer. Figure 2 compares the PL spectra of a standard GaN:Eu,O layer with those of samples coated with a Ag layer and a 15 nm spacer alone, and also embedded into a microcavity (ie. Ag + DBR/SLs). The increase in PL intensity for the samples with the Ag layer alone and combined with DBR/SLs, as compared to bulk GaN:Eu samples, were measured to be 4.9 and 7.6 times, respectively. The red shifts of PL peaks and enhancement of PL intensity observed in samples grown on DBR/SLs, is due to compressive strain induced on the GaN:Eu,O layers. The straininduced electric fields due to the piezoelectric effect are drastically different in DBR/SLs. The excitation of an Eu 3+ ion from 7 F 0 to 5 D 0, is spin-forbidden, and therefore very sensitive to crystal perturbations, since these can induce electron-phonon coupling and relax this selection rule. Therefore, the crystal lattice strain and the resulting electric fields can perturb the 4f energy level splitting of Eu 3+ ions and influence the transition probabilities, which can enhance the excitation as well as radiative recombination. However, in the microcavity, the Ag layer was 93

121 deposited on sample with DBR/SLs. Thus, these two samples can be compared in order to extract the effect of the Ag layer alone. The addition of the Ag layer to the DBR/SL sample further enhanced the PL emission intensity by times, as compared to the reference GaN:Eu,O samples. The enhancement of the PL intensity in the microcavity by 21 times was also confirmed even at room temperature. These results strongly suggest that the use of a microcavity structure is a promising method also for improving the light output from electrically pumped GaN:Eu-based red LEDs. PL intensity (arb. units) GaN:Eu,O+Ag GaN:Eu,O 2 dye-laser 10K GaN:Eu,O + microcavity GaN:Eu,O + DBR Wavelength (nm) Fig 2. PL spectra due to 5 D 0-7 F 2 transitions in GaN:Eu samples with different surrounding structures at 10 K. Figure 2 compares the PL spectra of a standard GaN:Eu,O layer with those of samples coated with a Ag layer and a 15 nm spacer alone, and also embedded into a microcavity (ie. Ag + DBR/SLs). The increase in PL intensity for the samples with the Ag layer alone and combined with DBR/SLs, as compared to bulk GaN:Eu samples, were measured to be 4.9 and 7.6 times, respectively. The red shifts of PL peaks and enhancement of PL intensity observed in samples grown on DBR/SLs, is due to compressive strain induced on the GaN:Eu,O layers. The straininduced electric fields due to the piezoelectric effect are drastically different in DBR/SLs. The excitation of an Eu 3+ ion from 7 F 0 to 5 D 0, is spin-forbidden, and therefore very sensitive to crystal perturbations, since these can induce electron-phonon coupling and relax this selection rule. Therefore, the crystal lattice strain and the resulting electric fields can perturb the 4f energy level splitting of Eu 3+ ions and influence the transition probabilities, which can enhance the excitation as well as radiative recombination. However, in the microcavity, the Ag layer was deposited on sample with DBR/SLs. Thus, these two samples can be compared in order to extract the effect of the Ag layer alone. The addition of the Ag layer to the DBR/SL sample further enhanced the PL emission intensity by times, as compared to the reference GaN:Eu,O samples. The enhancement of the PL intensity in the microcavity by 21 times was also confirmed even at room temperature. These results strongly suggest that the use of a microcavity structure is a promising method also for improving the light output from electrically pumped GaN:Eu-based red LEDs. 94

122 Acknowledgements This work was partly supported by a Grant-in-Aid for Scientific Research (S) (Grant No ) from the Japan Society for the Promotion of Science Referernces 1. A. Nishikawa, T. Kawasaki, N. Furukawa, Y. Terai, and Y. Fujiwara, Appl. Phys. Express 2, (2009). 2. Y. Fujiwara and V. Dierolf, Jpn. J. Appl. Phys. 53, 05FA13 (2014). 3. R. Wakamatsu, D. Lee, A. Koizumi, V. Dierolf, and Y. Fujiwara, J. Appl. Phys. 114, (2013). 95

123 (Room 107) 21 June 2016, 09:30-10:00 AM Luminescent N-functionalized MOFs and Coordination Networks for Novel Sensing Applications and Lighting Klaus Müller-Buschbaum 1, L. V. Meyer 1, P. R. Matthes 1, J.-C. Rybak 1, L. Meinel 2, C. Feldmann 3, H.-J. Holdt 4 1 Institute of Inorganic Chemistry, University of Würzburg, Würzburg, Germany k.mueller-buschbaum@uni-wuerzburg.de, web site: 2 Institute of Pharmacy and Food Chemistry, University of Würzburg, Würzburg, Germany 3 Institute of Inorganic Chemistry, Karlsruhe Institute of Technology, Karlsruhe, Germany 4 Institute of Chemistry, University of Potsdam, Golm, Germany Abstract Luminescent coordination polymers and especially the so-called metal-organic frameworks (MOFs) as porous variants [1] have attracted steadily growing attention. The interest derives both from possibilities to generate efficient luminescent emitters for potential use in lighting as well as to utilize changes in the luminescence properties by interaction with different chemical species for sensing processes (Figure a). [2-9] Fig. 1: Development and state of the art research on luminescent MOFs for lighting and sensing. Remarkable effects are possible. [9] Both parts, the organic ligands and the metal centers constituting the coordination polymer (or network) can contribute to the luminescence. For the organic part, typical processes with singlet-singlet transitions as well as transfer and participation of triplet states are observed as fluorescence and phosphorescence. Here, aggregated, polymeric structures in principle resemble complexes. However, the immobilization of ligands in a coordination network can 96

124 change the energetic level of excited states as well as the probability of transitions different from complexes, as shown e.g. for 4,4-bipyridine and its high population of triplet states in MOFs compared to complexes that can be used for energy transfer.[10] The metal centers of a coordination polymer, network or MOF (metal-organic framework) can also contribute, and mostly trivalent lanthanide ions dominate the metal-based luminescence of MOFs. Transitions in-between 4f-states are used for emission of small line width that is typical for the referring ions and hardly influenced by the surrounding (e.g. red for Eu 3+, green for Tb 3+ ). However, as these transitions are parity forbidden, the light uptake is usually weak. Here, the hybrid character of a coordination polymer can be highly beneficial, as the ligand can act as a sensitizer of the metal-based luminescence. We could show, that N-functionalized ligands such as azolates, pyridyles, etc. can be excellent for light uptake and energy transfer to lanthanide ions, and even intriguing effects such as inner filter effects in a combination of re-absorption and emission by lanthanide ions is possible.[11] Thereby, the luminescence efficacy and absorption could be significantly strengthened, resulting in bright emission meeting the standards of solid lighting.[12] Throughout the course of the lanthanide series, emission from the UV to the near infra-red region becomes available with and without participation of the ligand in the emission. By introduction of the concept of statistic replacement of metal ions ions for MOFs, deliberate setting of the chromaticity of luminescence was achieved for Ln-MOFs with 4,4 -bipyridine: solid solutions of 2 [Ln 2Cl 6(bipy) 3] 2bipy (bipy = 4,4 -bipyridine, Ln = Eu, Gd, Tb) were shown to be able to generate a linear chromaticity tuning from green to red upon varying the content of the lanthanide ions.[10] It is intriguing that several of these effects have also been used to influence the chromaticity of the luminescence up to the level of the generation of white light from one homogenous MOF.[13,14] Fig2. Tuning of the chromaticity of Ln-MOFs with 4,4 -bipyridine by statistic replacement of lanthanide ions. [10] In addition to the luminescence properties themselves, coordination networks and especially the porous MOFs can show additional effects on the luminescence upon interaction with chemical species such as molecules, metal ions as gases and liquid phases. It is reasonable that for such an interaction, the boundary surface and thus the inner surface of a MOF is important for contact. The interaction can induce a change in the energetic states (e.g. by donor-acceptor interactions, charge transfer) of states of a framework relevant for the luminescence, offer easily populated states of the interaction species that allow transfer of the energy to non-emissive states (e.g. high vibrational states of species containing OH or NH functions such as water, alcohols) or transitions on electronic shells (such as open d-shell configurations of metal ions, e.g. Co 2+, Cu 2+ ). All these different interactions can not only be used to monitor a change in the luminescence, but can be vice versa directly utilized to sense the referring species by the respective change of the coordination network. For a real sensing process, the change should be selective for the investigated system in order to avoid erroneous detection, and it should be strong in order to be easily identified and possibly allowing sensing of low concentrations. Most 97

125 prominently, changes in the luminescence intensity are investigated for sensing with luminescent coordination polymers and MOFs, today. They are achieved either by a quenching analyte in a so called turn-off process or by sensitizing analyte in a turn-on process.[15] Less frequent are shifts in participating energetic levels of the luminescence itself leading to a chromaticity shift (colour shift). Here, we elaborate on distinct applications for luminescent MOFs and coordination polymers for the detection of water and humidity that enables a real status analysis suitable to monitor storage conditions. References 1. S.R. Batten, N.R. Champness, X.-M. Chen, J. Garcia-Martinez, S. Kitagawa, L. Ö hrström, M. O Keeffe, M.P. Suh, J. Reedijk, Pure Appl. Chem. 85 (2013) M.D. Allendorf, C.A. Bauer, R.K. Bhakta, R.J.T. Houk, Chem. Soc. Rev. 38 (2009) Y. Cui, Y. Yue, G. Qian, B. Chen, Chem. Rev. 112 (2012) J. Heine, K. Müller-Buschbaum, Chem. Soc. Rev. 42 (2013) L.V. Meyer, F. Schönfeld, K. Müller-Buschbaum, Chem. Commun. 50 (2014) Z. Hu, B.J. Deibert, J. Li, Chem. Soc. Rev. 43 (2014) Y. Cui, B. Chen, G. Qian, Coord. Chem. Rev. 273 (2014) D. Liu, K. Lu, C. Poon, W. Lin, Inorg. Chem. 53 (2014) K. Müller-Buschbaum, F. Beuerle, C. Feldmann, Microporous Mesoporous Mater. 216 (2015) P.R. Matthes, C.J. Höller, M. Mai, J. Heck, S.J. Sedlmaier, S. Schmiechen, C. Feldmann, W. Schnick, K. Müller-Buschbaum, J. Mater. Chem. 22 (2012) J.-C. Rybak, L.V. Meyer, J. Wagenhöfer, G. Sextl, K. Müller-Buschbaum, Inorg. Chem. 51 (2012) L.V. Meyer, J. Vogt, H. Schäfer, M. Steinhart, R. Böttcher, A. Pöppl, M. Mai, C. Feldmann, K. Müller-Buschbaum, Inorg. Chem. Frontiers 2 (2015) J.-C. Rybak, M. Hailmann, P.R. Matthes, A. Zurawski, J. Nitsch, A. Steffen, J.G. Heck, C. Feldmann, S. Götzendörfer, J. Meinhardt, G. Sextl, H. Kohlmann, S.J. Sedlmaier, W. Schnick, K. Müller-Buschbaum, J. Am. Chem. Soc. 135 (2013) S.S. Mondal, K. Behrens, P.R. Matthes, F. Schönfeld, J. Nitsch, A. Steffen, P.-A. Primus, M.U. Kumke, K. Müller-Buschbaum, H.-J. Holdt, J. Mater. Chem. C 3 (2014) L.V. Meyer, F. Schönfeld, A. Zurawski, M. Mai, C. Feldmann, K. Müller-Buschbaum, Dalton Trans. 44 (2015)

126 (Room 107) 21 June 2016, 10:00-10:30 AM Good light based on candlelight OLED Jwohuei Jou Materials Sci. and Eng. Dept, National Tsing Hua University, Hsin-Chu, Taiwan Abstract Intensive blue and white lights may cause numerous problems to human health, human eyes, priceless artifacts, ecosystems, and night skies. The development of blue hazard free lights should become the primary task of future lighting technology. After the invention of sunlight organic light-emitting diode (OLED) in 2009,[1] we had introduced the first candlelight OLED on the Christmas Eve of 2012.[2-3] The candlelight OLED showed a color temperature similar to that of candles, i.e. 1,900K. From the perspective of retina protection, it is at least 10 times safer than the cold-white CFL, LED and OLED counterparts. From the perspective of melatonin generation, it is 5 times better.[4] We will present then the design and fabrication of the candlelight OLED that composes 4 candlelight complementary emitters dispersed in two different emissive layers. Besides being human-eyes friendly and melatonin secretion friendly, the candlelight OLED is also highly energy-saving, which exhibits a power efficacy of 90 lm/w, 9 times that of incandescent bulbs or 900 times that of candles. Moreover, just like candlelight, its comparatively high light quality enalbes comfort visual sensation. It is hoped that the demonstration of a blue hazard free good light like this can bring attention to the field experts and gather more efforts of the like so that Lighting Renaissance may be triggered and human as well as the environment be safeguarded. References 1. J. Jou, et al, Sunlight-style color-temperature tunable organic light-emitting diode, Appl. Phys. Lett. 95, (2009) 2. J. Jou, et al, Candle Light-Style Organic Light-Emitting Diodes. 23(21), p2750-7, A festive switch: OLEDs instead of candles? 4. J. Jou, et al, Healthy light with energy-saving and high light quality character, submitted. 99

127 (Room 107) 21 June 2016, 11:00-11:30 AM Ferromagnetic nanoparticles in topochemical transformations N. S. Perov 1, G. V. Pankina 2, P. A. Chernavskii 2 1 Faculty of Physics, Lomonosov Moscow State University, Moscow, Russia 2 Faculty of Chemistry, Lomonosov Moscow State University, Moscow, Russia Abstract The effect of a magnetic field on various topochemical processes was investigated for a long time. Magnetic field was reported [1] to influence growth of sodium hydrocarbonate crystals. It was shown that crystallites diminished because of an increase in the rate constant of nucleation. Since proton transfer was a rate-determining stage, the magnetic field presumably influenced the spin relaxation of protons. Awaji et al. [2] studied the magnetic field effect on the crystallization of the complex oxide YBa2Cu3Ox from a melt. They have revealed that the growth of crystallites was decelerated in a magnetic field. B. B. Žižić et al. [3] reported deceleration of the growth of ammonium hydrophosphatesingle crystals in a magnetic field. In the last decade the magnetic field effect on the electrochemical processes was investigated [4]. The theory of lowtemperature oxidation or oxidation in thin films was for the first time formulated by Caberra and Mott (C M theory) [5]. It involves the appearance of an electric potential (Mott potential) between oxide adsorbed oxygen and oxide metal boundaries at the initial time moment. The corresponding electric field can pull out metal atoms and move them toward the outside oxide surface, where an oxide film grows. The theory qualitatively correctly describes the formation of planar thin oxide films, but ignores potential gradients in films and assumes that the diffusion coefficients of metal ions, oxygen ions, electrons, and vacancies are constant. As it is known, the oxidation of Co nanoparticles is accompanied by the Kirkendall effect, forming void spherical structures consisting of CoO and Со3О4 [6]. The formation of void structures is explained by preferable diffusion of metal ions to the oxide oxygen interface and accumulation of vacancies, followed by their association under the oxide layer. The reduction of these structures with hydrogen can generally lead to different results. One scenario is a collapse of the void spherical particle, forming a reduced Co particle of the initial size; another mechanism is the decomposition of the oxide shell, forming a system of finer Co particles during the reduction. Here, we tried to answer the question: does magnetic field effect the results of oxidation reduction treatment? The formation of cavities at the metal oxide boundary should likely cause a more substantial decrease in the rate of oxidation than is predicted by the C M theory due to accumulation and condensation of vacancies and corresponding decrease of the real metal-oxide separation surface the metail ions diffuse through. One should note that corresponding information concerning the kinetics of oxidation of metal nanoparticles is exceedingly scarce. We used an experimental setup for "in situ" control of magnetic properties of ferromagnetic metals to investigate the kinetics of oxidation process. References 1. E. Hans, J. Cryst. Growth 267, 251 (2004). 2. S. Awaji, K. Watanabe, and M. Motokawa, J. Cryst. Growth 226, 83 (2001). 3. B. B. Žižić, S. E. Božin, S. I. Žegarac, and Ž. M. Nikoliс, J. Cryst. Growth 54, 439 (1981) 4. Perov N.S., Sheverdyaeva P.M., Inoue M. "Investigations of the magnetic field effect on electrochemical processes" Journal of Magnetism and Magnetic Materials, 272, 2448 (2004) 5. N. F. Caberra and N. Mott, Rep. Prog. Phys. 12, 163 ( ). 6. A. D. Smigelskas and E. O. Kirkendall, Trans. AIME 171, 130 (1947) 7. P. A. Chernavskii, G. V. Pankina, M. I. Ivantsov, and A. Yu. Khodakov, Russian Journal of Physical Chemistry A, 87, (2013). 100

128 (Room 107) 21 June 2016, 11:30-12:00 AM Theoretical Studies on the Slow Magnetic Relaxation of Single-Molecule Magnets Bingwu Wang 1, Yiquan Zhang 2, Chen Gao 1, Zhida Chen 1, Song Gao 1 1 Beijing National Laboratory for Molecular Science, State Key Laboratory of Rare Earth Materials Chemistry and Applications, College of Chemistry and Molecular Engineering, Peking University, Beijing , P. R. China. 2 Jiangsu Key Laboratory for NSLSCS, School of Physical Science and Technology, Nanjing Normal University, Nanjing , P. R. China. Abstract Single-molecule magnets (SMMs) exhibit the slow relaxation of magnetization, magnetic hysteresis under blocking temperature for the molecular origin. For the potential application in the high-density information storage, quantum computing and molecular spintronics, SMMs attract the interest of the scientists in inorganic chemistry, coordination chemistry and materials science. [1, 2] For the magnetic ordering materials, the method of density-functional theory combined with broken symmetry method could explain well the magneto-structural correlation. But for the SMMs, zero-field splitting and spin-orbit coupling play an important role in the magnetic properties, more sophisticated method are essential to calculate the electronic structures of ground and low lying excited states of molecules. Herein, we studied the magnetostructural correlation of single-molecule magnets, single-ion magnets and single-chain magnets by using multiple computational methods, CASSCF, CASPT2, MRCI etc. [3, 4] Fig.1 ground and low lying state sublevels of Co(II) based single-ion magnet. Acknowledgements 4. This work was supported by the NSFC and the National Basic Research Program of China. References 1. J.M. Manriquez, G.T. Yee, R.S. McLean, A.J. Epstein, and J.S. Miller, Science, 252, 1415, (1991). 2. R. Sessoli, D. Gatteschi, A. Caneschi, and M. A. Novak, Nature, 365, 141 (1993). 3. Y.-Y. Zhu, Y.-Q. Zhang, B.-W. Wang, S. Gao, Chem. Sci., 4, 1802, (2013) 4. S.-D Jiang, B.-W. Wang, H.-L. Sun, Z.-M. Wang, S. Gao, J. Am. Chem. Soc, 133, 4730 (2011). 101

129 (Room 107) 21 June 2016, 12:00-12:30 PM Magnetic and photocatalytic response of Ag-doped ZnFeO nano-composites for photocatalytic degradation of reactive dyes in aqueous solution Asif Mahmood 1, Yousef S. Al-Zaghayer 1, 2, Waheed A. Al Masry 1 1 College of Engineering, Department of Chemical Engineering, King Saud University, Riyadh 11421, Saudi Arabia. 2 Supervisor of Industrial Catalysts Research Chair, King Saud University, Riyadh 11421, Saudi Arabia. Abstract To investigate the photocatalytic degradation of reactive dyes in aqueous solution, pure ZnO and Fe/Agdoped magnetic photocatalysts having nominal compositions of Zn 0.95-xFe 0.05Ag xo (x = 0.0, 0.05 and 0.1) have been synthesized via self-consistent sol-gel based auto-combustion route. Thermally stable samples were subsequently confirmed to exhibit wurtzite type hexagonal structure, characteristic of ZnO. The nature of chemical bonding was elaborated by Fourier transform analysis. Electron microscopic techniques were employed to investigate the structural morphology and to evaluate the particle size. Ferromagnetic nature of the Fe/Ag doped samples was revealed by vibrating sample magnetometry, enabling the photocatalytic samples to be re-collected magnetically for repeated usage. The enhanced photocatalytic activity in the degradation of methylene blue under UV light irradiation with 5 and 10 wt.% Ag/ZnFeO has been observed validating the potential applications of these materials in the field of photo-degradation of organic pollutants. 102

130 (Room 107) 21 June 2016, 14:00-14:30 PM The controllable moiré effect Vladimir Saveljev 1 1 Center for Imaging Media Research, Korea Institute of Science and Technology (KIST), Seoul, Korea Abstract The more effect is a form of an optical interaction (interference) between periodic transparent layers. The visual effect of the moiré patterns is caused by the combinational spatial frequencies located near the origin of the spectral domain. Many examples can be found in the literature [1], [2]. Often, the moiré patterns appear unexpectedly under ordinary conditions and look unpredictable. A typical situation in research and engineering is a sudden appearance of the vivid moiré patterns. However actually they appear in accordance to the laws of nature, once the combinational spatial frequencies fall within the visibility circle [1]. In order to understand conditions when the moiré patterns appear, it is important to find the particularity for the moiré patterns to appear or disappear. In other words, conditions to minimize and maximize the patterns. Once such conditions are found, the moiré effect becomes controlled. In this paper, we present the spectral minimization of the moiré effect, the amplitudes of the moiré patterns, and the statistical approach. These techniques combined together may give tools to control the moiré effect, i.e., to eliminate it when it is not needed, and to enhance it, when it may give a positive outcome. The spectral minimization [3] is performed in the spectral domain. For convenience, we consider the vectors in the complex plane. For spectra consisting of narrow spectral peaks separated by relatively wide gaps, such minimization can be represented as a summation of vectors. Furthermore, when a parameter of the layered system is changed, the locations of the spectral peaks are correspondingly changed; and in the spectral domain, each peak follows its own path, in other words, a trajectory. An example of the spectral trajectories of overlapped gratings is shown in Fig, 1. Fig1. Spectral trajectories of two superposed gratings, when the running angle α varies from 15 to 30 (other three geometric parameters = 1). Each pair of spectral peaks corresponds to a flat standing wave in the spatial domain. The flat waves with lower spatial frequencies comprise the moiré patterns. In Fig. 1, among all 24 trajectories, two trajectories left the visibility circle (i.e. become invisible), while two others entered it (i.e., appeared visually). Visually it would look like a switching of two patterns: while 103

131 the moiré pattern with the horizontal fringes gradually disappears, another pattern with the vertical fringes appears instead. Basing on the layout of trajectories, the spatial frequency and the direction angle of each wave can be calculated analytically for any particular combination of parameters. Another issue is the amplitude. The patterns with low amplitude are virtually invisible, even if theoretically they are present. We investigated the amplitude of the moiré patterns in binary gratings depending on the width of the lines [4]. The surface of the amplitude vs. the opening ratios of gratings r 1 and r 2 is shown in Fig. 2. Amplitude Fig. 2. Amplitude of the moiré patterns in the parameter space (1D case). To consider the moiré effect from the statistical point of view, one may count the successful events (when the moiré patterns were observed) across a variety of display devices and different displaying methods, so as the parameters are chosen almost randomly. In this case, some interesting relationships between rational/irrational numbers make the moiré patterns to appear or disappear [4]. Namely, the probability of the moiré effect versus the angle closely follows the independently defined mathematical functions. As an example, the experimental probability and the theoretical spacing function are shown in Fig. 3. Fig. 3. Experimental probability and its theoretical counterpart. Both functions are almost the same on the rational angles, while being zero at the irrational ones. The spacing function, in turn, is close to the known Thomae s function. The author hope that the presented techniques to control the moiré effect could be applied to various research and engineering fields, such as linear measurements, visual displays including 3D, and more. References 1. I. Amidror, The Theory of the Moiré Phenomenon, vol. 1 (Springer, 2009). 2. K. Patorsky, The Moiré Fringe Technique (Elsevier, 1993). 3. V. Saveljev and S.-K. Kim, Optics Express 21, 1693 (2013). 4. V. Saveljev and S.-K. Kim, Optics Express 24, 2905 (2016). 5. V. Saveljev and S.-K. Kim, Optics Express 23, (2015). 104

132 (Room 107) 21 June 2016, 14:30-15:00 PM Directed Formation By Optical And Acoustic Forces Ifat Jacob, Eitan Edri, Erel Lasnoy, Silvia Piperno & Hagay Shpaisman Chemistry Department & Institute for Nanotechnology and Advanced Materials Bar-Ilan University, Ramat-Gan, Israel Abstract We present a novel concept based on the idea that optical traps can be used not only to manipulate and order preformed materials (as previously demonstrated), but also to influence ongoing chemical reactions. We experimentally study how optical forces promote formation of polymeric micro-structures when applied on a solution undergoing emulsion polymerization. Furthermore, by adding inorganic nanoparticles, hybrid formations are produced. The main advantages of these methods are based on their modularity and flexibility, as optical forces will influence most of the dispersed systems. Polymeric / hybrid patterned surfaces and colloids could be useful for the formation of sensors and filters as well as for biomedical applications. 105

133 (Room 107) 21 June 2016, 15:00-15:30 PM An Approximate Semiclassical Method that Uses Real Valued Trajectories for Time Dependent Tunneling Calculations Michael F. Herman Department of Chemistry, Tulane University, New Orleans, LA 70118, USA Abstract A semiclassical method will be presented that describes the time dependent tunneling of a quantum wavepacket encountering a barrier. Tunneling through barriers play a significant role in many reactions. The method described in this talk uses an approximation to the standard semiclassical stationary phase method. The approximation employed in this work leads to real valued tunneling trajectories, while most methods for this problem employ complex valued trajectories. Using only real valued trajectories will have significant advantages in applications to larger systems. It is found that there are typically three of these approximate stationary phase contributions to the wave function for each point r in the transmitted region. Two of these have energies very close to the barrier top, one slightly above the barrier top and the other slightly below it. The third approximate stationary phase contribution is at a lower energy. Difficulties in obtaining accurate values for the contributions from trajectories with an energy very close to the barrier top will be considered, and the accuracy of the approximate stationary phase wave function will be discussed. 106

134 (Room 107) 21 June 2016, 16:00-16:30 PM Mapping Carrier Dynamics on Material Surfaces in Space and Time using 4D Electron Microscopy Omar F. Mohammed Solar and Photovoltaics Engineering Research Center, Division of Physical Sciences and Engineering, King Abdullah University of Science and Technology, Thuwal , Kingdom of Saudi Arabia Abstract In the fields of photo-catalysis and photovoltaics, ultrafast dynamical processes, including carrier trapping and recombination on material surfaces and at interfaces, are among the key factors that determine the overall conversion efficiency. Despite extensive research efforts over the past few decades, information and understanding about surface-dynamical processes remains extremely limited. A key challenge is to selectively map such dynamic processes, a capability that is hitherto impractical by time-resolved laser techniques. The only way to access such surface dynamics is to map the surface dynamics selectively in real space and time by applying four-dimensional (4D) scanning ultrafast electron microscopy (S-UEM), which records snapshots of materials surfaces with nanometer spatial and sub-picosecond temporal resolutions (see Figure 1). In this method, the surface of a specimen is excited by a clocking optical pulse and imaged using a pulsed primary electron beam as a probe pulse, generating secondary electrons (SEs), which are emitted from the surface of the specimen in a manner that is sensitive to the local electron/hole density. Figure 1 Schematic of the 4D electron imaging setup with the femtosecond laser integrated with modified SEM. In several unique applications, we spatially and temporally visualize the SE energy gain and loss, the charge carrier dynamics on the surface of InGaN nanowires and CdSe single crystal. We also discuss the mechanisms for the observed dynamics, which will be the foundation for future potential applications of S-UEM to a wide range of studies on material surfaces and device interfaces. 107

135 (Room 107) 21 June 2016, 16:30-17:00 PM Ultrafast electron diffraction studies of lattice dynamics of femtosecond laser-excited bismuth and antimony nanoparticles and thin films H. E. Elsayed-Ali, A. R. Esmail, and M. Abdel-Fattah Department of Electrical and Computer Engineering and the Applied Research Center, Old Dominion University, Norfolk, VA 23529, USA Abstract Ultrafast electron diffraction is used to probe the lattice dynamics of femtosecond laser-excited bismuth and antimony nanoparticles and thin films. 1 The temporal hierarchies of the intensity and radius of diffraction orders are measured. Compression in lattice spacing is observed from the temporal dependence of the diffraction peak angle. Coherent acoustic phonons are observed as oscillations in the lattice spacing. A damped harmonic oscillator model, in which the driving force was considered, including the effect of hot electron blast force, is used to interpret the data. The electron-phonon energy exchange rate, its anisotropy, and decay of coherent acoustic phonons are studied. References 1. A. R. Esmail, A. Bugayev, and H. E. Elsayed-Ali, J. Phys. Chem. C 117, (2013). 108

136 (Room 108) 21 June 2016, 09:30-10:00 AM Carbon Nanotubes Reinforced Rubber Composites and Their Promising Application in High Performance Tires Yonglai Lu 123, Liqun Zhang 123, Jun Liu 1 1 Center of Advanced Elastomer Materials, College of Material Science and Engineering, Beijing University of Chemical Technology, Beijing , China 2 State Key Laboratoary of Inorganic-Organic Composites, Beijing University of Chemical Technology, Beijing , China 3 Engineering Research Center of Energy Conservation and Resource of Elastomers, Ministry of Eduction, Beijing University of Chemical Technology, Beijing , China Abstract Carbon nanotubes (CNTs) are considered as excellent nanofillers for polymer based composites due to their superior mechanical, thermal and electrical properties. Compared to traditional reinforcing fillers, CNTs not only can provide higher strength, but also simultaneously improve can improve the charge and heat transportation of the composites. [1] To maximize the advantage of CNTs as effective fillers for high performance polymer composites, the CNTs must be well dispersed in the matrix and have good interfacial interactions with the polymer. Although many delicate scientific research works have been carried out for development of high performance CNTs/polymer nanocomoposites, [2] their bulk and pratical application is still very few, due to large huge gap between labarotary technique and industrial development. We developed a method for preparing CNTs reiforcend rubber compsoites with homogeneous dispersion morphology and strong interfacial interaction between CNTs and rubber matrix. In this method, a specifical CNTs bundles, having one-dimensional alignment structure, less intertube entanglement as well as high surface defects (denoted as HDCNTBs) was selected. The CNTs reinforced rubber composites were prepared by using melt compounding approach, which is eco-friendly, low-cost as well as easily intergrated with present polymer processing industry. In comparsion with the rubber based composites prepared by convetinoal CNTs (i.e., CNTs agglomerates having intensive entanglements), the dispersion of CNTs in HDCNTBs/rubber composites is much more homogenious, and the length of dispersed CNTs is also larger, so as to form more effective reiforncing networks. Meanwhile, high surface defects of CNTs improve their affinity to rubber molecules, facilating strong interfacial interaction through both physical absorption and chemical bonding. The resultant CNTs reinforced rubber composites were demonstrated to possess excellent mechanical properties, high thermal conductivity and low electronic volume resistivity. In order to further enhance interfacial bonding between CNTs and matrix rubber, the silane in-situ modification technique was also employed. As revealed by AFM quantitative nano mechanic study, the thickness of interfacial region between CNTs and rubber matrix became thicker obvisously after the silane in-situ modification. As a result, the dynamic hysteresis for CNTs/rubber nanocomposites was dramticaly reduced. The outstanding advantage for our developed technique for preparing CNT/rubber composites is that the processing can be performed by conventional rubber processing equipments, so that it is easy to be industrialized and the large-scale application of CNT/rubber becomes possible. Collobrated with several Chinese tire companies, we have realized engineering scale-up and successfully fabricated trial fule-sabing passergener tires and long-durabile engineering tires containing CNTs/rubber composites. As shown in TEM imgae of Figure 1 A, small amount CNTs (~0.7%wt) was incorporated and homogenously dispersed into the highly filled silica/rubber tread compound for energy-saving tire so as to formation nano eletcronic charge conductive paths, for resolving the problem of electrostatic dissipation. The trial tire exhibits lower rolling resitance and satisfied anti-static properties. Adoption of such CNT contained tire could save save 3-5% of all gasoline consumption of the passenger vehicle. Considering that 109

137 the heat accumulation is determining factor on durability of engineering tires, we developed nano-alumina/cnts/rubber composites having the features of high thermal conductivity and low hysterysis; hereby they could be used to make tread base and shoulders of the engineering huge tire to prolong service life (Figure 1(B)). Figure 1 (C) shows the picture of trial products of energy-saving passenger tire and high durability enginerring huge tire containing CNTs reinforced rubber composites parts. All in all, this work demonstrated promising prospect in bulk application of CNTs in high-performance tires. 110

138 Fig1. Application of rubber/cnt nanocomposites in high-performance tires: (A) Using CNTs in the highly filled rubber/nano silica tread composite for solving the problem of electronic charge releasing of the energy-saving passenger tire; (B) Application of rubber/cnt nanocomposites in high-performance engineering tire for reducing heat accumulation; (C) End products of energy-saving tire and engineering tire containing rubber/cnt nanocomposite parts. The diameter of rim and cross width of the engineering tire is 33 inch and 18 inch, respectively, and its outer diameter is over 1.9 m. References 1. Qiang Zhang, Jia-Qi Huang, Wei-Zhong Qian, Ying-Ying Zhang, and Fei Wei, small 9, 1237 (2013). 2. Z. Spitalsky, D. Tasis, K. Papagelis, C. Galiotis, Prog. Polym. Sci. 2010, 35,

139 (Room 108) 21 June 2016, 10:00-10:30 AM Polymer based composites for selective laser sintering additive manufacturing Yusheng Shi 1, Wei Zhu 1, 2, Chunze Yan 1, *, Jiayi Yang 1, Shifeng Wen 1 1 State key Laboratory of Materials Processing and Die &Mould Technology, Huazhong University of Science and Technology, Wuhan, Hubei, China 2 State Key Lab of Digital Manufacturing Equipment & Technology, School of Mechanical Science and Engineering, Huazhong University of Science and Technology, Wuhan, Hubei, China Abstract Selective Laser Sintering (SLS) is a powder bed fusion additive manufacturing process, where materials have a significant influence on the accuracy and performance of as-built parts. Among the materials for SLS, polymers were the first and still the most widely applied materials. Polymeric materials in SLS is, however, still facing the challenges of limited species and low properties, thus greatly restricting the applications of SLS. Therefore, nowadays, many attempts have been made to increase number and diversity of polymers or improve the performance of existing polymeric laser sintered parts by reinforcing them with micron-sized even nano-sized fillers. This article will introduce the preparation methods of polymer based composites for SLS and compare the mechanical and physical properties of these composites, aiming to provid a comprehensive understanding of the performance capabilities and limitations of each material, and finally will discuss the future development trend in this field. 112

140 (Room 108) 21 June 2016, 11:00-11:30 AM Development of gas sensors by utilizing well-developed porous materials Takeo Hyodo, Eriko Fujii, Keijiro Ishida, Taro Ueda, Kai Kamada, and Yasuhiro Shimizu Graduate School of Engineering, Nagasaki University, 1-14 Bunkyo-machi, Nagasaki , Japan Abstract Our efforts have been directed to developing well-developed mesoporous and/or macroporous gas-sensing materials in the past dozen years or so, to enhance the gas sensitivity and selectivity, because optimization of the size and the amount of meso- and macro-pores in the gas-sensing materials are very effective in controlling the gas diffusivity and reactivity. For example, mesoporous gas-sensing materials, which were prepared by utilizing a self-assembly of various surfactants such as n-cetylpyridinium chloride (CH 3(CH 2) 15C 5H 5NCl) or a triblockcopolymer (e.g., Pluronic P123 (BASF Corp., EO 20PO 70EO 20, EO: ethylene oxide, PO: propylene oxide)) as a mespore template, showed quite large response to various gases, due to the well-developed mesopores (pore size: less than several nm), large specific surface area (SSA), and small crystallite size (CS) [1-8]. However, they generally had some disadvantages such as relatively large resistance and slow recovery speed as well. On the other hand, macropous gas-sensing materials, which were prepared by modified sol-gel technique [9-15] or ultrasonic-spray pyrolysis [16-21] employing polymethylmethacrylate (PMMA) microspheres (e.g., Soken Chem. & Eng. Co., Ltd., typical particle size: 150, 400, 800, and 1500 nm) as a macropore template, realized fast response and recovery speeds, but their gas responses were generally smaller than those of the mesoporous ones, probably because of their small SSA and large CS. Therefore, we have recently synthesized smaller PMMA microspheres with well-controlled particle size (several ten nm~ca. 150 nm in diameter), to prepare various gas-sensing materials having middle-sized pores with a diameter of several nm~ca. 100 nm, larger SSA and smaller CS. The size-controlled PMMA microspheres were synthesized in deionized water by ultrasonic (19.5 khz)-assisted emulsion polymerization (generally, at 60~65ºC for 30 min) employing methylmethacrylate (MMA) monomer as a polymer source, ammonium persulfate (APS) as an initiator and a surfactant (generally, sodium lauryl sulfate (SLS, CH 3(CH 2) 11OSO 3Na)). Figure 1 shows variation in MMA conversion with sonication time, represesntative particle-size distributions, which were measured by dynamic light scattering (DLS) technique, and a SEM photograph of PMMA microspheres which were synthesized after 30 min (synthesis condition: 8 g MMA, 0.3 g APS, and 0.1 g SLS in 0.1 dm 3 deionized water). The large amount of the MMA monomer (ca. 80 wt%) was quickly polymerized and the particle size measured by DLS gradually increased in the first 15 min, due to the polymerization in the micelles (i.e, nano reactors) which were formed in the aqueous dispersion. And then, the MMA conversion ratio didn t change after 30 min. The size of PMMA microspheres which were measured from the SEM photograph, ca. 35 nm, was smaller than the particle size, probably because the PMMA microspheres were covered with self-assembly of SLS molecules in the dispersion. The obtained PMMA microsphere dispersion was mixed with an appropriate amount of 0.05 mol dm -3 In(NO 3) 3 aqueous solution, to prepare a precursor solution. The precursor mists were generated by ultrasonic irradiation (2.4 MHz) and then it was fed to an electric furnace at 600 and 1100ºC under air flowing (3.0 dm 3 min -1 ). As the mists were abruptly heat-treated the moment they were carried into the electric furnace, the PMMA and the In(NO 3) 3 were thermally depomposed simultaneously with vaporization of the water. Figure 2 shows TEM photographs of porous In 2O 3 powders prepared at 600 and 1100ºC (pr-in 2O 3(T), T: temperature of the electric furnace (ºC)), together with their SSA and CS. The SSA was measured by Brunauer-Emmett- 113

141 Teller (BET) method using a N 2 adsorption isotherm Fig. 1. (a) Variation in MMA conversion with sonication time, (b) represesntative particle-size distribution which were measured by DLS, and (c) a SEM photograph of PMMA particles which were synthesized after 30 min. Fig. 2. TEM photographs of pr-in 2O 3(T) powders (T: 600 and 1100), together with their SSA and CS. at 77 K, and the CS was calculated with the (222) diffraction peak of XRD spectra by using Scherrer equation. Well-developed pores (several tens of nanometer in diameter) were formed in both the pr-in 2O 3(T) powders, and the morphology originated from shape of the PMMA microspheres. Naturally, CS of the pr-in 2O 3(600) powder was much smaller than that of the pr- In 2O 3(1100) powder, and thus SSA of the pr-in 2O 3(600) powder was much larger than that of the pr-in 2O 3(1100) powder. These powders were screen-printed on an alumina sbustrate equipped with a pair of interdigitated Pt electrodes and subsequently heat-treated at 550ºC for 5 h, to fabricate 114

142 Fig. 3. Operating temperature dependence of (a) NO 2 (10 ppm) response and (b) 90% response time of pr-in 2O 3(T) sensors (T: 600 and 1100), together with those of c-in 2O 3(1100) sensor (t: oxide-film thickness). semiconductor-type gas sensors [16-21]. Operating temperature dependence of NO 2 (10 ppm) response and 90% response time of these pr-in 2O 3(T) sensors were shown in Fig. 3, together with those of conventional (c-)in 2O 3(1100) sensor. The c-in 2O 3(1100) powder, which didn t have the PMMA-derived pores, were prepared without the PMMA microspheres by almost the same preparation technique employed for preaparing the pr-in 2O 3(1100) powder. The magnitude of NO 2 response was difined as a ratio of resistance in NO 2 balanced with air (R g) to that in air (R a). The NO 2 response of the pr-in 2O 3(T) sensors was much larger than that of the c-in 2O 3(1100) sensor at lower temperatures, while the 90% response time of the pr-in 2O 3(T) sensors was shorter than that of the c-in 2O 3(1100) sensor at almost all the operating temperatures tested. These results indicate that introduction of such well-developed pores into the In 2O 3 powder was quite effective in improving the NO 2-sensing properties. References 1. T. Hyodo, N. Nishida, Y. Shimizu, and M. Egashira, Sens. Actuators B 83, 209 (2002). 2. T. Hyodo, S. Abe, Y. Shimizu, and M. Egashira, Sens. Actuators B 93, 590 (2003). 3. Y. Shimizu, A. Jono, T. Hyodo, M. Egashira, Sens. Actuators B 108, 56 (2005). 4. Y. Shimizu, K. Tsumura, T. Hyodo, and M. Egashira, IEEJ Trans. SM, 125, 70 (2005). 5. M. Hayashi, T. Hyodo, Y. Shimizu, and M. Egashira, Sens. Actuators B 141, 465 (2009). 6. T. Tsumura, T. Hyodo, and Y. Shimizu, Sens. Lett. 9, 646 (2011). 7. T. Hyodo, Y. Yuzuriha, O. Nakagoe, T. Sasahara, S. Tanabe, and Y. Shimizu, Sens. Actuators B 202, 748 (2014). 8. T. Hyodo, T. Hashimoto, T. Ueda, O. Nakagoe, K. Kamada, T. Sasahara, S. Tanabe, and Y. Shimizu, Sens. Actuators B 220, 1091 (2015). 9. T. Hyodo, K. Sasahara, Y. Shimizu, and M. Egashira, Sens. Actuators B 106, 580 (2005). 10. H. Seh, T. Hyodo, and H. L. Tuller, Sens. Actuators B 108, 547 (2005). 11. I. D. Kim, A. Rothschild, T. Hyodo, and H. L. Tuller, Nano Lett. 6, 193 (2006). 12. Y. Takakura, T. Hyodo, Y. Shimizu, and M. Egashira, IEEJ Trans. SM, 128, 137 (2008). 13. T. Hyodo, S. Nonaka, Y. Shimizu, and M. Egashira, ECS Trans. 16(11), 293 (2008). 14. M. Morio, T. Hyodo, Y. Shimizu, and M. Egashira, Sens. Actuators B 139, 563 (2009). 115

143 15. C. Ishibashi, T. Hyodo, Y. Shimizu, and M. Egashira, Sens. Lett. 9, 369 (2011). 16. K. Hieda, T. Hyodo, Y. Shimizu, and M. Egashira, Sens. Actuators B 133, 144 (2008). 17. A. A. Firooz, T. Hyodo, A. R. Mahjoub, A. A. Khodadadi, and Y. Shimizu, Sens. Actuators B 147, 554 (2010). 18. T. Hyodo, H. Inoue, H. Motomura, K. Matuso, T. Hashishin, J. Tamaki, Y. Shimizu, and M. Egashira, Sens. Actuators B 151, 265 (2010). 19. E. Fujii, T. Hyodo, K. Matsuo, Y. Shimizu, ECS Trans. 50(12), 273 (2012). 20. T. Hyodo, S. Furuno, E. Fujii, K. Matuso, S. Motokucho, K. Kojio, and Y. Shimizu, Sens. Actuators B 187, 495 (2013). 21. K. Ishida, T. Ueda, K. Kamada, T. Hyodo, and Y. Shimizu, Chemical Sensors, 31(B), 94 (2015). 116

144 (Room 108) 21 June 2016, 11:30-12:00 AM Nanoporous Biomaterials in Uremic Toxin Adsorption Yoke-Leng Sim 1, Wee-Keat Cheah 2, Fei-Yee Yeoh 2 1 Department of Chemical Science, Faculty of Science, Universiti Tunku Abdul Rahman, Jalan Universiti, Bandar Barat, Kampar, Perak, Malaysia. 2 School of Materials & Mineral Resources Engineering, Universiti Sains Malaysia, Transkrian Engineering Campus, Seri Ampangan, Nibong Tebal, Penang, Malaysia. Abstract Present available hemodialysis faces several limitations such as ineffective adsorption of uremic toxins from the close-system dialysate as well as the adsorbent used. Our work aims to evaluate several emerging nanoporous biomaterials, i.e. mesoporous silica (MS-S) and its amine functionalised derivative (MS-N), in their effectiveness towards adsorption of major uremic toxin constituent urea and uric acid [1]. MS-S and MS-N performed well in the preliminary urea adsorption capacity evaluation. Adsorption kinetic studies revealed that simultaneous physisorption and chemisorption involved in the urea adsorption mechanism. MS has superior porosity and effective surface adsorption, which govern its adsorption capacity (figure 1). While for uric acid adsorption, MS did not follow theoretical adsorption curve. On the other hand, MS-N can improve uric acid adsorption through surface functional group interaction. In summary, MS and its amine-derivative performed better than the benchmarked commercial activated carbon in terms of urea and uric acid adsorption. With superior adsorbents as replacements, the amount of dialysate required to remove uremic toxins could be reduced and regenerated. Fig1. Urea adsorption kinetics by mesoporous silica. Reference: 1. Wee-Keat Cheah, Radzali Othman, Fei-Yee Yeoh, Journal of Biomedical Materials Research: Part B: Applied Biomaterials, (2015). 2. Wee-Keat Cheah, Yoke-Leng Sim, Fei-Yee Yeoh, Materials Chemistry and Physics, manuscript under review, (2016). 117

145 (Room 108) 21 June 2016, 12:00-12:30 PM Controllable construction of mesoscopic DNA pattern by combining precise magnetic manipulation and DNA-driven assembly Yingwei Zhang 1 College of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing, China Abstract Self-assembly as a bottom-up strategy is very promising on fabrication of multifunctional DNA pattern, due to its advantages of low cost, mild experimental conditions and especially programmed precise controlling ability on construction of ordered structures. [1] However, two problems need to be addressed in advance: first, current self-assembly method is difficult to extend to mesoscopic scale or larger scale; second, how to control the accurate location of building blocks for assembly. [2] To solve these issues, we firstly consider exploiting mesoscale glass fibers as building blocks for large-scale assembly, avoiding requirement of expanding assembly scale. Secondly, we introduced magnetic responsive ability to DNA functionalized glass fibers to enable magnetic field to drive it to realize precise and controllable assembly. Based on these ideas, we constructed a complex DNA pattern in the shape of different letters DNA at mesoscale on quartz slide, by using DNA functionalized magnetic responsive glass fibers as DNA carrier and building blocks and applying the strategy of combining magnetic field-assisted localization with DNA hybridization as assembled driving force. This selfassembly approach is advantageous due to its erasable characteristic, which enables us to realize repeated fabrication of different patterns on the same substrate through toehold-mediated strand displacement strategy. Most importantly, we demonstrated its multifunctionality and significant application in simultaneous detection of multiplex targets DNA. Fig1. A schematic to illustrate the process of constructing DNA pattern by combining mangnetic manipulation and DNA-driven assembly. References 1. M. J. Cheng, Y. Wang, L. L. Yu, H. J. Su, W. D. Han, Z. F. Lin, J. S. Li, H. J. Hao, C Tong, X. L. Li, F. Shi, Adv. Funct. Mater. 2015, 25, 6851 (2015). 2. M. J. Cheng, H. T. Gao, Y. J. Zhang, W. Tremel, J. F. Chen, F. Shi, W. Knoll, Langmuir, 27, 6559 (2011). 118

146 (Room 108) 21 June 2016, 14:00-14:30 PM Use of magnesium-based alloys for stents: current status and future research directions Gladius Lewis Department of Mechanical Engineering, The University of Memphis, Memphis, TN 38152, USA Abstract Coronary artery disease (or coronary heart disease or ischemic heart disease) (CAD) is characterized by blockage and, hence, weakening, of one or more of the arteries that supply blood to the heart [1]. CAD is caused by atherosclerosis, which is a multifactorial pathology whose genesis is accumulation of fat and lipids in an artery and, ultimately, results in the formation of de-novo lesions (plaque) inside the artery [1]. The plaque is unstable, and, as such, may rupture, causing a blood clot to occur, and this may result in a heart attack and, sometimes, death [1]. CAD is very prevalent in many countries, although the incidence varies (Figure 1). The costs (direct and indirect) of CAD are very high; for example, in the United States, these amount to $200 billion annually [3]. TURKMENISTAN UKRAINE RUSSIA SLOVAKIA MALAYSIA USA INDONESIA THAILAND PAKISTAN CHINA PORTUGAL JAPAN FRANCE SOUTH KOREA Figure 1. Age-adjusted incidence of death due to coronary artery disease in select countries (2014) [2]. Interventional modalities for treating/managing CAD that are in current clinical use are coronary artery bypass grafting, percutaneous transluminal coronary angioplasty ( balloon angioplasty ) followed by the placement of a stent ( stenting ), and atherectomy (use of a catheter-deliverable tool to debulk and remove the plaque by cutting, pulverizing, or shaving) followed by balloon angioplasty [4]. The management of CAD remains challenging not least because the choice of modality is dictated by a large array of factors, notably health characteristics of the patient (such as age and comorbidities, such as Type II diabetes) and of the lesion (such as artery size and degree of blockage of the artery), and there is a dearth of evidence-based recommendations [5]. Thus, there is no universal best treatment strategy; nonetheless, the most popular modality is stenting [6]. Stents are may divided into two broad types: 1) durable stent, such as drug eluting stents in which the platform is fabricated from a durable metal (such as Co-Cr alloy) and the drug (usually, an anti-proliferative drug such as everolimus, paclitaxel, zotarolimus, and biolimus) is embedded in a coating made of a durable 320 DEATH RATE PER 100,000 (AGE-ADJUSTED) [2014]

147 Hydrogen evolved (ml cm -2 ) 2016 Collaborative Conference on 3D & Materials Research (CC3DMR) June 2016 polymer (such as a mixture of polybutyl methacrylate/hexamethacrylate/vinyl and acetate/vinyl; pyrrolidinone) (Figure 2); and 2) bioresorbable stent. The latter may, in turn, be divided into several sub-types, such as a stent fabricated from a bioresorbable metal, most commonly, Mg, and a stent in which the scaffold and the drug coating are each fabricated from a bioresorbable polymer, such as poly (-D/L-lactide). Figure 2. Schematic drawing of a drug eluting stent that comprises a durable metal scaffold and a durable polymer drug coating. The focus of this presentation is bioresorbable Mg-based stents. With this type of stent, 1) the principal challenge is to produce a metal/alloy that simultaneously has high values of elastic modulus, yield strength, ultimate tensile strength, and ductility; and 2) the principal drawback is the rapid degradation of the stent in the in vivo medium (that is, degradation before revascularization is complete), with many consequences such as vascular elastic recoil and late lumen loss. The presentation will be divided into five parts. The first part will comprise succinct descriptions of relevant aspects of CAD and advantages and limitations of the different types of stents (including clinical problems), with special emphasis on bioresorbable stents. In the second part, the focus will be discussion of a review of the literature with regards to methods used to meet the aforementioned principal challenge, such as alloy selection and development, mechanical processing of alloys (such as cryogenic burnishing [7]), and impurity control in alloys, and development of nanocomposites. In the third part, h 4 h 8 h Ground specimens Cryogenically burnished specimens Time in 5 wt.% NaCl solution Figure 3. Influence of mechanical processing method on corrosion of a Mg alloy [7]. the focus will be discussion of a review of the literature with regards to methods used to meet the aforementioned principal drawback, such as impurity control in alloys, modification of alloy 120

148 chemistry, heat treatment of alloy parts, mechanical processing of alloy parts, deposition of either a microstructured or a nanostructured coating on alloy parts, development of nanocomposites, and production of porous metal parts. Based on the reviews presented in the second and third parts, areas for future research will be identified and discussed in the fourth part. In the fifth part, all the salient points made in the presentation will be summarized. References 1. Lusis A. Atherosclerosis. Nature 2000; 407; World Health Rankings; purpose. 3. American Heart Association. Heart and stroke statistics update. Dallas, TX, USA: American Heart Association, Cortese B, et al.j.cardiovas Med 2015; D0I: /JCM Buchman GL, et al., Rev Esp Cardiol 2014; 67: Buchman GL, et al., Prog Cardiovascul Dis 2015; 58: Uddin MS, et al., Sci Technol Adv Mater 2015;16:056901; 24 pp. 121

149 (Room 108) 21 June 2016, 14:30-15:00 PM Large magnetocapacitance effect in magnetic tunnel junctions at room temperature Hideo Kaiju 1, Taro Nagahama 2, Junji Nishii 1, and Gang Xiao 3 1 Research Institute for Electronic Science, Hokkaido University, Sapporo, Hokkaido, Japan 2 School of Engineering, Hokkaido University, Sapporo, Hokkaido, Japan 3 Department of Physics, Brown University, Providence, RI, USA Abstract Spintronics is an emerging research field which utilizes the charge and spin degrees of freedom of electrons in solid-state systems and devices. One of the most successful devices in spintronics is the magnetic tunnel junction (MTJ), which consists of two ferromagnetic layers separated by a thin insulator. MTJs show a large tunneling magnetoresistance (TMR) effect at room temperature [1, 2], and at present, the TMR ratio has reached 600% in MTJs with MgO tunnel barriers [3]. On the other hand, MTJs also exhibit tunneling magnetocapacitance (TMC) effect at room temperature [4, 5]. The capacitance in the parallel configuration is larger than that in the antiparallel configuration between the magnetization vectors in both ferromagnetic layers adjacent to the barrier. Recently, we have observed a large TMC ratio beyond 150%, which is three times larger than the conventional value, at room temperature in MTJs with MgO tunnel barriers [6]. We have also found that the mechanism of TMC effect can be well explained by the theoretical calculation based on Debye-Fröhlich model. This calculation predicts that the TMC ratio can be as large as about 1000% for a spin polarization of 87%, while the TMR ratio is 623% for the same spin polarization. These theoretical and experimental findings provide a deeper understanding on AC spin-dependent transport in MTJs and will open up wider opportunities for device applications, such as highly sensitive magnetic sensors and impedance-tunable devices. Furthermore, MC effect has also been observed in molecular spin valves [7], magnetic nanoscale granular solids [8], and magnetic single electron transistors (SETs) [9]. Rapid progress is now being made in the research field on MC effect. In this talk, we focus on MC effect in spintronic devices and present the recent progress in this field. References 1. S. Yuasa, T. Nagahama, A. Fukushima, Y. Suzuki, and K. Ando, Nat. Mater. 3, 868 (2004). 2. S. S. P. Parkin, C. Kaiser, A. Panchula, P. M. Rice, B. Hughes, M. Samant, and S.-H. Yang, Nat. Mater. 3, 862 (2004). 3. S. Ikeda, J. Hayakawa, Y. Ashizawa, Y. M. Lee, K. Miura, H. Hasegawa, M. Tsunoda, F. Matsukura, and H. Ohno, Appl. Phys. Lett. 93, (2008). 4. H. Kaiju, S. Fujita, T. Morozumi, and K. Shiiki, J. Appl. Phys. 91, 7430 (2002). 5. P. Padhan, P. LeClair, A. Gupta, K. Tsunekawa, and D. D. Djayaprawira, Appl. Phys. Lett. 90, (2007). 6. H. Kaiju M. Takei, T. Misawa, T. Nagahama, J. Nishii, and G. Xiao, Appl. Phys. Lett. 107, (2015). 7. J. Y. Hong, S. H. Chen, W. C. Chiang and M.-T. Lin, SPIN 4, (2014). 8. N. Kobayashi, H. Masumoto, S. Takahashi, and S. Maekawa, Nat. Commun. 5, 4417 (2014). 9. T.-H. Lee and C.-D. Chen, Sci. Rep. 5, (2015). 122

150 (Room 108) 21 June 2016, 15:00-15:30 PM PLD-fabricated Nd-Fe-B thick-film magnets deposited on Si substrates Masaki Nakano, A. Yamashita, T. Yanai, and H. Fukunaga 1 Graduate School of Engineering, Nagasaki University, Nagasaki , Japan Abstract We have already reported the isotropic Nd-Fe-B thick-films with the thickness range from 10 to 1200 μm by using a PLD (Pulsed Laser Deposition) method and applied them to several electronic devices [1,2]. The thick-films were deposited on various metal substrates such as a Ta and a Fe ones. On the other hand, several researchers demonstrated the deposition of Nd-Fe- B thick-films with a buffer layer on Si substrates using a sputtering method to develop MEMS by taking account of micromachining technology [3], and the thickness of each film was mainly less than 20 μm. Although we also tried to prepare isotropic Nd-Fe-B thick-films on Si substrates with a Ta buffer layer [4], the samples were broken after a dicing process due to the mechanical property of Ta. This contribution reports a control of microstructure of samples enables us to increase the thickness above 100 μm without a buffer layer on a Si substrate. Namely, we found that the precipitation of Nd at the boundary of Nd-Fe-B grains is effective to suppress the destruction of samples through an annealing process. Figure 1 shows the relationship between thickness and Nd contents in isotropic Nd-Fe-B thick-films deposited on Si substrates. After the annealing process, samples without destruction (the symbol of in Fig.1) could be prepared. On the other hand, all the samples of were broken. As the Nd content became higher than 22 at.%, we could enhance the thickness up to approximately 160 μm without deterioration of mechanical properties. The remanence and coercivity of films displayed as in Fig. 1 varied from 0.4 to 0.6 T and from 1000 to 1500 ka/m, respectively. The magnetic properties were comparable to those of previously reported ones deposited on Ta substrates [1]. Furthermore, a dicing process for a 113 μm-thick sample which had the remanence of 0.5 T and coercivity of 1160 ka/m was carried out. The sample could be diced smoothly without deterioration of mechanical properties. We also confirmed that the magnetic properties didn t degrade after the dicing. It was clarified that the control of microstructure of samples was effective to increase the thickness of Nd-Fe-B films deposited on Si substrates. 25 Nd/(Nd+Fe) [at. %] :No destruction :Destruction Thickness[ m] Fig.1 Relationship between Nd contents and thickness of Nd-Fe-B thick-films deposited on Si substrates. References 1. M. Nakano et al,, Sensor Letters, vol. 5, 48(2007). 2. M. Nakano et al, IEEE Trans. Magn. vol. 43, No. 6, 2672(2007). 3. M. Oryoshi et al., in Rep.IEE Jpn.Res.Meeting,vol. MAG , 37(2013). 123

151 (Room 108) 21 June 2016, 16:00-16:30 PM The mechanisms of thermal engineered laser shock peening for enhanced fatigue performance Yiliang Liao 1 Mechanical Engineering Department, University of Nevada Reno, Reno, NV, USA Abstract Thermal engineered laser shock peening (LSP) is a technique combining warm laser shock peening (WLSP) with subsequent post-shock tempering treatment to optimize the surface strength and fatigue performance of metallic materials. This technique integrates the advantages of LSP, dynamic strain aging (DSA), dynamic precipitation (DP) and post-shock tempering to obtain optimized microstructures for extending fatigue life, such as nanoprecipitates and highly dense dislocations. In this work, AISI 4140 steel is used to evaluate the thermal engineered LSP process. The resulting microstructures as well as mechanical properties are studied under various processing conditions. The mechanism underlying the improvements in fatigue performance is investigated. It is found that the extended fatigue life is mainly caused by the enhanced cyclic stability of compressive residual stress as well as surface strength. This improved material stability and reliability are attributed to the enhanced dislocation pinning effect corresponding to the number density, size and space distribution of nanoprecipitates, which could be tailored by manipulating the WLSP processing conditions and by post-shock tempering. The effects of the precipitate parameters on the precipitation kinetics as well as on the dislocation pinning strength are discussed [1-2]. References 1. Y. Liao, C. Ye, S. Suslov, G. J. Cheng, Acta Materialia, 60, (2012). 2. Y. Liao, G. J. Cheng, Acta Materialia, 61, (2013). 124

152 (Room 108) 21 June 2016, 16:30-17:00 PM Strain Mode of General Flow: Characterization and Implications for Flow Pattern Structures Yasuya Nakayama Department of Chemical Engineering, Kyushu University, Fukuoka, Japan Abstract Understanding the mixing capability of mixing devices based on their geometric shape is an important issue both for predicting mixing processes and for designing new mixers. The flow patterns in mixers are directly connected with the modes of the local strain rate, which is generally a combination of elongational flow and planar shear flow. We develop a measure to characterize the modes of the strain rate for general flow occurring in mixers. The spatial distribution of the volumetric strain rate (or non-planar strain rate) in connection with the flow pattern plays an essential role in understanding distributive mixing. With our measure, flows with different types of screw elements in a twin-screw extruder are numerically analyzed. The difference in flow pattern structure between conveying screws and kneading disks is successfully characterized by the distribution of the volumetric strain rate. The results suggest that the distribution of the strain rate mode offers an essential and convenient way for characterization of the relation between flow pattern structure and the mixer geometry. Fig1. Distribution of the strain-rate type in flow in a twin-screw extruder. The numerical calculations have been partly carried out using the computer facilities at the Research Institute for Information Technology at Kyushu University. This work has been supported by Grants-in-Aid for Scientific Research (JSPS KAKENHI) under Grant Nos , , and 15H References 1. Y. Nakayama, T. Masaki, and T. Kajiwara, AIChE J. (2016) in press. 125

153 (Room 109) 21 June 2016, 09:30-10:00 AM Cold-Electron Transport at Room Temperature: Toward Ultralow Energy Consumption Electronics Seong Jin Koh 1 1 Department of Materials Science and Engineering, The University of Texas at Arlington, Arlington, Texas, USA Abstract A technology that enables electronic devices to operate with extremely-low energy consumption promises numerous applications. For example, if powered by energy-efficient transistors, smart phones, tablets and laptops could be in use for a prolonged time (e.g., for a week or more) without recharging. However, efforts to reduce energy consumption or heat dissipation for current large-scale integrated circuits are hampered by intrinsic limitations imposed by thermodynamics, specifically, the Fermi-Dirac electron energy distribution. Thermally excited energetic electrons at the Fermi-Dirac tail can overcome the OFF-state energy barrier of a transistor, resulting in undesired leakage currents, causing excessive heat dissipations. This talk presents a new way of electron transport in which thermally excited electrons are filtered out by a quantum well energy state such that only energy-filtered cold electrons are allowed to transport through device components at room temperature. We show that the effective electron temperature of the energy-filtered cold electrons can become as low as 45 Kelvin without any external cooling. Applications of the cold-electron transport will be discussed, including room-temperature single-electron transistors and ultra-low heat dissipation transistors. 126

154 (Room 109) 21 June 2016, 10:00-10:30 AM CdTe/PbTe heterostructure: A new 2DEG system Huizhen Wu Department of Physics and the State Key Laboratory of Silicon Materials, Zhejiang University Hangzhou, Zhejiang , People s Republic of China Abstract The two-dimensional electron gas (2DEG) at the interface of two materials with same crystal symmetry and similar lattice constants but different bandgaps has for many years been a fertile playground for discovering novel electron physics and new device applications. The latticestructure-mismatched CdTe(zinc-blende)/PbTe(rock-salt) heterostructure, distinctly different from other 2DEG systems, is a much simpler heterostructure yet able to offer high electron mobility comparable to and one or two order magnitude higher sheet carrier density than the best achieved values for those of Si and II-VI based quantum well structures relying on modulation doping. TEM characterization on the CdTe/PbTe heterojunction indicates an abrupt interface without cation interdiffusion due to a large miscibility gap between the two constituent materials. Density-functional theory modeling reveals the interface of CdTe/PbTe(111) forms spontaneously a high density 2DEG with electron density over cm 2, without the need for doping. Hall-effect measurements show high electron mobilities and carrier concentrations: cm 2 /V s and cm 3 at 2 K, and cm 2 /V s and cm 3 at 77 K. The primary mechanism is the mismatch in the bonding coordination at the interface. The quantum oscillations observed in the 2DEG suggest that the interface of the CdTe/PbTe is a Dirac electron system with a non-zero Berry phase, indicating the topological nature of the 2DEG in this novel heterostructure. An abnormal enhancement of mid-infrared light emission and phonon blockage effect in the CdTe/PbTe heterostructures are also observed. The CdTe/PbTe heterostructure is emerging with unique properties and promising applications in optoelectronics, thermoelectric and spintronics. References 1. Shuqiang Jin, Huizhen Wu, et al, Two-dimensional electron gas at the metastable twisted interfaces of CdTe/PbTe (111) single heterojunctions,phys. Rev. B 87, (2013) 2. Bingpo Zhang, Huizhen Wu, et al, Quantum Oscillations in a Two-Dimensional Electron Gas at the Rocksalt/Zincblende Interface of PbTe/CdTe (111) Heterostructures, Nano Lett., 15, 4381 (2015) 3. Bingpo Zhang, Huizhen Wu, et al, Phonon blocking by two dimensional electron gas in polar CdTe/PbTe heterojunctions, Appl. Phys. Lett. 104, (2014) 127

155 (Room 109) 21 June 2016, 11:00-11:30 AM Thin film Silicon Nanowire/PEDOT: PSS Hybrid Solar Cells with Surface Treatment H. Wang, J. X. Wang, A. B. Prakoso, Rusli NOVITAS, Nanoelectronics Centre of Excellence, School of Electrical and Electronic Engineering, Nanyang Technological University Abstract Si nanowires (SiNWs) have been incorporated into solar cells for light trapping, so that thinner Si absorber layer can be used to lower the material cost of solar cells [1-3]. SiNWs fabricated by the low cost solution based metal-catalyzed electroless etching (MCEE) technique have also been combined with organic semiconductor poly(3,4-ethylene-dioxythiophene): polystyrenesulfonate (PEDOT:PSS) to form hybrid solar cells [4]. Such cells present a very cost-effective option due to their simple structure, coupled with the solution based, low temperature and large area fabrication process. Lower cost Si thin films have to be explored as a more parctical option instead of expensive bulk Si wafter. We have previously reported SiNWs/PEDOT:PSS hybrid solar cells based on a 2.2 レ m Si thin film that achieved a PCE of 5.6% [5]. We have also recently investigated planar Si/PEDOT:PSS hybrid solar cells as a function of the Si thickness, and found that the photocurrent generated saturates at a Si thickness of ~10 レ m, indicating that a further increase in the thickness of Si material would not be costeffective [6]. To further improve the performance, we study in this work thin film hybrid cells with 10.6 レ m Si thickness incorporated with SiNWs for light trapping. We have applied a recently developed two-step surface treatment process to improve the surface quality of the SiNWs. A PCE of 7.83% has been achieved for the treated SiNWs/PEDOT:PSS cells with an optimized SiNW length of 0.7 レ m. The average Voc of the SiNWs/PEDOT:PSS cells is improved from 0.46 V to 0.56 V as compared to the untreated counterparts. The results in this study demonstrate the potential of thin film Si/PEDOT:PSS hybrid cells incorporated with SiNWs for light trapping, and the importance of surface treatment to fully realize the advantages brought about with the use of SiNWs. The light harvesting capability of the SiNWs has also been investigated theoretically using optical simulation. It is found that the inherent randomness of the MCEE SiNWs, in terms of their diameter and spacing, accounts for the excellent light harvesting capability. In comparison, periodic SiNWs of comparable dimensions have been shown to exhibit much poorer trapping and absorption of light. References 1. E. Garnett and P. Yang, "Light Trapping in Silicon Nanowire Solar Cells," Nano Letters, vol. 10, pp , 2010/03/ M. D. Kelzenberg, S. W. Boettcher, J. A. Petykiewicz, D. B. Turner-Evans, M. C. Putnam, E. L. Warren, et al., "Enhanced absorption and carrier collection in Si wire arrays for photovoltaic applications," Nature Materials, vol. 9, pp , J. Zhu, Z. Yu, G. F. Burkhart, C.-M. Hsu, S. T. Connor, Y. Xu, et al., "Optical absorption enhancement in amorphous silicon nanowire and nanocone arrays," Nano Letters, vol. 9, pp , L. He, C. Jiang, Rusli, D. Lai, and H. Wang, "Highly efficient Si-nanorods/organic hybrid core-sheath heterojunction solar cells," Applied Physics Letters, vol. 99, L. He, C. Jiang, H. Wang, D. Lai, Y. Heng Tan, C. Seng Tan, et al., "Effects of nanowire texturing on the performance of Si/organic hybrid solar cells fabricated with a 2.2 m thinfilm Si absorber," Applied Physics Letters, vol. 100, H. Wang, J. Wang, A. B. Prakoso, L. Hong, Y. Heng Tan, C. Seng Tan, et al., "High- Efficiency Planar Thin-Film Si/PEDOT:PSS Hybrid Solar Cell," Photovoltaics, IEEE Journal of, vol. PP, pp. 1-6,

156 (Room 109) 21 June 2016, 11:30-12:00 AM Multi-striped Orthogonal Photon-Photocarrier-Propagation Solar Cells (MOP 3 SC) with Redirection Waveguide Akira Ishibashi Research Institute for Electronic Science, Hokkaido University, Sapporo, Hokkaido, Japan Abstract Energy and environmental issues have been increasingly serious, and development of highly efficient solar cells is of focus of attention. The high efficiency solar cell, basically, enables us to live most elegantly with the ultimate, safe nuclear power plant: the Sun. Many kinds of solar cells [1-3] have been studied, but in conventional solar cells, the photon propagation direction is orthogonal to pn junction, and the photo-carriers diffusion directions are parallel to the direction of the photon propagation. In general, we need a thick layer to fully absorb the solar light, but on the other hand we have to make the layer thin enough to collect photo-generated carriers as much as possible, because of the carrier s finite life time. The conventional solar cells are with trade-off in determining the semiconductor layer thickness between light absorption and photocarrier collection. Fig.1 Waveguide-coupled 4-striped orthogonal photon- photocarrier propagation solar cell Fig. 2 Light propagation a) with incident angle θ=30 and b) with incident angle θ=60 129

157 In a redirection waveguide-coupled photon-photocarrier-popagation solar cell (MOP 3 SC) system [4] shown in Fig. 1, photons come from beneath, in general, with oblique angles. The redirection waveguide converts the three-dimensionally propagating photons (sunlight) into guided two-dimensional (2D) wave of photons that eventually get into the solar cell units from the edge as shown in Fig. 1. The redirection waveguid has following functions: first, making those photons coming from various directions impinge perpendicularly to the 2D waveguide (small vertical arrows in Fig. 1); and secondly, changing the photons direction from the perpendicular to parallel direction with respect to the 2D waveguide plane. Those photons, going into the MOP 3 SC along the pn junction plane, propagate in the direction orthogonal to that of the photocarriers. Thus, photons being absorbed in the direction vertical to the carrier drift/diffusion, the aforementioned trade-off can be lifted, thanks to the orthogonality. Further, by placing those multiple semiconductor stripes, neighboring to each other, with different bandgaps in such an order that the incoming guided photons first encounter the widest gap semiconductor, then medium-gap semiconductors, and the narrowest at last as shown in Fig. 1, we can virtually convert the full spectrum of sunlight into electlicity. Fig. 3. Wavelentgh dependence of 2D propagation efficiency. The inset shows 2D photon-propagation in the waveguide. We have been developing the redirection waveguide structure using simulations, results of which are shown in Fig. 2, where the incident light are coming from beneath as a plane-wave. By placing structure that has periodic parabola cross-section on top of the slab we can make the photons impinging with various incident angles proppagate almost perpendicularly to the slab [5]. Thus the aforementioned first function of the redirection waveguide is achieved farely well. With the parabola cross-section structure or integrated-paraboloid-sheet we can virtually regard all the incoming photons impinge the 2D salb waveguide at a right angle. As for the second function, by using the periodic refractive-index modulation [6], we can make the photons coming from beneath propagate laterally in the 2D slab waveguide as shown in the inset of Fig. 3. This structure consists of a slab, 160μm long and 5μm thick, with refractive index n=1.33, and a periodic refractive-index modulation structure (0.5μm wide, 0.769μm high, placed with period of 1.0μm, having n=1.65). By controlling the refractive-index modulation structure, as shown in Fig. 3, we can redirect the photons with different wavelengths from 3D to 2D propagation. Full conversion from 3D to 2D, however, is not yet achieved because the system, being based on diffraction, has large wavelength dependence. In the waveguide-coupled MOP 3 SC, as shown in Fig. 1, the multi-striped solar cell structure is placed at the edges of the waveguide, and the waveguide-coupled MOP 3 SC serves as a 130

158 concentration photovoltaic system typically operating under a few hundreds to a thousand suns. When the mulitstriped structure is coupled to waveguide, further advancement is expected. Not only the waveguide-coupled MOP 3 SC can optimize the absorption of light and the photo-carrier collection independently converting the whole spectrum of sunlight into electricity, but also the waveguide-coupled MOP 3 SC is expected to serve as a highly efficient concentration photovoltaic system with low temperature rise thanks to its minimal thermal dissipation plus its best match with heat-sinks as well as with the diffusive light convertibility when used, for example, with the parabola cross-section structure or the integrated-paraboloid-sheet on top of the waveguide. The waveguide-coupled MOP 3 SC is also of potential interest as a high reliability system, because the high energy photons that can damage the bonding of the materials, being converted into electricity already at upstream in the wide-gaped semiconductor cell, never go into the medium or narrow gap semiconductors. Thus, the waveguide-coupled MOP 3 SC would serve as an ultimate high efficiency all-in-one system in the near future. References 1. M. Liu, M. B. Jonson, and H. J. Snaith, Nature, (2013) 2. M. A. Green, K. Emery, Y. Hishikawa, W. Warta, and E. D. Dunlop, Solar cell efficiency tables (version 40). Prog. Photovolt. Res. Appl (2012) 3. K. Suemori, T. Miyata, M. Hiramoto, and M. Yokoyama, Jpn. J. Appl. Phys., 43 L1094 (2004) 4. A. Ishibashi, N. Kawaguchi, K. Kondo, H. Kaiju and S. White, Proc. Int. Symp. Environment. Consci. Design and Inv. Manufact. pp (2009) 5. T. Taniguchi, T. Kasai, K. Kondo, and A. Ishibashi, Proc. 15th RIES-Hokudai International Symposium, Sapporo, p. 136 (2014). 6. I. Suemune, Appl. Phys. Express 4, (2011) 7. A. Ishibashi, Proc. Int'l Conference and Exhibition on Mesoscopic & Condensed Matter Physics, Boston, p.24 (2015) 131

159 (Room 109) 21 June 2016, 12:00-12:30 PM Next generation of high-efficient heterojunction crystalline silicon solar cells T. Kamioka 1, Y. Hayashi 1, K. Nakamura 2, Y. Ohshita 1 1 Toyota Tecknological Institute, Nagoya, Aichi, Japan 2 Meiji Universityy, Kawasaki, Kanagawa, Japan Abstract Crystalline silicon (csi) based solar cells have dominated the present photovoltaic market. To achieve the grid parity, higher conversion efficiency and lower production cost are both required. A cell concept with a passivated contact, in which an electrode is not directly contacted to a csi surface, has been much attracted for this target. This cell architechture is also regarded as a good candidate for the bottom cell of III-V/Si tandem cells [1]. The exapmles of the passivated contact cells are an amorphous/crystalline (a/c) Si heterojunction cell and a tunneling-oxide passivated-contact (TOPCon) cell [2]. The heterojunction with thin intrinsic layer (HIT) cell [3] is a leading example of the a/c Si heterojunction cell. The advantage of this cell is high open-circuit voltage (V oc) owing to high-quality passivation using an intrinsic hydrogenated amorphous Si (i-asi:h) layer. Recently, by combining the back-contact structure to avoid the shadow loss (interdigitated back-contact Si heterojunction cell; IBC-SHJ cell), the world record efficiencies of 25.6% was achieved by Panasonic [4]. In our Japanese national project, the high efficiency of over 25% was also demonstrated by SHARP using this architecture [5]. In this presentation, we share our simulation works that contributed the above achievement. We also introduce our research activities for other passivated-contact cells. Carrier transport across the amorphous/crystalline Si heterojunction One of the most important physics in the a/csi heterojunction cells is the carrier transport across the junction, since the transport characteristics are strongly related to the optimal thickness of the i-asi:h layer for high efficiency. It is well known that an inversion layer and an accumulation layer are formed at the csi sides of the p-asi:h/i-asi:h/n-csi and n-asi:h/iasi:h/n-csi interfaces, respectively. One expects that the quantum effects might be occurred at this region, i.e., the carrier distribution is modified there. This quantum modification leads to the change in V oc especially for the very thin i-asi:h layer conditions. By considering this quantum effects, our modeling succeeded in qualitatively explaining the experimental results for the V oc dependence on the i-asi:h layer thickness [6]. This result indicates that more indepth understanding of the device physics is important to accurately predict the device performance. Towards mass production of IBC-SHJ cells On the other hand, there are several issues in the design optimization of the IBC-SHJ cells when it comes to mass production. Since low-cost processes are allowed for the solar cell production, the patterning processes such as photolithography are not used. This means that the gap between an emitter and a collector electrode in the back-contact cell becomes wide. Such a "dead region" causes a significant recombination loss. It is thus necessary to obtain guidelines as roadmaps for how to compensate the performance degradation under such a relaxed design rule. Our twodimensional device simulation shows that these gap-related problems are common even though any variation of IBC-SHJ structure is adopted. To keep the high-quality passivation with the i- asi:h layer for this gap region is mandantory [7]. One of the ideas to overcome this recombination loss problems is also proposed in our presentation [8]. Towards future passivated and selective-carrier contact cells For any passivated contact cells, independent of its dominant carrier transport mechanisms (thermal emission or tunneling etc.), the new and/or improved materials are important for excellent selectivity of photogenerated carriers. Essentially, to control the workfunction at the hetero-interface (Fig. 1) [9], which would be different from the bulk properties, is the key technology. Many works have been dedicated for this topic in the world-wide. We also show 132

160 our Kelvin force microscopy (KFM) studies to directly measure an actual workfunction profile of the Si heterojunction cells in nano-meter-scale [10]. Fig1. Simulated V oc as a function of interfacial workfuctions of the front and rear electrodes for a both-side MIS-type tunnelling junction solar cell. Acknowdegements This work was partly supported by the New Energy and Industrial Technology Development Organization (NEDO) under the Ministry of Economy, Trade and Industry of Japan. We also thank our co-workers at SHARP Corporation. References 1. S. Essig, M. A. Steiner, C. Allebe et al., 6th International Conference on Crystalline Silicon Photovoltaics (2016). 2. S. W. Glunz, F. Feldmann, A. Richter et al., 31st European Photovoltaic Solar Energy Conference and Exhibition (2015). 3. M. Taguchi, A. Yano, S. Tohoda et al., Proc. 39th IEEE Photovoltaic Spec. Conf., 96 (2013) 4. K. Masuko, M. Shigematsu, T. Hashiguchi et al., IEEE J. Photovoltaics 4, 1433 (2014). 5. J. Nakamura, N. Asano, T. Hieda, C. Okamoto, H. Katayama, and K. Nakamura, IEEE J. Photovoltaics 4, 1491 (2014). 6. Y. Hayashi, D. Li, A. Ogura, and Y. Oshita, IEEE J. Photovoltaics 3, 1149 (2013). 7. T. Kamioka, Y. Hayashi, K. Nakamura, and Y. Ohshita, Jpn. J. Appl. Phys. 54, 08KD07-1 (2015). 8. T. Kamioka, Y. Hayashi, K. Nakamura, and Y. Ohshita, 6th International Conference on Crystalline Silicon Photovoltaics (2016). 9. T. Kamioka, Y. Hayashi, K. Nakamura, and Y. Ohshita, 73th JSAP Autumn Meeting (2015). 10. F. Yamada, T. Kamioka, T. Tachibana et al., 40th IEEE Photovoltaic Spec. Conf., 3040 (2014). 133

161 (Room 109) 21 June 2016, 14:00-14:30 PM Analysis of Interface Thermal Stability of High-k ZrO2 on GaN and AlGaN G. Ye 1, H. Wang 1,2, K. S. Ang 2 1 Shool of Electrical and Electronic Engineering, Nanyang Technological University, Singapore Temasek Laboratories@NTU, Nanyang Technological University, 50 Nanyang Drive, Singapore Abstract High-k ZrO2 is a promising dielectric material candidate for GaN-based MISHEMTs. Excellent electrical characteristics of AlGaN/GaN MISHEMTs utilizing ZrO2 as gate dielectrics are reported recently1-3. The interface between dielectric layer and underlying GaN and AlGaN layers is critical and thermal stability of the dielectric layer at the interface is one of the most challenging requirements for application of ZrO2 as a gate dielectric. In this paper, a detailed investigation of the impact of post-deposition annealing on interfacial properties related to the formation/annihilation of interfacial GaOx sub-oxide layer of atomic layer deposited (ALD) ZrO2 on GaN and AlGaN is carried out by using X-ray photoelectron spectroscopy (XPS) and high-resolution transmission electron microscopy (HR-TEM). ZrO2 dielectric layers were deposited on (Al)GaN-on-sapphire substrates by using ALD method. The un-doped (Al)GaNon-sapphire wafers were grown by Metal Organic Chemical Vapor Deposition (MOCVD) using a commercial reactor. For the investigation of ZrO2/GaN interface, samples with 2 nm thick ZrO2 on GaN surface were utilized for XPS measurements while ZrO2 dielectric layers with a thickness of 10 nm were deposited for HR-TEM characterization. After dielectric layer deposition, different post-deposition anneals (PDAs) using rapid thermal annealing (RTA) in N2 atmospheres for 30 s were performed under five different temperatures (300 oc, 400 oc, 500 oc, 600 oc and 700 oc). The XPS measurements were carried out using a monochromatic Al Kα X-ray source of energy ev. The spectra are curve-fitted with a combination of Gaussian and Lorentzian line shapes using a Shirley-type background subtraction. All peaks were referenced to the C 1s peak at ev to compensate for any variations in the peak corelevel positions due to binding energy (BE) shift caused by surface charging. ZrO2/GaN interface Ga 3d core-level XPS spectra obtained under different post-deposition annealing temperatures are depicted in Fig. 1. It can be seen from Fig. 1 that each Ga 3d spectrum could be deconvolved into two components, corresponding to the Ga-N and Ga-O bonds. The existence of the Ga-O spectrum for the as-deposited sample (indicated by N.A in Fig. 1) may be attributed to the parasitic oxidation of the GaN surface after cleaning during ALD deposition process. Apparently, the Ga-N bonds show an obvious increase in binding energies (BEs) with the increase of annealing temperatures when the annealing temperatures are lower than 500 oc. Further increase in annealing temperature shows a reduction of the BEs. Cross sectional TEM micrograph for as-deposited sample (N.A) and samples annealed at 500 oc and 700 oc are shown in Fig. 2. For the as-deposited film shown in Fig. 2(a), an obvious interfacial layer could be found. While, an abrupt interface without any interfacial layers is observed for sample annealed under 500 oc. This may indicate the clean up effect for ALD ZrO2 on GaN at annealing temperature of 500 oc. For the sample annealed at 700 oc in Fig. 2(c), re-formation of interfacial layer was observed. This could be due to the reaction between GaN and O2 that is dissociated from ZrO2 layer at higher annealing temperatures. 134

162 Fig.1. The measured (open circles) and fitted (lines) XPS Ga 3d core-level spectra for ALD ZrO2 on GaN samples measured at take-off angle θ of 15o under different post-deposition annealing (PDA) temperatures. The as-deposited sample is indicated as N.A. Fig.2 Cross-sectional TEM images of the ZrO2 dielectric layers on GaN: (a) as-deposited (N.A) and (b) with a 500 oc post-deposition annealing in N2 for 30 s and (c) with a 700 o C postdeposition annealing in N2 for 30 s. The interfacial layer is indicates as IL. ZrO2/AlGaN interface The Al 2p and Ga 3d core-level spectra obtained at two take-off angles θ of 15o for 2 nm thick ZrO2 on AlGaN samples under different PDA temperatures are shown in Fig. 3. Al 2p spectrum in Fig. 3(a) could be deconvolved into two components, corresponding to the Al-N and Al-O bonds, while Ga-N and Ga-O bond components are observed for Ga 3d spectrum as shown in Fig. 3(b). The existence of the Al-O and Ga-O spectrum for the as-deposited sample (indicated 135

163 by N.A.) could be attributed to the parasitic oxidation of the AlGaN surface after cleaning during ALD deposition process. The interfacial chemical bonding states for ALD-ZrO2 on AlGaN are highly depend on the annealing temperatures. The Al-O/Al 2p and Ga-O/Ga 3d area ratios decrease with the increase in annealing temperature when the RTA temperature is lower than 500 oc. This could be ascribed to the passivation of sub-oxide interfacial states through the clean up effect. The re-growth of the sub-oxide interfacial layer is evidenced by the increase in Al-O/Al 2p and Ga-O/Ga 3d area ratios. The annihilation or formation of the interfacial layer is also confirmed by HR-TEM shown in Fig. 4. Fig.3 The measured (open circles) and fitted (lines) XPS Al 2p (a) core-level spectra and Ga 3d (b) core-level spectra for 2 nm ALD-ZrO2 on Al0.5Ga0.5N samples at take-off angle θ of 15 o under different PDA temperatures. The as-deposited sample is indicated as N.A. In conclusion, the effect of post-deposition annealing on interfacial chemical bonding states for ALD-ZrO2 on GaN and Al0.5Ga0.5N is studied by angle-resolved XPS and HR-TEM. The experimental results reveal that interface quality for both ZrO2/GaN and ZrO2/Al0.5Ga0.5N can be improved by the annihilation of the sub-oxide layers through post-deposition annealing in N2 ambient at a temperature below 500 o C, suggesting the presence of the clean up effect of ALD-ZrO2 on (Al)GaN. 136

164 Fig.4 Cross-sectional TEM images of the ZrO2 dielectric layers on Al0.5Ga0.5N: (a) asdeposited (N. A), (b) annealed at 500 oc in N2 for 30 s, and (c) annealed at 700 oc in N2 for 30 s. The interfacial layer is indicated as IL. Referernces 1. V. Kumar, W. Lu, R. Schwindt, A. Kuliev, G. Simin, J. Yang, M. A. Kahn, and I. Adesida, IEEE Electron Device Lett. 23, 455 (2002). 2. T. Palacios, A. Chakraborty, S. Rajan, C. Poblenz, S. Keller, S. P. DenBaars, J. S. Speck, and U. K. Mishra, IEEE Electron Device Lett. 26,781 (2005). 3. G. Ye, H. Wang, S. Arulkumaran, G. I. Ng, Y. Li, Z. H. Liu and K. S. Ang, Appl. Phys. Lett. 105, (2014). 137

165 (Room 109) 21 June 2016, 14:30-15:00 PM InGaN quantum dots on GaN micropyramids for polarized photon emission K. F. Karlsson i, A. Lundskog, C. W. Hsu, S. Amloy, U. Forsberg, T. Jemsson, H. Machhadani, E. Janzén and P. O. Holtz Semiconductor Materials, Department of Physics, Chemistry and Biology (IFM), Linköping University, Sweden Abstract III-nitride based quantum dots (QDs) have attracted much attention as efficient light emitters, offering deeper confinement potentials and a wider range of photon energies than provided by the conventional III-arsenide system. Moreover, the unique valence band structure with small split-off energy makes the nitrides particularly useful for emission of polarized light [1]. We utilize the apexes of hexagonal GaN micropyramids as preferential nucleation sites for InGaN QDs. The structures are fabricated by low-pressure hot-wall MOCVD, and the micropyramids are obtained by selective area growth on photolithography-defined SiN patterns. Optimized growth conditions result in the formation of single QDs, as evidenced by photoluminescence (PL) spectroscopy, and the photon energy can be tuned by about 400 mev in the indigo and violet part of the visible spectrum by controlling the growth temperature of the InGaN layer [2]. It is demonstrated that the top (0001) facet on slightly truncated pyramids is essential for QD formation. Fig. 1: (a) SEM image showing uniform growth of GaN pyramids with the elongation parallel with é ë2110ù û ( =0o ). (b,c) Close up SEM images of individual pyramids with various elongation directions ( =n 30 o, n = 0, 1 5). 138

166 Fig. 2: (left) Histograms of the measured polarization direction for QDs on pyramids with various elongation directions. (right) Polar plot of the PL intensity versus the angle of the linear polarizer analyzer for elongated pyramids with =0 o. The optical spectra of the pyramids reveal sharp sub-mev emission lines [2], typical for QDs, and signatures of a charged exciton complex have been identified [3]. An ultimate proof of QD formation is provided by the photon antibuching characteristics of the emission [4-5]. All pyramids exhibit a strongly linearly polarized emission from the QDs, implying that the dots possess significant degrees of asymmetry [1]. We have developed a novel concept based on elongated pyramids for controlling the polarization direction (see Fig. 1), by which the predefined elongation determines the polarization vectors of the emitted photons from the QDs [6]. The resulting QDs have a high degree of linear polarization (average 84 percent), with a high probability to be well aligned with the axis of elongation (up to about 90 percent for one micron elongation). Best polarization alignment is obtained for elongations parallel with the principal axes of the crystal, arranged with multiples of 60 o angle with respect to each other, but some degree of polarization control in 30 o steps is also shown possible (see Fig. 2). This growth scheme should allow fabrication of compact arrays of photon emitters, with a controlled polarization direction for each individual emitter. References 4. S. Amloy et al., arxiv: : 5. C. W. Hsu et al., Nano Letters (2011). 6. C. W. Hsu et al., Applied Physics Letters 103, (2013). 7. T. Jemsson et al., Applied Physics Letters 105, (2014). 8. T. Jemsson et al., Nanotechnology 26, (2015). 9. A. Lundskog et al., Light: Science & Applications 3, e139 (2014). 139

167 (Room 109) 21 June 2016, 15:00-15:30 PM Temperature-dependent morphology of annealed gold films on silicon surfaces Ching-Ling Hsu 1, Ming-Yu Juang 1, Pei-Wen Lin 1, Bo-Rui Liaw 1, Chi-Tin Shih 2 1 Department of Physics, Center for Nanotechnology, and Institute of Biomedical Technology, Chung Yuan Christian University, Chung-li, 32023, Taiwan 2 Department of Physics, Tunghai University, Taichung, 40704, Taiwan Abstract Various Au/Si alloy or compound nanostructures were formed when Au thin films were deposited on Si substrates and annealed. Figure 1 shows a typical atomic force microscopy (AFM) image of a 20 nm Au thin film deposited on a Si substrate and annealed at 900 C for 40 minutes as an example. The fractal analysis of the surface morphology was conducted by using the height height correlation function (HHCF) and the power spectral density function (PSDF) with the AFM image data, revealing the relation between the annealing temperatures and the fractal dimension D f, the interface width w, and the lateral correlation length ξ of the surface. While the morphology of the surface is mainly self-affine, suggesting that the random surface/interface diffusion plays a dominant role in the kinetic roughening process of such an annealed Au/Si system, the results of the morphological analysis also imply that the self-affine surface begins to become mounded for higher annealing temperatures. Fig1. A typical AFM image of a 20 nm Au thin film deposited on a Si substrate and annealed at 900 C for 40 min. 140

168 (Room 109) 21 June 2016, 16:00-16:30 PM Additive Manufacturing and Investigation of Heat Pipe with Novel Micro Feature Designs Jie Wang 1, H.P. Xu 1, Z.W. Zhang 1, Q. J. Wang 2,1 1 The State Key Laboratory of Mechanical Transmission, Chongqing University, Chongqing, China; 2 Northwestern University, Evanston, Illinois, USA Abstract The additive manufacturing (AM) technology unfolds a new horizon for innovative designs of components with complicated shapes and structures, especially unusual internal features that can hardly be made with conventional manufacturing tools. Heat pipes accomplish efficient heat exchanges via internal fluid cyclical phase transfers guaranteed by their inner wick structures. They can be innovatively designed and conveniently fabricated by means of the AM method. Reported here are the design, three-dimensional printing, tests, and material studies of a group metal micro heat pipes with novel inner wick features. The effectiveness of different micro-grooves are explored based on the heat-pipe heat transfer performances, and the results are correlated to the groove shape variation, groove surface roughness and micro topography, and the microstructures of the fabricated material. 141

169 (Room 109) 21 June 2016, 16:30-17:00 PM Durable and Efficient Packing Materials for Green Subcritical Water Chromatography Yu Yang Department of Chemistry, East Carolina University, Greenville, NC 27858, USA Abstract Because of the elimination of hazardous organic solvents used in the mobile phase, subcritical water chromatography (SBWC) has gained greater attention nowadays. In SBWC, pure water is used as the mobile phase. At elevated temperatures water becomes a stronger solvent for reversed phase liquid chromatography separation due to the decreased dielectric constant with increasing temperature [1-3]. Thus, temperature can be regarded as an important parameter to enhance separation efficiency, speed up analysis, and manipulate the selectivity of a chromatographic separation [2, 3]. Although SBWC is a green and economical separation technique [4-6], the routine use of this technique has still not been adopted by industry. One major reason for this is the stability of the stationary phase under high-temperature liquid chromatography conditions. In this presentation, packing materials with enhanced upper temperature limit will be discussed. These thermally more stable packing materials include hybrid silica-based particles, zirconia-based particles, and various polymer materials. Our recently developed zeolite-based packing materials will also be presented. References 1. D.J. Miller and S.B. Hawthorne, Anal. Chem. 69, 623 (1997). 2. Y. Yang, B. Kapalavavi, Encyclopedia of Analytical Chemistry (John Wiley & Sons, Ltd.), 1 (2011). 3. Y. Yang, J. Sep. Sci. 30, 1131 (2007). 4. Y. Yang, B. Kapalavavi, L. Gujjar, S. Hadrous, R. Marple, and C. Gamsky, International Journal of Cosmetic Science 34, 466 (2012). 5. B. Kapalavavi, R. Marple, C. Gamsky, and Y. Yang, International Journal of Cosmetic Science 34, 169 (2012). 6. Y. Yang, Z. Strickland, B. Kapalavavi, R. Marple, C. Gamsky, Talanta 84, 169 (2011). 142

170 (Room 110) 21 June 2016, 09:30-10:00 AM Pair-Density Functional Theory for Superconductors Katsuhiko Higuchi 1, Eina Miki 2 and Masahiko Higuchi 3 1 Graduate School of Advanced Sciences of Matter, Hiroshima University, Higashihiroshima, Japan 2 Graduate School of Science and Technology, Shinshu University, Matsumoto, Japan 3 Department of Physics, Shinshu University, Matsumoto, Japan Abstract The density functional theories for superconductors are widely used for investigating electronic properties of equilibrium superconducting state [1-4]. In these theories, the off-diagonal elements of the second-order reduced density matrixes (RDM2) are chosen as the basic variable[1-4], because they corresponds to the order parameter of the superconducting state [5-8]. In this study, we show that there exists the relation between the order parameter of the superconducting state and diagonal elements of RDM2 that are refered to as the pair-density (PD). Specifically, if the order parameter of the superconducting state takes a non-zero value, then the fluctuation of the particle number that can be expressed by using the PD becomes O(N). This means that we can choose as the basic variable the PD instead of the order parameter of the superconducting state. Concerning the PD for the normal state, we have been developing the zero-temperature PD functional theory, in which the PD is chosen as the basic variable [9-17]. It is expected that the findings and knowledge obtained from the zero-temperature PD functional theory [9-17] are useful also in developing the PD functional theory for superconductors. In this study, we present the theoretical framework of the finite-temperature PD functional theory that is applicable to superconductors. We can calculate the fluctuation of the particle number by means of the present PD functional theory, which enables us to predict the critical temperature of the superconductivity. In addition to the fluctuation of the particle number, the present PD functional theory can reproduce the spatial distribution of the order parameter of the superconducting state. This is also a useful information for understanding the superconducting state. References 1. L. N. Oliveira, E. K. U. Gross, W. Kohn, Phys. Rev. Lett. 60, 2430 (1988). 2. W. Kohn, E. K. U. Gross and L. N. Oliveira, J. de Phyique (Paris) 50, 2601 (1989). 3. M. Lüders, M. A. L. Marques, N. N. Lathiotakis, A. Floris, G. Profeta, L. Fast, A. Continenza, S. Massidda, E. K. U. Gross, Phys. Rev. B 72, (2005) ; and references cited in Ref K. Higuchi, K. Koide, T. Imanishi, M. Higuchi, Int. J. Quantum Chem. 113, 709 (2013). 5. C. N. Yang, Rev. Mod. Phys. 34, 694 (1962). 6. A. J. Leggett, Quantum Liquids (Oxford University Press, Oxford, 2006). 7. M. Ueda, Fundamentals and New Frontiers of Bose-Einstein Condensation (World Scientific, New Jersey, 2010). 8. C. J. Pethick and H. Smith, Bose-Einstein Condensation in Dilute Gases (Cambridge University Press, Cambridge, 2008). 9. M. Higuchi and K. Higuchi, Physica B 387, 117 (2007). 10. M. Higuchi and K. Higuchi, Phys. Rev. A 75, (2007). 11. M. Higuchi and K. Higuchi, Phys. Rev. B 78, (2008). 12. K. Higuchi and M. Higuchi, J. Phys.: Condens. Matter 21, (2009). 13. K. Higuchi and M. Higuchi, Phys. Rev. B. 82, (2010). 14. M. Higuchi and K. Higuchi, Phys. Rev. A 84, (2011). 143

171 15. K. Higuchi and M. Higuchi, Phys. Rev. A 85, (2012). 16. K. Higuchi and M. Higuchi, Phys. Rev. A 87, (2013). 17. K. Higuchi and M. Higuchi, Phys. Rev. A. 90, (2014). 144

172 (Room 110) 21 June 2016, 10:00-10:30 AM Fractional Quasiparticles in a Local Quantum Hall System Masayuki Hashisaka Department of Physics, Tokyo Institute of Technology, Ookayama, Meguro, Tokyo , Japan Abstract An elementary excitation in a fractional quantum Hall (FQH) system is known to have a fractional charge. In bulk FQH systems, the tunneling current between the FQH edge channels is carried by the quasiparticle tunneling. This fractional-quasiparticle tunneling have been experimentally investigated by shot-noise measurements. In contrast, here I talk about a shotnoise measurements performed on a local FQH system, which is sandwiched between integer quantum Hall (IQH) systems [1]. In this device, the local FQH system operates as a tunneling barrier between the IQH systems. The tunneling quasiparticles have a fractional charge, although they emerge from the IQH systems. This is a dual experiment of bunching of fractional quasiparticles through a high-potential barrier in a bulk FQH system [2]. The measurements were performed using our original cross-correlation noise-measurement technique [3]. In this talk, first I review this technique and show its benefits for measurements in quantum Hall systems. Then, I demonstrate the detection of the tunneling fractional quasiparticles. The low-frequency cross-spectral density of the shot noise generated at a beam splitter can be described by * * e V 2kBTe S Cross 2 e IF coth, (1) * 2kBTe e V where e * is the effective charge of scattered quasiparticles, I is the impinging current, V is the applied bias voltage, k B is the Boltzmann constant, and T e is electron temperature. Here, F is the shot-noise reduction factor. When quasiparticles are partitioned one by one, F equals to a binominal distribution factor T(1 T), where T is the transmission probability through the beam splitter. Fig 1. Noise cross-spectral density measured as a function of T through the local FQH system. Solid blue and dotted black lines are the theoretical curves calculated with e * = e/3 and e, respectively, assuming F = T(1 T). 145

173 The measurement was performed at 82 mk at the magnetic field of 8.0 T to form the filling factor v = 1 IQH system. The local FQH system was formed by tuning the local electron density using a split-gate electrode. We applied a dc bias voltage 450 V to the local FQH system to generate the shot noise. The noise cross-spectral density was measured by using the crosscorrelation technique. Figure 1 shows the shot noise measured as a function of the transmission probability T of the current through the local FQH system. The data agree well with the curve calculated using Eq. (1) with e * = e/3 and F = T(1 T) over the wide range of T (1/3 < T < 0.9). This tells that the tunneling quasiparticles have the fractional charge e/3. In addition, the binominal distribution factor F = T(1 T) indicates that these fractional quasiparticles are scattered between the IQH systems. This means that the fractional quasiparticles emerge from the IQH systems to tunnel through the local FQH system. References 1. M. Hashisak, T. Ota, K. Muraki, and T. Fujisawa, Phys. Rev. Lett. 114, (2015). 2. E. Comforti, Y. C. Chung, M. Heiblum, V. Umansky, and D. Mahalu, Nature 416, 515 (2002). 3. M. Hashisaka, T. Ota, K. Muraki, and T. Fujisawa., Rev. Sci. Instrum. 85, (2014). 146

174 (Room 110) 21 June 2016, 11:00-11:30 AM Breakdown of quantum Hall effect in graphene: Noise studies Manohar Kumar 1, Antti Laitinen, Daniel Cox, Pertti Hakonen Low temperature laboratory, School of science, Aalto University, Espoo, Uusimaa, Finland Abstract Graphene is made up of a single layer carbon atoms, packed in honeycomb lattice, a true 2- dimeniosnal electron gas. Like other 2-DEG electron gas, electrons in graphene also shows the quantum Hall effect (QHE). But due to massless nature of Dirac electron, linear dispersive energy spectrum and high Fermi velocity close to Dirac point in graphene, the QHE in graphene is very robust and shows fourfold degeneracy along with zero energy state. This makes graphene an attractive element for metrology. For this front, a better understanding of QHE w.r.t. to mobility, temperature and bias current is needed. Here I will present very first low frequency noise and high frequency noise studies on non-equilibrium aspect of quantum Hall effect i.e. dissipative quantum Hall sates. Our studies indicates the breakdown of quantum Hall states at lower current is due to interaction of Landua level with localized states. On the other hand at higher current, electron avalanche leads to wash out of quantum Hall states. 147

175 (Room 110) 21 June 2016, 11:30-12:00 AM Local Investigations in the Fractional Quantum Hall Regime using Scanning Gate Microscopy B. A. Braem 1, S. Hennel 1, T. Krähenmann 1, C. Rössler 1, C. Reichl 1, W. Wegscheider 1, M.S. Rudner 2, B. Rosenow 3, T. Ihn 1, K. Ensslin 1 1 Solid State Laboratory, ETH Zurich, 8093 Zurich, Switzerland 2 Niels Bohr International Academy and Center for Quantum Devices, Niels Bohr Institute, University of Copenhagen, 2100 Copenhagen, Denmark 3 Institut für Theoretische Physik, Universität Leipzig, D Leipzig, Germany Abstract In the regime of the integer and the fractional quantum Hall effect, the current is expected to be carried by edge channels. The position of these edge channels is determined by the electrostatic potential in the sample. Therefore scanning gate microscopy [1] provides the possibility to locally manipulate edge channels by applying a voltage to the metallic tip of a scanning force microscope and moving it over the sample [2, 3]. Fig1. Conductance G as function of tip position. (a) Single scan line showing the pronounced =1/3 plateau. Inset: Sketch of experimental setup. (b) G(x,y) with the =1/3 plateau in orange, cut shown in (a) is taken along the dotted line. (c) Numerical derivative of G shows plateau as a dark belt. We use a split-gate defined quantum point contact on a high-mobility GaAs/AlGaAs heterostructure to bring the counter propagating edge channels of the quantum Hall regime close to each other. Figure 1 demonstrates the effect of applying a negative bias to the tip and moving it close to the constriction. The negative tip voltage reduces the charge carrier density 148

176 and changes the quantum Hall filling factor in the quantum point contact from the bulk filling factor to zero and we observe a reduced conductivity of the sample [Fig 1(a,b)]. The tip-induced filling factor can be determined by measuring the diagonal conductivity of the quantum point contact [3]. Of special interest are localized fractional quantum Hall states in the constriction which are observed as a conductance plateau as function of tip position. Figure 1(c) shows the calculated modulus of the gradient of the conductance as function of tip position, the ngth of the tipinduced filling factor at temperatures up to 800 mk allows us to extract the activation energy of the tipconfined systems [4] and significantly lower than in the bulk [5]. Recent observations showed a feedback mechanism between the nuclear and the electronic spin microscopy allowed us to locally manipulate the mechanism and study the effect on the oscillations. References 1. M. A. Topinka, B. J. LeRoy, R. M. Westervelt, S. E. J. Shaw, R. Fleischmann, E. J. Heller, K. D. Maranowski, A. C. Gossard, in: Nature 410, (2001). 2. N. Paradiso, S. Heun, S. Roddaro, L. Sorba, F. Beltram, G. Biasiol, L. N. Pfeiffer, K. N. West, in: Phys. Rev. Lett. 108, (2012) 3. N. Pascher, C. Rössler, T. Ihn, K. Ensslin, C. Reichl, W. Wegscheider, in: Phys. Rev. X 4, (2014) 4. S. Baer, C. Rössler, E. C. de Wiljes, P.-L. Ardelt, T. Ihn, K. Ensslin, C. Reichl, W. Wegscheider, in: Phys. Rev. B 89, (2014) 5. B. A. Braem, T. Krähenmann, S. Hennel, C. Reichl, W. Wegscheider, T. Ihn, K. Ensslin, submitted. 6. S. Hennel, B. A. Braem, S. Baer, L. Tiemann, P. Sohi, D. Wernli, C. Reichl, W. Wegscheider, C. Rössler, T. Ihn, K. Ensslin, M. S. Rudner, B. Rosenow, in: arxiv:1511:

177 (Room 110) 21 June 2016, 12:00-12:30 PM Toward quantum bit generation using single highly charged ion implantation Makoto Sakurai1 Department of Physics, Kobe University, Nada-ku, Kobe , Japan Abstract The highly charged ions (HCIs) carry large potential energy as a summation of ionization energy for each promotion step of charge state. When a HCI enters the surface the potential energy is dissipated at a nano-scale region over the surface in a very short time (a few femtoseconds) which leads to the emission of hundreds of secondary electrons, sputtering of many secondary ions, and structural modification of the topmost surface layers. The amount of modification such as the size of irradiation traces quantitatively depends on the charge state of the HCI. [1,2] Single ion implantation (SII) is a technique to implant dopant ions one-by-one into a fine semiconductor region in order to avoid inhomogeneity of dopant atoms [3], and also an important approach toward realizing a quantum register. We have demonstrated that collision event of a HCI with a surface is detectable with almost 100% efficiency, which is an essential requirement in SSI technique, by virtue of advantageous characteristics of HCI that the secondary electron yield is far beyond unity [4]. If SII using HCI is available it is also useful for other processing techniques in nano technology; creation of nano-sized structures such as nano-gaps, cutting a carbon nano tube at an arbitrary position and probing of nano-sized materials for instrumental analysis, utilizing the unique property of HCI that single HCI sputters the atoms over nano-scaled region on a surface. There are many challenges for realizing SII using HCIs. We have made some preliminary experiments to inject HCI within limited area in the size of 100 nm ~ 10 mm [5]. In these eperiments, irradiated areas were observed by STM or SEM in a vacuum system different from that for the irradiation experiment. Since it is very difficult to find an irradiation spot at an off-line observation facility, we started to develop an irradiation apparatus with in-situ STM observation function. At the conference I will report our efforts toward SII using HCIs. References 1. A. Arnau et al., Surface Sci. Rep. 27, 113 (1997). 2. F. Aumayr, S. Facsko, A.S El-Said, C. Trautmann, and M. Schleberger, J. Phys. C23, (2011). 3. T. Shinada, S. Okamoto, T. Kobayashi, and I. Ohdomari, Nature 437, 1128 (2005). 4. N. Yoshiyasu et al., Jpn. J. Appl. Phys. 45, 995 (2006). 5. M. Sakurai, S. Liu, S. Sakai, S. Ohtani, T. Terui, and H.A. Sakaue, Nucl. Instrum. Meth. B315, 248 (2013). 150

178 (Room 110) 21 June 2016, 14:00-14:30 PM 3D quantitative analysis of rapidly solidified powders of Al-4.5wt%Cu Hani Henein Advanced Materials and Processing Laboratory Dept of Chemical and Materials Engineering University of Alberta Edmonton, Alberta, Canada, T6G 2G6 Abstract Powders of various metallic alloys have been generated by atomization under controlled atomizing conditions. This technique allows the development of the understanding of the solidification path of these undercooled droplets. Using neutron scattering a quantitative post mortem analysis of the microstructure is carried out. The result provides a measure of the phase constituents in the powders as well as their volume fractions. This enables the estimation of the undercooling of the droplets and the effect of process variables on undercooling and cooling rate. Furthermore, micro-tomographic imaging of the solidified droplets reveal a number of morphologies in Al-4.5wt% Cu alloyed powders. The changes in morphologies were analyzed as a function of droplet undercooling and cooling rate as well as a function of Scandium additions to the Al-4.5wt% Cu alloy. 151

179 (Room 110) 21 June 2016, 14:30-15:00 PM Growth of Crystalline Metal Carbides on the Catalyst Surface in Hot Wire Chemical Vapor Deposition Yujun Shi Department of Chemistry, University of Calgary, Calgary, Alberta, Canada T2N 1N4 Abstract Hot wire chemical vapor deposition (HWCVD), also known as Catalytic CVD, has been widely used in the production of Si-containing thin films, metal oxide nanoparticles, carbon nanotubes, and functional polymer coatings. The technique of HWCVD uses a heated metal filament to catalytically decompose the precursor gas to form various reactive species, which then react with the metal, leading to the formation of metal alloys. Therefore, HWCVD can also be used for the deposition of metal carbide and silicide coatings on the metal surface. Early transition metal carbides possess many unique mechanical, electronic, and chemical properties that have led to their applications as anti-wear and corrosion-resistant coatings. In addition, these metal carbides can be used as heterogeneous catalysts or as electrocatalyst supports. For example, tungsten carbide (WC) show platinum-like behavior in hydrogenolysis.[1] Tungsten carbide has also found applications as an anode catalyst to replace the expensive Pt/Ru alloy in the direct methanol fuel cell (DMFC). Tantulum carbide (TaC), on the other hand, is a good electrocatalyst support. Despite of their wide applications, synthesis of a single phase of WC and TaC film is still challenging. Formation of metal carbides on heated metal surfaces In this work, we report a method of forming crystalline metal carbides, including WC and TaC, by heating a W or Ta filament in the environment of various four-membered-ring organosilicon compounds in a HWCVD reactor. Three different molecules, namely 1-methylsilacyclobutane (MSCB), 1,3-disilacyclobutane (DSCB), and 1,1,3,3-tetramethyl- 1,3-disilacyclobutane (TMDSCB), have been investigated. X-ray diffraction, scanning electron microscopy, Auger electron spectroscopy, and in-situ filament resistance measurements have been employed to monitor the growth of different phases of metal crabides on the heated metal surfaces. We have 152

180 shown that filament temperatures, reaction time, and reactions on the metal catalyst surface are among the important factors in determining the nature of metal alloys formed and changes in different phases. The decomposition chemistry of MSCB is characterized by a competition of methyl radical formation and ring-opening reactions.[2] For DSCB, its decomposition is dominated by the exocyclic H 2 elimination, forming a cyclic silylene species.[3] Due to the difference in the decomposition chemistry of MSCB and DSCB, different alloys were formed with these two precurosors. Specifically, metal carbides were formed with contamination by SiC when using DSCB at low filament temperatures of ºC.[4] MSCB truns out to be a good precursor molecule to produce a pure TaC layer. The filament temperature and deposition time for the formation of TaC coating will be presented in this work. The third precursor molecule tested in this work, TMDSCB, is an efficient precursor to produce methyl radicals on the W sufrace, therefore, exposure to TMDSCB leads to the carburization of W.[5] By tuning the filament temperature and deposition time, a pure W 2C phase was obtained at 2400 ºC after 1-2 hr of deposition. Once the filament is fully carburized to W 2C, the C-rich WC phase starts to form on the outside layer. A pure WC layer was produced at 2400 ºC and 4 hr deposition time. Our study of the metal carbide formation using HWCVD with novel organosilicon precursors helps shape a new method of forming pure WC and TaC coatings on W and Ta metal surfaces. References 1. R. B. Levy and M. Boudart, Science 181, 547 (1973). 2. I. Badran, T. D. Forster, R. Roesler and Y. J. Shi, J. Phys. Chem. A 116, (2012). 3. I. Badran and Y. J. Shi, J. Phys. Chem. A 119, 590 (2015). 4. I. Badran, W. H. Kan and Y. J. Shi, J. Phys. Chem. C 119, (2015) 5. Y. J. Shi, I. Badran, A. Tkalych, W. H. Kan and V. Thangudurai, J. Phys. Chem. C 117, 3389 (2013). 153

181 (Room 110) 21 June 2016, 15:00-15:30 PM Atomic-scale Imaging of Electronic Properties of the TiO 2(110) Surface by Electrostatic Force Microscopy H. F. Wen, Y. Naitoh, Y. J. Li, and Y. Sugawara Physics Department of Applied Physics, Osaka University, Suita, Osaka, Japan Abstract Gold (Au) is known as one of the chemically inactive materials and is considered to be a noncatalytic metal. However, nano-sized Au clusters with the size of 2-6 nm deposited on metal oxides exhibit an unexpected catalytic behaviors toward a number of reactions. Au/rutile TiO 2(110) surfaces display extremely high catalytic reactivity and have been model to investigate the mechanism of the CO oxidation reaction from both experimental and theoretical viewpoints. There are four representative models that explain the emerging catalytic activity of Au nanoclusters. The first one is a geometric model stating that the fraction of active undercoordinated atoms located at corners and edges increases with decreasing the cluster size. The second model is d-band model which claims that catalytic activities are enhanced as the d-band center position (Ed) moves to the Fermi-level (E F) of a transition metal. The third one is the cationic cluster model. An electronic charge transfer takes place from Au clusters to an O-rich TiO 2(110) surface and thus Au atoms at the interface become cationic, allowing for binding O 2 with a large adhesion energy. The forth one is the interface dipole model in which the perimeter interface of Au/TiO 2 is the reaction site for CO oxidation. However, the injection/extraction mechanism of electrons and the reaction process are not clarified by a comprehensive experimental description. Here we propose a new method for measuring the electronic properties on the surface using electrostatic force microscopy (EFM). Frequency modulation technique was used to measure the tip-sample interaction in UHV condition. We demonstrate simultaneous measurement of topography, contact potential difference between the tip and surface, and dipole moment (Fig. 1) on TiO 2(110) surface with atomic resolution (a) (b) Fig1. (a) Atomical resolution image of dipole moment and (b) the cross-sectional profile along the solid line in (a) measured on TiO 2(110) surface. References 1. L. Kou, Z. M. Ma, Y. J. Li, Y. Naitoh, M. Komiyama, and Y. Sugawara, Surface potential imaging with atomic resolution by frequency-modulation Kelvin probe force microscopy without bias voltage feedback, Nanotechnology, 26, (2015). 154

182 (Room 110) 21 June 2016, 16:00-16:30 PM Magneto-Plasmonic Nanostructures for Theranostic Applications Alejandro G. Roca 1, Elvira Fantechi 1, Neus G. Bastus 1, Victor Puntes 1,2,3 and Josep Nogues 1,2 1 Catalan Institute of Nanoscience and Nanotechnology (ICN2), CSIC and The Barcelona Institute of Science and Technology, Campus UAB, Bellaterra, Barcelona, Spain 2 ICREA- Institució Catalana de Recerca i Estudis Avançats, Barcelona, Spain 3 Vall d Hebron Institut de Recerca (VHIR), 08035, Barcelona, Spain Abstract The emerging use of nanomaterials in widespread applications such as energy storage, catalysis or biomedicine requires the continuous design of increasingly complex synthetic routes [1]. The generation of new nanomaterials demands strategies to tailor not only the structural phases but also their morphology and to combine two or more materials with different functional properties in one nanoplatform leading to hybrid nanostructures with synergic properties. One example is the gold-magnetite system, where the integration of both materials into one nanostructure possesses a tremendous potential in biomedicine. On one hand, magnetite nanoparticles are used as T2 contrast agents in magnetic resonance imaging (MRI) and are able to dissipate heat in the presence of an alternating magnetic field (magnetic hyperthermia) [2]. On the other hand, gold particles can be imaged by optical means due to the surface plasmon resonance or by X- ray computed tomography due to its large Z number. Moreover, gold nanoparticles are able to generate heat by the absorption of light due to their unique surface plasmon resonances (photo hyperthermia) [3] Fig1. Gold-magnetite nanostructures with different morphologies; a) Dimers; b) Flower-like. The objective of this work is the synthesis of Fe 3O 4-Au nanostructures with different sizes and morphologies since the potential effect of Fe 3O 4-Au as theranostic agent will strongly depend on the plasmonic and magnetic properties, which are strongly correlated to the structural parameters. Two different protocols were designed for the synthesis of gold-magnetite nanoparticles based on thermal decomposition. The first method consists on a one-pot synthesis where Au nanoparticles nucleate on the magnetic counterpart. The second route consists on the heteronucleation of Fe 3O 4 onto Au seeds. In both cases, the large lattice mismatch between both materials is the main hurdle for the successful growth of these heterostructures. Thus, we studied the different synthetic parameters (thermodynamic and kinetic) for both routes which control the morphology and the final size of both counterparts. A wide range of heterostructures 155

183 with different morphologies ranging from dumbbell (Fig.1a) to flower-like (Fig. 1b) to heterostructures were obtained in both routes by modifying the synthetic parameters. Additionally, the structural properties, together with optical and magnetic properties of heterostructures with different morphologies will be also presented in order underline the best candidates for different biomedical applications. The authors thank the MAT R and the SEV projects of the Spanish MINECO References 1. Bastús, N. G.; Gonzalez, E.; Esteve, J.; Piella, J.; Patarroyo, J.; Merkoçi, F.; Puntes, V. Z. Phys. Chemie - Int. J. Res. Phys. Chem. Chem. Phys. 229 (1-2), (2015) 2. López-Ortega, A.; Estrader, M.; Salazar-Alvarez, G.; Roca, A. G.; Nogués, J. Phys. Rep., 553, (2015) 3. Dreaden, E.C., Alkilany, A. M., Huang, X. Murphy, C. J. and El-Sayed, M. A., Chem. Soc. Rev., 41, (2012). 156

184 (Room 110) 21 June 2016, 16:30-17:00 PM Magnetic nanoparticles for drug internalization by the iron-acquisition pathway Hémadi Miryana 1, Piraux Hélène 1, Hai Jun 1, Jeanne Volatron 2, Gazeau Florence 2, Verbeke Philippe 3, Ammar Souad 1, and El Hage Chahine Jean-Michel 1 1 ITODYS, Université Paris Diderot, SPC, CNRS UMR-7086, 15 Rue J.-A. de Baïf, Paris, France. 2 Laboratoire MSC, Université Paris Diderot, SPC, CNRS UMR-7057, 10 rue Alice Domon et Léonie Duquet, Paris, France 3 Faculté de médecine Xavier Bichat, Université Paris Diderot, INSERM U699, Paris, France Abstract The targeting of magnetic nanoparticles (NP) remains an important goal of nanomedicine [1] because of its significant role in the diagnosis and treatment of cancer [2]. A targeting agent should imply fast and precise drug delivery directly into the appropriate cells or tissues. Transferrin is one of the two proteins involved in the major iron-acquisition pathway. Indeed, via its interaction with Receptor 1, transferrin crosses the plasma membrane within a few minutes by receptor-mediated endocytosis [3-5]. This protein is, therefore, widely used as a drug carrier. Furthermore, the overexpression of transferrin-receptor 1 in cancer cells enhances transferrin internalization, making it a perfect Trojan horse for nanoparticle delivery [6]. In this work, maghemite nanoparticles of different sizes (5, 10 and 15 nm) were synthesized by the polyol method, coated with 3-aminopropyltriethoxysilane (APTES) and coupled to transferrin by amide bonds. For each NP size, the ratio of transferrin per NP was determined and the interaction in vitro with the receptor investigated. A comparative study of internalization by raw NP and the transferrin constructs was conducted in cellulo. The efficiency of targeting was analyzed by magnetophoresis, ICP and confocal fluorescence microscopy. All our constructs were rapidly internalized in the cytosol of HeLa and lymphocyte cells. A relationship between the size of the constructs and their capability in NP delivery was established. Comparison of our results with those of the literature [7], our system shows promise for theragnostics following the main iron-acquisition pathway. 5 nm 10 nm 15 nm Figure 1 Shematic representation of different sizes of nanoparticles onto which holotransferrins were grafted. References 1. Wiley et al., Proc. Natl. Acad. Sci. U S A, 2013, 110, Xie et al., Biomaterials, 2011, 32,

185 3. Dautry-Varsat et al., Proc. Natl. Acad. Sci. U S A, 1983, 80, El Hage Chahine et al., Biochim. Biophys. Acta, 2012, 1820, Piraux et al., Biochim. Biophys. Acta, 2013, 1830, Daniels et al., Biochim. Biophys. Acta, , Salvati et al., Nat. Nanotechnol., 2013, 8,

186 (Room 110) 21 June 2016, 17:00-17:30 PM Evolution of Pd Nanostructures on c-plane Sapphire by the Control of Annealing Temperature and Duration Mao Sui, Quanzhen Zhang, Sundar Kunwar, Puran Pandey, Ming-Yu Li and Jihoon Lee College of Electronics and Information, Kwangwoon University, Nowon-gu Seoul , South Korea Abstract Self-assembled metallic nanostructures, as a popular nanomaterial with outstanding physical, chemical and optical properties, are widely utilized in solar cells, sensors, LEDs and many other applications. [1-3] In these applications, controllable fabrication of metal nanostructures in terms of dimension, density and configuration can be an important method to control the device performance. For example, in the localized surface plasmon resonance (LSPR) sensors, the controllable fabrication of metallic nanostructures can directly tune the wavelength and sensitivity owing to the enhance absorption and scattering cross-sections. [2-3] Besides, as catalysts, the metallic nanostructures can also be used to design the fabrication of other nanostructures, such as nanowires, nano-rings and nano-holes. [4-6] Fig1. Pd nanostructures fabricated on c-plane sapphire at various annealing temperature between 500 and 950 C with Pd thickness of 12 nm. (a) (j) atomic force microscopy (AFM) top-views of 3 3 µm

187 Thus, in this paper, the dimensional and configurational evolution of self-assembled Pd nanostructures on c-plane sapphire is studied with the systematical control of annealing temperature and annealing duration as shown in Figure 1. We observed two distinguishable growth regimes along the variation of annealing temperature: (i) Void nucleation, void expansion and agglomeration of Pd nano-clusters (500 < AT 650 C) and (ii) Semi-spherical NPs with size evolution (650 C < AT 900 C). And for the investigation of annealing duration at high temperature, the NPs dimensional evolution is dominated by both Oswald ripening and Pd evaporation, resulting in an inverted V shape. Acknowledgements Financial support from the National Research Foundation of Korea (no and 2016R1A1A1A ), and in part by the research grant of Kwangwoon University in 2016 is gratefully acknowledged. References 1. Wang, C., & Astruc, D. Chemical Society Reviews, 43, (2014). 2. Chen, H. M., Chen, C. K., Chen, C. J., Cheng, L. C., Wu, P. C., Cheng, B. H., Ho, Y. Z., Tseng, M. L., Hsu, Y. Y., Chan, T. S. Lee, J. F., Liu., R. S., & Tsai, D. P. ACS nano, 6, (2012). 3. Pu, Y. C., Wang, G., Chang, K. D., Ling, Y., Lin, Y. K., Fitzmorris, B. C., Liu, C. M., Lu, X., Tong, Y., Zhang, J. Z., Hsu, Y. J., & Li, Y. Nano letters, 13, (2013). 4. Wacaser, B. A., Dick, K. A., Johansson, J., Borgström, M. T., Deppert, K., & Samuelson, L. Advanced Materials, 21, (2009). 5. Kolasinski, K. W. Current Opinion in Solid State and Materials Science, 10, (2006). 6. Campos, L. C., Tonezzer, M., Ferlauto, A. S., Grillo, V., Magalhães Paniago, R., Oliveira, S., Laderira, L. O., & Lacerda, R. G. Advanced Materials, 20, (2008). 160

188 (Room 111) 21 June 2016, 09:30-10:00 AM Evolution of a designless nanoparticle network into reconfigurable Boolean Logic Wilfred van der Wiel MESA + Institute for Nanotechnology, University of Twente, P.O. Box 217, 7500 AE Enschede, The Netherlands Abstract Present-day computers are based on integrated circuits, constructed according to fixed design rules and making use of well-defined components. Living systems, however, are able to achieve extraordinary feats of computation without the need for a specific design. Darwinian evolution has resulted in sophisticated information processing systems in which the emergent properties and huge parallelism of complex networks are exploited. Inspired by this, we here report on an artificial system of randomly assembled gold nanoparticles coupled via molecular tunnel barriers, acting as a disordered network of singleelectron transistors at low temperature [1]. Using artificial evolution, we demonstrate that this designless system can be configured into any basic Boolean logic gate with a very high degree of stability and reproducibility. Our results comprise the first experimental demonstration of fully reconfigurable logic based on randomly distributed nanoscale components, and bear direct relevance for future unconventional computer architectures. Fig1. Schematic representation of the disordered nanoparticle network. The inputs V in1 and V in2 are used for applying voltage input signals, the current output is measured at I out. The contacts V 1-V 6 are used for applying control voltages, affecting the input-output characteristics. References 1. S.K. Bose, C.P. Lawrence, Z. Liu, K.S. Makarenko, R.M.J. van Damme, H.J. Broersma and W.G. van der Wiel, Nature Nanotechnology 10, 1048 (2015). 161

189 (Room 111) 21 June 2016, 10:00-10:30 AM On-Chip Nonvolatile Memory for Standalone System using 0.18 Technology Standard CMOS Nobuhiko Nakano 1 1 Keio University, Dept. of Electronics and Electrical Engineering, Yokohama, Japan Abstract Demand of the sensor node has been increasing in recent years. CMOS LSI chip is usually used for the sensor node. However, the LSI chip requires power supply and PCB usually. For these requirements prevents aggressive miniaturization. We are proposing a stand-alone chip called Microsystem, which has no requirement for external power supply and packaging. Microsystem has an energy-harvesting device and application circuit on a same CMOS LSI chip. A power supply system includes an energy harvesting device and a DC-DC boost converter. As an energy-harvesting device, solar cell is used with p-n junction in standard CMOS process and is integrated with other circuits [2]. It outputs maximum 600 mv and several microwatts with a single cell. Moreover, solar cell with a DC-DC boost converter, which has a bootstrap charge pump structure, can output over 1 V, which is sufficient to drive standard CMOS circuits. To realize a microsystem as a sensor node, the data communication is issue. Therefore, the way to read the value is limited because of low power output of solar power supply. For example, general RF continuous communication power consumption is mw order. Hence, it seems that a solar power supply system cannot drive RF circuit. One of method to solve this problem is a storing data on chip and read them later. In this condition of unstable solar power supply system, it is required that memory is nonvolatile. In general, a MOS capacitor acts as a capacitor. Withstand voltage are determined on the MOS structure, therefore, applying higher voltage than the withstand voltage, breakdown occurs to the dielectric oxide [3]. In normal use, this is undesirable behavior. However, a broken MOS capacitor acts as a resistor different from a fresh MOS capacitor. Therefore, by utilizing the change of its state, memory is realized as shown in Fig. 1(a). Using standard CMOS technology, there are two choices to realize nonvolatile memory. One is a MOS capacitor as anti-fuse onetime programmable memory, and the other is a metal fuse as fuse onetime programmable memory. In general, metal fuse programming power consumption is much larger than MOS capacitor [4][5]. Therefore, we choose MOS capacitor as a memory element for Microsystem. A MOS capacitor as anti-fuse memory is to be programmed by applying much higher voltage than the withstand voltage. Applying sufficiently high voltage to the MOS capacitor, hard breakdown occurs in the oxide. It is known that when oxide breakdown occurs is decided by QBD, how much charge flowing in MOS capacitor, or TBD, how long it is applied voltage, depending on applied voltage [6]. Much larger current flows in a broken MOS capacitor than fresh one. Hence, we can discriminate hard broken one or fresh one by measuring flowing current on them when applying voltage. However, it should be noticed that there are two breakdown mode of the roughly divided into MOS breakdown mode as shown in Fig. 1 (b). One is hard breakdown as mentioned above, which is breakdown mode that much larger current flows in the broken MOS than fresh one. The other is soft breakdown which is breakdown mode and leakage current flows in broken MOS, and the current is larger than fresh one, however, lower than hard broken one. In general, they are distinguished by measuring the current value. Fig. 2 shows breaking characteristics of a MOS capacitor. When applying stepwise voltage by 10 mv from 0 V to 10 V, in MOS capacitors of 0.04 µm 2 and 1 µm 2, soft breakdown occurred but no hard breakdown occurred. However, in a MOS capacitor of 100 µm 2, hard breakdown occurred at about 5.6 V, and all size of MOS capacitors became re-insulated at higher voltage such as a fuse. It is a little difficult to discriminate between flesh and soft breakdown than fresh and hard breakdown, and decide when it is broken. Of course it is better to minimize the size 162

190 of MOS capacitors, hence, MOS capacitors size should be designed to the minimum size one which hard breakdown occurs in. We proposed as on-chip nonvolatile memory for Microsystem sensor. A MOS capacitor acts as anti-fuse one-time programmable memory, and can be fabricated in standard CMOS technology. Programming voltage is around 6 V and programming power consumption is µw order, which is lower than the power generated by solar cell in high lux condition. Hence, there is possibility of realize memory for Microsystem. The reading circuit could distinguish between fresh memory and programmed memory. However, there are mainly two of challenges; one is the programming circuit, which boosts voltage from solar cell output to over withstand voltage, and the other is the reading circuit, which is never broken even when applying programming voltage. Fig.1 (a) The operation of a MOS capacitor as anti fuse memory (b) Gate oxide hard breakdown process. Fig. 2 Measured breakdown characteristics of MOS capacitors. Acknowledgements The VLSI chip in this study has been fabricated in the chip fabrication program of VLSI Design and Education Center (VDEC), the University of Tokyo in collaboration with Rohm Corporation and Toppan Printing Corporation. This work was supported by IS program of the Semiconductor Technology Academic Research Center (STARC). References 1. Golsa Moayeri Pour et.al., IEEE Transactions on Circuits and Systems II: Express Briefs, vol.61, no.7, pp , July Jordi Sune et.al., IEDM 1998, pp , December Ngoc Dang Phen et.al., Circuits and Systems 1: Regular Papers Vol. 60, No.7, pp , Kuei-Sheng Wu et.al., Interconnect Technology Conference and Materials for Advanced Metallization, pp.1-3, Schuegraf, KlausF et.al.,, IRPS 1993, pp.7-12, March

191 (Room 111) 21 June 2016, 11:00-11:30 AM Understanding Molecular Recognition and Assembly at Biological-Inorganic Interfaces to Engineer New Functional Materials: Catalysts, Sensors, and Biominerals Hendrik Heinz Department of Chemical and Biological Engineering, University of Colorado-Boulder, Boulder, CO 80309, USA Abstract The mechanism of specific adsorption of polymers and biomacromolecules onto metallic and oxidic nanostructures will be explained in atomic resolution resulting from simulations with novel force fields and surface models in comparison to measurements (Figure 1). As an example, variations in peptide adsorption on Pd and Pt nanoparticles depending on shape, size, and location of peptides on specific bounding facets are determined by soft epitaxial processes and induced charges. Accurate computational predictions of reaction rates in C-C coupling reactions using particle models derived from HE-XRD and PDF data illustrate the utility of computational methods for the rational design of new catalysts. On oxidic nanoparticles such as silica and apatites, it is shown how changes in ph lead to similarity scores of attracted peptides lower than 20%, supported by model surfaces of appropriate surface chemistry and data from adsorption isotherms. The results demonstrate how new computational methods can support the design of structured hydrogels, nanoparticle carriers for drug release, and the understanding of calcification mechanisms in the human body. The main features of the INTERFACE force field for accurate simulations of inorganic/organic and inorganic/biological interfaces will be discussed and explained at hand of examples. Fig. 1. Examples of biomolecular recognition on inorganic surfaces and interfacial features that determine surface reactivity. 164

192 References 1. H. Heinz and H. Ramezani-Dakhel. Chem. Soc. Rev. 45, 412 (2016). 2. N. M. Bedford, H. Ramezani-Dakhel, J. M. Slocik, B. D. Briggs, Y. Ren, A. I. Frenkel, V. Petkov, H. Heinz, R. R. Naik, and M. R. Knecht. ACS Nano 9, 5082 (2015). 3. H. Heinz, T. J. Lin, R. K. Mishra, F. S. Emami. Langmuir 29, 1754 (2013). 165

193 (Room 111) 21 June 2016, 11:30-12:00 AM Molecular Dynamics Study of Diffusion in Polymers Phillip Choi 1 1 Department of Chemcial and Materials Enigneeering, University of Alberta, Edmonton, Alberta, CANADA Abstract With ever-increasing demand on the performance of materials exhibiting unique functional properties, design of such materials and the associated manufacturing processes has become fairly sophisticated. This, in turn, requires a deeper understanding of the corresponding structure-processing-property relationships. And in some cases, it is highly desirable to have molecular level of understanding. With advances in computer technology and developments in molecular simulation methods, complex molecular systems and physical phenomena of engineering importance can be investigated with ease. Such simulation provides an effective means to determine how molecular structure and atomic-level interactions determine macroscopic properties of materials of interest as well as how they response to the imposed processing conditions. In this presentaion, I will present some basic principles and techniques used in molecular simulation and research problems in the area of diffusion in polymers that my group has embarked on over the past decade using such techniques. 1 In one example, I will demonstrate how molecular simulation help design a biopolymer that has the potential to be used for food packaging applications. 2 References 1. A. Noorjahan and P. Choi, Chemical Engineering Science 121, 258 (2015). 2. D. Zhou, F. Bayati and P. Choi, Carbohydrate Polymers 98, 644 (2013). 166

194 (Room 111) 21 June 2016, 12:00-12:15 PM Two-dimensional Magnetic Nanosheets for Rapid Separation of Biomolecules and Pollutants Kuan-Syun Wang, Ting-Yu Liu 1 Dept. Materials Engineering, Ming Chi University of Technology, Taipei, Taiwan Abstract Two-dimensional (2D) nanomaterials, such as molybdenum disulfide (MoS 2), montmorillonite (MMT) and graphene oxide (GO) nanosheets, are next generation novel materials, due to their distinctive nanoscale chaterizations (high surface area) for increasing nanotechnology development. Moreover, magnetic materials have been wildly used for nano and bio-technology, such as microwave absorbing, hyperthermia therapy, drug carriers, and magnetic separation. Therefore, we would combine the advantages of magnetic properties and 2D materials to modify Fe 3O 4 nanoparticles on the MoS 2, MMT and GO nanosheets. The novel magnetic 2D nanosheets would be employed for rapid magnetic separation of biomolecules and pollutants (Fig. 1). The size of magnetic nanosheets is about 500 nm 500 nm and the diameters of Fe 3O 4 nanoparticles are about 5-10 nm by TEM observation. The characterizations of magnetic 2D nanosheets would be evaluated by FTIR, zeta potential, XRD, TEM, VSM and XPS. The results show that 100 ppm of malachite green solutions could be fully captured by 3 mg/ml magnetic nanosheets at 20 min under the external magnetic field. The novel magnetic nanosheets provides high surface area (capacity) and rapid separation capability, which offers great potential for practical applications in environment pollution and biomedical fields. [1, 2] Fig. 1 Illustration of the magnetic separation of biomolecules and pollutants by magnetic (Fe 3O 4) nanosheets References 1. Sun, H., L. Cao and L. Lu (2011). Nano Research 4(6): Yu, J., W. Yin, X. Zheng, G. Tian, X. Zhang, T. Bao, X. Dong, Z. Wang, Z. Gu, X. Ma and Y. Zhao (2015). Theranostics 5(9):

195 (Room 111) 21 June 2016, 12:15-12:30 PM How simple are the models of Na intercalation in aqueous media? Jeongsik Yun 1, Jonas Pfisterer 1 and Aliaksandr Bandarenka* 1,2 1 Physics Department, Technical University of Munich, Munich, Germany 2 Nanosystem Initiative Munich, Munich, Germany Abstract Renewable energies take up already a substantial portion of the energy provision schemes in a number of countries due to sustainability and environmental issues which become more and more important in the future. However, since they are intermittent energy sources, it is required to be equipped with Energy Storage Systems (ESS) in order to address the so called generation versus consumption problem. Among many different types of ESS, batteries are considered as one of the best candidates thanks to their desirable characteristics. The Li-polymer batteries are currently viewed as the best in terms of performance, but for the grid scale application, there are several issues. The affordability of Li and the safety issues concerning the use of organic electrolytes could make it difficult to upscale, which in turn would increase the maintenance costs. Hence, Na-ion batteries operating in aqueous media are regarded as the potential alternatives for large scale applications. Despite the steadily increasing interest in such storage systems, there is a certain lack of the fundamental understanding of the intercalation process which is necessary to effectively improve and design better battery systems. Therefore, in this study we performed an in-situ characterization of the Na-intercalation with so-called hyphenated techniques including simultaneous measurements using cyclic voltammetry (CV), electrochemical impedance spectroscopy (EIS), and electrochemical quartz crystal microbalance (EQCM). Fig. 1. Schematics of (A) the temporal and spatial charge compensation during intercalation of Na, (B) potential shifts between charging and discharging as a function of the anion nature and (C) the onset potential of Na intercalation versus the solvation energy of alkali metal cations [1]. A Na-intercalation mechanism is proposed and factors influencing so-called voltammetric reversibility in charging and discharging and the onset potentials of the intercalation in the presence of different electrolytes are demonstrated using electrochemically deposited Na 2Ni[Fe(CN) 6] thin film which is one of the state of the art cathode materials for Na-ion 168

196 batteries. The experimental results suggested that the current understanding of the intercalation mechanisms in aqueous systems might be oversimplified and the Na intercalation should have at least a three-stage process, which is influenced by the nature of the anions in the electrolyte as schematically illustrated in Fig 1 (A). In addition, Fig 1(B) shows that the charge and its distribution at the anions have an influence on the voltammetric reversibility, apart from the changes in the electrolyte conductivities. Furthermore, the nature of the intercalating cations also plays an important role. The onset potential of the intercalation is not only dependent on the electrode materials themselves, but also on the solvation energy of the intercalated species as shown in Fig 1 (C). Moreover, the specific capacity of the Na 2Ni[Fe(CN) 6] film even at a high C-rate (180 C) exhibited ~80 ma h/g which is, to the best of our knowledge, the highest value reported for this material in aqueous Na-ion batteries [1]. References 1. J. Yun, J. Pfisterer and A. S. Bandarenka, Energy and Environ. Sci., 2016, DOI: /C5EE

197 (Room 111) 21 June 2016, 14:00-14:30 PM Electrochromic Devices with Metallo-Supramolecular Polymers Masayoshi Higuchi 1,2 1 National Institute for Materials Science, Tsukuba , Japan 2 JST-CREST, Japan Abstract Electrochromic displays have received attention as low energy consumption devices due to the memory properties. Actually electrochromic displays are loaded as smart window in recent airplanes (Boeing 787). The device properties greatly depend on the electrochromic material used in the device. Therefore, the development of electrochromic devices is influenced by the appearance of new electrochromic materials. Many electrochromic materials including WO 3, viologen, and conjugated polymers have been investigated so far. In my presentation, I introduce recent progress on the synthesis and properties of metallo-supramolecular polymers for the electrochromic device application. Metallo-supramolecular polymers were synthesized by the 1:1 complexation of transition metal ions with ditopic organic ligands. Blue, red, yellow, black, and green electrochromism were observed in Fe(II)-, Ru(II)-, Co(II)-, Co(I)-, and Cu(II)-based metallo-supramolecular polymers, respectively[1] Heterometallo-supramolecular polymers with two metal ion species show multi-color electrochromism due to the different redox potential of the metal ions.[2] Expect for the electrochromism, the polymers exhibited various electronic, ionic, and emissive properties.[3] The polymer films are easily prepared by spin-coating. Therefore, the device applications are not so difficult, unlike general metal complexes with high crystallinity. The device with the polymer layer and a gel electrolyte layer showed reversible color change by applying 3/-3V between the two ITO electrodes. References 1. (a) M. Higuchi, D. G. Kurth, Chem. Rec., 7, 203 (2007). (b) F. S. Han, M. Higuchi, D. G. Kurth, Adv. Mater., 19, 3928 (2007). (c) F. S. Han, M. Higuchi, D. G. Kurth, J. Am. Chem. Soc., 130, 2073 (2008). (d) M. D. Hossain, T. Sato, M. Higuchi, Chem. Asian J., 8, 76 (2013). (e) C.-W. Hu, T. Sato, J. Zhang, S. Moriyama, M. Higuchi, ACS Appl. Mater. Interfaces, 6, 9118 (2014). (f) C.-Y. Hsu, J. Zhang, T. Sato, S. Moriyama, M. Higuchi, ACS Appl. Mater. Interfaces, 7, (2015). (g) M. Higuchi, J. Mater. Chem. C, 2, 9331 (2014). (h) B.-H. Chen, M. Higuchi, K.-C. Ho, Y.-C. Liao et al., ACS Appl. Mater. Interfaces, 7, (2015). 2. (a) C.-W. Hu, T. Sato, J. Zhang, S. Moriyama, M. Higuchi, J. Mater. Chem. C, 1, 3408 (2013). (b) M. D. Hossain, M. Higuchi et al., Eur. J. Inorg. Chem., 2014, 3763 (2014). 3. (a) R. K. Pandey, M. D. Hossain, S. Moriyama, M. Higuchi, J. Mater. Chem. A, 1, 9016 (2013). (b) R. K. Pandey, M. D. Hossain, S. Moriyama, M. Higuchi, J. Mater. Chem. A, 2, 7618 (2014). (c) R. K. Pandey, M. Higuchi et al., Chem. Commun., 51, (2015). (d) T. Sato, M. Higuchi, Chem. Commun., 48, 4947 (2012). (e) T. Sato, M. Higuchi, Chem. Commun., 49, 5256 (2013). (f) R. K. Pandey, M. Higuchi et al., RCS Advances, 5, (2015). (g) C. Chakraborty, M. Higuchi et al., ACS Appl. Mater. Interfaces, 7, (2015). (h) M. D. Hossain, R. K. Pandey, U. Rana, M. Higuchi, J. Mater. Chem. C, 3, (2015). (i) T. Suzuki, T. Sato, J. Zhang, M. Kanao, M. Higuchi, H. Maki, J. Mater. Chem. C, 4, 1594 (2016) 170

198 (Room 110) 21 June 2016, 14:30-15:00 PM High Speed Electro-Optic Polymer/TiO 2 Vertical Slot Waveguide Modulators Yasufumi Enami 1, Jingdong, Luo 2, and Alex K-Y. Jen 2 1 Graduate School of Engineering, Kochi University of Technology, Kami, Kochi, Japan 2 Department of Materials Science and Engineering, University of Washington, Seattle, Washington USA Abstract We analyze an advantaqe of electro-optic (EO) polymer (SEO125)/TiO 2 slot waveguide modulator [1, 2] for high speed and low half wave voltage (V ) as shown in Fig. 1. Thickness of TiO 2 slot layers is critically reduced to a less than single mode condition ( /2n effective), where is the wavelength and n effective is the effective refractive index of the waveguide. The modulator has similar mode confinement and higher poling efficiency of the EO polymer, compared to our previous hybrid EO polymer/sol-gel silica waveguide modulators [3]. Therefore, the slot waveguide modulator can realize a lower half-wave voltage (V )-electrode length (L e) product (V L e). We show the enhancement of the poling efficiency in these devices when the EO polymers are poled with TiO 2 and sol-gel silica layers. Mach-Zehnder-type EOP/TiO 2 vertical slot waveguide modulators were fabricated using a m-thick EOP layer sandwiched between two 0.1- m-thick TiO 2 thin film layers. A cross-sectional view of a 4- m-wide Mach- Zehnder-type waveguide used in the modulator is shown in Fig. 1(a). A standard hybrid EOP/SG silica waveguide modulator is also shown in Fig. 1(b). Fig1. Cross sectional view of (a) the EO polymer/tio 2 slot waveguide modulator and (b) the hybrid EO polymer/sol-gel silica waveguide modulator The mode profile in the slot waveguide was calculated using the three-dimensional finitedifference time domain (3D FDTD) method. Mode overlap integral ( ) between the optical wave in the active region and the applied electric field with respect to thickness of EO polymer (t EO) was obtained from the result for the calculated mode profile, which was normalized using effecitive electrode distance (d effective) as shown in Fig. 2. The V L e products of the EOP/TiO 2 slot waveguide modulators was calculated from the in-device r 33 value of 70 pm/v and the obtained value of. The dependence of the V L e product for the slot waveguide modulator on the EOP thickness was obtained for 4- m-thick SG silica under cladding layers, as shown in Fig

199 Fig. 2 Normalized mode overlap integral between the optical mode and the applied electric field divided by the effective electrode distance d effective with respect to the thickness of the EOP layer, t EO. The solid lines (EOP/TiO 2 vertical slot waveguide modulators) in red, green, blue, and black show the results for SG silica thicknesses under cladding of 1, 2, 3, and 4 m, respectively. The dotted lines (standard hybrid EOP/SG silica waveguide modulators) in red, green, blue, and black show the results for SG silica thicknesses under cladding of 1, 2, 3, and 4 m, respectively. Fig. 3 V L product with respect to the thickness of the EOP (SEO125). Blue closed circles denote the experimental results and the red line shows the result calculated by the 3D FDTD method. The V L e product was experimentally measured at 1 khz for several modulators with different EOP thickness (t EO) values, ranging from 0.3 to 0.6 m, as shown in Fig. 4. The measured V L e products were well matched with the theoretically calculated values [4]. 172

200 We recently fabricated high speed EO polymer/tio 2 slot waveguide modulators after the top and bottom electrode was modified for RF miscrostrip line. The 3 db optical bandwidth was calculated to be more than 60GHz. 6dB electrical bandwith (correspondes to 3dB optical bandwidth) for the RF electrode was measured to up to 50GHz. The measured bandwidth was limited by the ability of RF equipments, and this can be extended to be more than 50GHz when we use better RF equipment of >50GHz. References 1. Y. Enami, B. Yuan, M. Tanaka, J. Luo, and A. K-Y. Jen, Electro-optic polymer/tio2 multilayer slot waveguide modulators, Appl. Phys. Lett., 101, pp (2012). 2. Y. Enami, Y. Jouane, J. Luo, and A. K-Y. Jen. Enhanced conductivity of sol-gel silica cladding for efficient poling in electro-optic polymer/tio2 vertical slot waveguide modulators. Opt. Express 22, (2014). 3. Y. Enami, D. Mathine, C.T. DeRose, R.T. Norwood, J. Luo, A. K.-Y. Jen, N. Peyghambarian, Hybrid cross-linkable polymer/sol-gel waveguide modulators with 0.65V, Appl. Phys. Let (2007). 4. Y. Enami, H. Nakamura, J. Luo, and A. K-Y. Jen, Analysis of efficiently poled electrooptic polymer/tio2 vertical slot waveguide modulators, Optics Communications, 362, (2016). 173

201 (Room 110) 21 June 2016, 15:00-15:30 PM Development of Supramolecular Polymers based on Unique Molecular Recognition Motifs Takeharu Haino 1 1 Department of Chemistry, Graduate School of Science, Hiroshima University, Japan Abstract Supramolecular polymers are a promising class of molecular assemblies with huge versatility compared with their covalent polymeric equivalents. Each monomer of a polymer chain is connected with reversible bonds; therefore, monomeric and polymeric states are in equilibrium over the experimental timescale. Molecular recognition eventsare highly selective and directional for determining the size, direction, and dimension of the resulting supramolecular polymers. Although quite a number of host-guest structures have been developed over the history of supramolecular chemistry, a limited number of recognition motifs have been employed as supramolecular connections in polymeric assemblies. 1,2 We have developed a methodology that uses our unique host-guest motifs to realize supramolecular polymeric assemblies with a high degree of organization. The calix[5]arenefullerene interaction and molecular associations of bisporphyrin clefts have been demonstrated to be key intermolecular connections that enable supramolecular polymerization of monomeric building blocks. In this presentation, we describe our recent developments on supramolecular fullerene polymers 3-5 and supramolecular porphyrin polymers 6-8 established via molecular recognition of our host-guest complexes. Ditopic host Tritopic host Ditopic guest Figure 1. Schematic representation of supramolecular polymers and networks. 4 Figure 1 displays the synthetic strategy of supramolecular fullerene polymers and networks beased on a biscalix[5]arene C60 supramolecular structure. Di- and tritopic hosts generates the linear and network supramolecular polymers through the complexation of a dumbbell-shaped fullerene. The supramolecular fullerene polymers and networks was established by diffusionordered 1 H NMR spectroscopy (DOSY) and solution viscometry. As concentrating the mixtures of di- or tritopic hosts and dumbbell-shaped fullerene, the diffusion coefficients of the complexes were decreased, and the solution viscosities were increased. This implys that large polymeric assemblies were produced in solution. A mixture of the homoditopic host and the fullerene resulted in fibers. The homotritopic host generated the supramolecular networks with the dumbbell-shaped fullerene. Distorted honeycomb structures were observed. The growth of the supramolecular polymers is clearly governed by the shape, dimension, and directionality of the monomers. 174

202 Ph Ph NH N N HN Ph O HN N OC 12H 25 OC 6H 12O O O Ph Ph NH N N HN Ph HN O OC 12H 25 O 2N O 2N NO 2 Figure 2. Schematic representation of supramolecular polymerization of a heteroditopic monomer. 7 Self-assembly of porphyrins in organic media, driven by weak noncovalent forces, is limited, although the porphyrin moiety possesses an electron-rich surface that generates the attractive charge-transfer (CT) interactions. We have developed a bisporphyrin cleft connected by a pyridine dicarboxamide linker that assembles to form a complementary dimer. 9,10 The competitive complexation of an electron-deficient aromatic guest into the bisporphyrin cleft results in a CT host guest complex. These supramolecular motifs can be utilized for the guest motif was introduced into the heteroditopic monomer (Figure 2). The electron-deficient guest moiety can bind within the bisporphyrin cleft through a CT interaction. Iterative head-to-tail host guest complexation can generate a brand-new supramolecular polymer (Figure 2). DOSY determined the hydrodynamic radii for molecular aggregates in solution. Upon concentrating the solution, the diffusion coefficient of the monomer decreased nonlinearly, which resulted in the degree of polymerization of 660-mer. Viscometry gives fruitful information concerning the size and structure of supramolecular assemblies in solution. The specific viscosities for solutions of the monomer in chloroform significantly increased upon concentrating a solution. Critial polymerization concentration was determined to be 23 mmol L 1. Above the CPC, the well-developed polymer chains were evidently entangled in solution. References 1. Haino, T. Polym. J. 2013, 45, Haino, T. Chem. Rec. 2015, 15, Haino, T.; Matsumoto, Y.; Fukazawa, Y. J. Am. Chem. Soc. 2005, 127, Hirao, T.; Tosaka, M.; Yamago, S.; Haino, T. Chem. Eur. J. 2014, 20, Haino, T.; Hirai, E.; Fujiwara, Y.; Kashihara, K. Angew. Chem. Int. Ed. 2010, 49, Haino, T.; Fujii, T.; Watanabe, A.; Takayanagi, U. Proc. Natl. Acad. Sci. USA 2009, 106, Haino, T.; Watanabe, A.; Hirao, T.; Ikeda, T. Angew. Chem. Int. Ed. 2012, 51, Kinjo, K.; Hirao, T.; Kihara, S.-i.; Katsumoto, Y.; Haino, T. Angew. Chem. Int. Ed. 2015, 54, Haino, T.; Fujii, T.; Fukazawa, Y. J. Org. Chem. 2006, 71, Haino, T.; Fujii, T.; Fukazawa, Y. Tetrahedron Lett. 2005, 46,

203 (Room 111) 21 June 2016, 16:00-16:30 PM The designing of coordination polymers consisting of late-transition metals and lanthanide ions for luminescence enhancement Zerihun Assefa 1, Richard Sykora 2 1 Department of Chemistry, North Carolina A&T State University, Greensboro, NC 27411, USA 2 Department of Chemistry, University of South Alabama, Mobile, AL 36688, USA Abstract Lanthanide ions have sharp characteristic emission in the visible and near-infrared (NIR) ranges, long luminescence lifetimes, and large Stokes shifts, which makes them very attractive candidates for the development of optical devices, including as light conversion materials. The potential for these and other applications requires a new approach in the choice of chromophores suitable for lanthanide sensitizations. Although great progress has been made to circumvent the problem of inefficient direct f-f absorption in lanthanide systems through the process of sensitization, the conversion efficiency of the absorbed photon to visible emission is typically low, except in a few cases. In doing so we hope to (1) broaden the energy range for donor light harvesting and (2) create systems with highly efficient lanthanide luminescence via cooperative energy transfer from the donor groups. A class of chromophores involving transition metal complexes is emerging as a suitable choice as sensitizer for lanthanide ion acceptors. A major advantage afforded by these chromophores is their ability to sustain a better energy match-up with most Ln 3+ acceptor states. Unique advantages of metal complexes over organic chromophores are that they provide a relatively high triplet quantum yield due to the rapid intersystem crossing inherent within the system (due to the heavy-atom effect), and the possibility of a facile detection of both quenching of the d-block chromophores and the sensitized emission from the lanthanide centers. One of our research aims is to prepare compounds that contain multiple donor species that can cooperatively enhance the lanthanide emission. Hence, two classes of donor groups are discussed in this talk. One class involves N- containing multidentate donor ligands that include terpyridine and bipyridine. The second class of donors involves selected group 10 and 11 transition metal complexes that are used for direct coordination at the lanthanide center. The choice of donor groups is established based on the presence of strongly overlapping absorption regions that will provide the added advantage of broadening the usable excitation range and promote tunability to the emission. The structural and photophysical details as well as the energy transfer mechanisms and the sensitization efficiency are studied through temperature dependent, life-time, time-resolved, quantum yield and luminescence experiments. Fig1. Dual donor excitation and emission enhancement. 176

204 References 1. Z. Assefa, R. E. Sykora, Review (Invited) Comments on Inorganic Chemistry, 33 (5-6), (2013) 2. R. B Thomas, P. A. Smith, A. Jaleel,; P. Vogel, C. Crawford; Z. Assefa,; R. Sykora, 3. Inorg. Chem. 51, (2012). 4. B. A. Maynard, P. A. Smith, L. Ladner, A. Jaleel, N. Beedoe, C.Crawford, Z. Assefa, R. E. Sykora Inorg. Chem. 48, (2009). 177

205 (Room 110) 21 June 2016, 16:30-17:00 PM Preparation of Polymer with Perylenediimide Side Chain and Characterization of Its Nanotsructure Tomoyasu Hirai 1,2,3, Makoto Kido 2, Atsushi Takahara 1,2,3 1 Institute for Materials Chemistry and Engineering, 2 Graducate School of Engineering, 3 International Institute for Carbon-Neutral Energy Researuch, Kyushu University, Fukuoka, Japan Abstract Polymers with perylenediimide (PDI) pendant side chain are of great interest as n-type organic solar cell materials and memory devices, owing to its great conductivity. Generally, both long linear and branched alkyl chains are introduced to improve solubility and thereby enhance processability[1-2]. The long linear chains are typically inserted as a spacer between the main chain and PDI segments, whereas the branched alkyl chains are included as tail group at the PDI termini. Depending on the length of the alkyl chains, various ordered structure ranging from liquid-crystalline to crystalline have been observed. We recently reported that a polymer containing a dodecyl group as long liner spacer and bishexylheptyl groups as branched alkyl tail group, designated PAc12PDI, organized into various crystal lattices in the thin film state depending on preparation conditions, which lead to specific n-type memory properties[3]. To further improve the functional performance of this type of PDI-containing material, it is necessary to better control the orientation of the side chains. However, varying alkyl chain length provides only limited control of this critical property. The aim of this study is to Fig 1. WAXD patterns for PAc12PDI with (a) M n = 8,000, (b) M n = 11,700, (c) M n = 29,900. (d-f) Azimuthal plots of the (020) diffraction. 178

206 understand the effect of molecular weight on the formation and orientation of microcrystalline regions for this promising class of polymers. Panel (a)-(c) in Fig. 1 show the WAXD pattern of the PAc12PDI fiber with different M n. The fiber axis was fixed along the meridional direction. All diffraction patterns were clearly assignable by assuming a monoclinic crystals, as previously reported[3]. In the small angle region, the diffraction patterns are assigned to (100), (002) and (003) reflections of the monoclinic crystal. In the wide angle region, the diffraction peak at q = 18.2 nm -1 is assigned to the (020) reflection, which corresponds to stacking between PDI units. The WAXD results indicate that M n does not affect the formation of monoclinic crystals. However, the azimuthal angle of the peak in the (020) diffraction was found to depend on the M n, which indicates a shift in the orientation of the side chain groups with respect to the main chain as M n increases. In the case of the PAc12PDI with M n of 8,000, the diffraction peak was located along the equatorial axis, whereas the diffraction in the PAc12PDI with M n of 11,700 appeared on both meridional and the equatorial axis. For the sample with the highest molecular weight, M n=29,900, the (020) diffraction was primarily along the meridian. The azimuthal angle dependence of intensity of the (020) diffraction on M n is shown in Panel (d)-(f) in Fig. 1. To quantitatively compare between the intensity of the (020) diffraction peaks along the meridional and equatorial axes, designated I 1 and I 2, respectively, it is necessary to normalize the curves using the integrated intensity at all scattering vectors. It was assumed that I 1 and I 2 are both Gaussian distribution functions of the azimuthal angle, φ, with peaks along the meridional (φ =0 ) meridian and equatorial (φ =90 ) axes, respectively. The solid lines in Fig. 1(d) are the best fit obtained using Gaussian function to the measured data shown as open symbols. The I 1 (φ) and I 2 (φ) so obtained were then used to determine the normalized integral intensity, I(q), defined by equation 1[4]. π I i (q) = 2 I i (φ)2πq sinφ dφ, 0 i = 1 or 2 (1) The normalized integral intensity of the (020) reflections along the equator (i=1) and meridian (i=2) were evaluated using equation 1. The ratios are summarized in Table 1. The results clearly show that in the case of PAc12PDI with M n of 8,000, the (020) plane is oriented parallel to the fiber axis, whereas for the sample with M n of 29,900, it is oriented perpendicular to the fiber axis. For the intermediate case of PAc12PDI with M n of 11,700, two peaks are observed, which indicates that populations of crystals with (020) plane parallel and perpendicular to the fiber axis coexist. To more meaningfully describe the observed transition in side chain orientation, the aspect ratio of the polymer chain, as defined by the ratio between length of the main and side chains, was estimated using equation 2: Aspect ratio = n 3.48 (2) where and 3.48 are the bond lengths in units of nm/monomer unit in the main chain and side chain directions, respectively, and n is the degree of polymerization. The aspect ratio may be interpreted as a ratio between major and minor axes, where an aspect ratio greater or less than 1 indicates that either the main chain or the side chain serves as the longitudinal axis of the polymer, respectively. A summary of the results is included in Table 1. For the PAc12PDI with M n of 8,000, the side chains are longer than the main chain of the polymer and thereby serve as the longitudinal axis, resulting in side chain orientation along the fiber axis (Fig. 2a). In contrast, the observed shift in side chain orientation perpendicular to the fiber axis for the PAc12PDI with M n of 29,900, may be attributed to the increase in aspect ratio above 1, which indicates that the main chain is the longitudinal axis in this case (Fig. 2b). Based on these findings, it appears that when the fiber is spun from the isotropic melt, the major axis of the polymer chain will easily align in the flow direction and remain oriented along the fiber axis upon cooling. The minor axis will then be oriented perpendicular to the fiber axis. In the case of PAc12PDI with M n of 11,700, the aspect ratio is close to 1, which indicates that 179

207 there is no well-defined major or minor axis and accounts for the observed mixture of the two different orientations of the side chains with respect to the fiber axis. Table 1. Influence of M n on aspect ratio and normalized scattering intensity along fiber axis. Fig 2. Schematic illustration for chain conformation in the isotropic melt (left), preparation of the fiber (center), and the aggregation state in the fiber (right) of PAc12PDI with a) higher and b) lower M n. References 1. M. Sommer, A. S. Lang, M. Thelakkat, Angew. Chem. Int. Ed. 47, 7901 (2008). 2. P. Kohn, L. Ghazaryan, G. Gupta, M. Sommer, A. Wicklein, M. Thelakkat, T. Thurn- Albrecht, Macromolecules, 45, 5676 (2007). 3. Y. Y. Kim, B. J. Ree, M. Kido, Y. G. Ko, R. Ishige, T. Hirai, D. Wi, J. Kim, W. J. Kim, A. Takahara, M. Ree, Adv. Electron. Mater. 1(10), (2015). 4. Y. Shoji, R. Ishige, T. Higashihara, J. Morikawa, T. Hashimoto, A. Takahara, J. Watanabe, M. Ueda, Macromolecules 46, 747 (2013). 180

208 (Room 107) 22 June 2016, 09:30-10:00 AM Hybrid Perovskite Single Crystals: Properties, Growth Design, and Device Applications Osman M. Bakr 1 1 Division of Physical Sciences and Engineering, Solar and Photovoltaics Engineering Center, King Abdullah University of Science and Technology (KAUST), Thuwal , Kingdom of Saudi Arabia Abstract Low temperature solution-grown hybrid perovskite single crystals exhibit low trap density, a large non-linear optical absorption-cross-section, low intrinsic carrier concentration, high mobility, and long diffusion length for photogenerated charge carriers outperforming perovskite-based polycrystalline disordered thin films and even putting them on par with optoelectronic grade III-V semiconductors. These impressive characteristics make perovskites an ideal choice for realizing highly efficient photovoltaics, fast and sensitive photodetectors, as well as a wide array of linear and non-linear applications. However, perovskite macroscopic single crystals are a challenge to grow on planar substrates, which is a major hindrance for their optoelectronic integration. I will highlight our work in understanding and engineering the growth of perovskite crystals, including the discovery of inverse temperature crystallization; and our efforts to realize planar-integrated single-crystal films, which enabled us to realize record performance narrowband and broadband photodetectors, as well as the first monocrystalline film perovskite solar cell. References 1. D. Shi, V. Adinolfi, R. Comin, M. Yuan, E. Alarousu, A. Buin, Y. Chen, S. Hoogland, A. Rothenberger, K. Katsiev, Y. Losovyj, X. Zhang, P.A. Dowben, O.F. Mohammed, E.H. Sargent, and O.M. Bakr, Science 347, 6221, 519 (2015). 2. M.I. Saidaminov, A.L. Abdelhady, V. Burlakov, B. Murali, W. Peng, D. Dursun, L. Wang, A. Goriely, T. Wu, O.F. Mohammed, and O.M. Bakr, Nature Communications 6:7586, /ncomms8586 (2015). 3. M.I. Saidaminov, V. Adinolfi, R. Comin, A.L. Abdelhady, W. Peng, I. Dursun, M. Yuan, S. Hoogland, E.H. Sargent, and O.M. Bakr, Nature Communications 6:8724, /ncomms9724 (2015). 4. W. Peng, L.F. Wang, B. Murali, K.T. Ho, A. Bera, N.C. Cho, C.F. Kang, V. Burlakov, J. Pan, L. Sinatra, C. Ma, W. Xu, D. Shi, E. Alarousu, A. Goriely, J.H. He, O.F. Mohammed, T. Wu, and O.M. Bakr, Advanced Materials, /adma (2016). 181

209 (Room 107) 22 June 2016, 10:00-10:30 AM Atomic scale visualization of topological dynamics of plaquette antiferromagnetic order and interfacial phonons in tetragonal FeAs layer encapsulated in perovskite layers using spin-polarized STM Jhinhwan Lee 1 1 Physics Department, KAIST, Daejeon 34141, Korea Abstract The magnetism coexisting with superconductivity on the Fe-layer in iron-based superconductors (IBS) has been a surprise for a decade. One fundamental relevant issue is to understand the exact magnetic ground state and its low energy excitations, which are related to the exchange interactions between the Fe magnetic moments, their quantum fluctuations and the magnetoelastic effect due to the orthorhombic structural deformation that usually accompanies the magnetic transition. The parent-state superconductor Sr2VO3FeAs has fairly high Tc near 35 K and has little orthorhombic deformation down to 4 K and thus can be an ideal model IBS system for understanding the effects of exchange interactions and the quantum fluctuations. Theory suggests that plaquette order is preferred over the diagonal double stripe order in the absence of orthorhombicity in the Fe lattice. Here we report spin-polarized scanning tunneling microscope (SPSTM) study on Sr2VO3FeAs revealing the plaquette antiferromagnetic spin order in the Fe layer. In the symmetry of the tetrahedral FeAs4-based unit cell with two Fe atoms, the plaquette order shows C4-symmetric (2 2) unit cell structure as measured by SPSTM tip where the current channel through each vertical As-V pair averages the magnetic moments of the four neighboring Fe moments. The appearance of four distinct phase-slip domains and the atomic scale spin-contrast of the domain boundaries are also consistent with the plaquette order in the Fe layer. Our large-scale atomic resolution SPSTM images demonstrate that the domain walls of plaquette AFM order forms a non-trivial topology of topological defects with well-defined topological charges. Even in the presence of tiny external electric current, the domain wall configuration fluctuates significantly through the annihilation and creation of topological defect pairs. The large-scale domain topology and the time evolution of domain walls and topological defects with atomic resolution reveal the unprecedented physics of the plaquette order in the Fe layer with negligible orthorhombicity. Recently the interface between monolayer iron-based superconductor with perovskite substrate has shown the possibility of high Tc in excess of 100 K probably due to enhancement of the antiferromagnetic spin fluctuation-mediated pairing of the electrons by phonons provided by the perovskite substrate. The family of Fe-based superconductors such as (Sr,Ba)2(V,Cr,Sc)O3FeAs have similar but somewhat distinct structure in a sense that it is a self-assembled bulk crystal with repetition unit made of a single FeAs layer coupled to two perovskite-like layers on its sides, possessing the possibility of significantly enhanced electronphonon interaction. Here we present a spectroscopic imaging scanning tunneling microscopy study on a parent compound superconductor Sr2VO3FeAs with Tc ~ 35 K, where we observed (1) two distinct replica bands separated by the phonon mode energy both in the filled and empty states as signatures of strong electron coupling with interfacial phonons and (2) anisotropic kinks in the Γ-centered band as a signature of Γ-M electron scattering mediated by the plaquette-order-based spin waves. Our experimental data and phonon simulation show that symmetrically breathing phonon modes suitable for BCS pairing and spin waves possibly suitable for antiferromagnetic spin fluctuation-based pairing can be simultaneously achieved by self-assembled encapsulation of FeAs layer by perovskite layers. 182

210 (Room 107) 22 June 2016, 11:00-11:30 AM Multiview 3D Display Using Varifocal Lenticular Liquid Lens Array Y. H. Won 1, J. Kim 1, C. J. Kim 1, D. S. Shin1, J. Lee 1, G. Koo 1 1 School of Electrical Engineering, KAIST, 291 Daehak-ro, Yuseong-gu, Daejeon, 34141, Republic of Korea Abstract Electrowetting on dielectric (EWOD) is a primary phenomenon to create liquid-liquid interface or liquid-air interface as a lens. [1] This induces a real movement of liquids as a voltage across the liquids changes. A main issue for EWOD is lowering the applied voltage and the problem has been solved with some techniques. [2-3] Our approach is to fabricate a liquid lenticular lens array oprated by the EWOD. In the lenticular type multiview system, pitch sizes of lens sheet and pixel is important and it is precisely calculated to targeted specification. After setting pitch size, silicon KOH etching is progressed having slanted walls and the silicon is electro-plated with nickel. The nickel is used as a master mold to imprint soft and transparent materials as PMMA, PC and PET. As an electrode on chamber side, ITO is sputtered onto the chamber and parylene C is deposited which refered from a previous research. [4] To have a hydrophobicity, a fluoropolymer Teflon AF1600 is dip coated. As the slanted structure, optical performance must be affected by interfaces between chamber and liquids. To compensate this, an index matching is necessary between chamber material and a mixture of oil which acts as a lens. Finally, a sealing glass is covered with a UV adhesive gasket. The shape of the fabricated liquid lenticular lens changes from concave to convex with a flat state between them. This indicates that a 2D and 3D convertible ability is achieved. Fig1. A cross-sectional view of liquid lenticular lens array References 1. B. Berge and J. Peseux, The European Physical Journal E, 3, (2000). 2. H. Moon and S. K. Cho, Journal of Applied Physics, 92, 7 (2002). 3. S. Berry, J. Kedzierski and B. Abedian, Journal of Colloid and Interface Science, 303, (2006). 4. M. Dhindsa, S. Kuiper and J. Heikenfeld, Elsevier, 519, (2011). 5. J. Zhang, D. Van Meter, L. Hou, N. Smith, J. Yang, A. Stalcup, R. Laughlin and J. Heikenfeld, Langmuir, 25, 17 (2009). 183

211 (Room 107) 22 June 2016, 11:30-12:00 AM Three-dimensional Magneto-optic Spatial Light Modulator Composed of Artificial Magnetic Lattice H. Takagi 1, K. Nakamura 1, T. Goto 1,2, P. B. Lim 1, M. Inoue 1 1 Department of Electrical and Electronic Information Engineering, Toyohashi University of Technology, Toyohashi, Aichi, Japan 2 JST, PRESTO, Kawaguchi, Saitama, Japan Abstract A holographic display is a realistic three-dimensional (3D) display because it produces an exact copy of the wave front of scattered light from 3D objects [1]. A holographic display demands a wide viewing angle for 3D visualization. However, the viewing angle of holographic displays based on conventional spatial light modulators (SLMs) is less than three degrees. The pixel pitch of conventional SLMs is in the range of μm. Recently, we developed a threedimensional magneto-optic spatial light modulator (3D-MOSLM) that had a two-dimensional magnetic pixel array with sub-micrometer-scale pixels for a wide viewing holographic display. To form magnetic pixels, we used a thermomagnetic recording system to control the direction of magnetization by the optical addressing method. This method has the advantage that it is possible to fabricate sub-micrometer-scale pixel arrays without a driving line and pixel structure on the magnetic medium. The magnetic film of the first 3D-MOSLM was an amorphous TbFe (a-tbfe) film, a material widely used in thermomagnetic recording applications. However, the reconstructed images had a low brightness: cd/m2 with reconstruction illumination of 10.8 mw/cm2 at 532 nm. Display standard ISO13406 for liquid crystal displays recommends brightness of displays to be over 100 cd/m2. To represent a 3D image with 100 cd/m2 from the a-tbfe film would require reconstruction illumination of about 24 W/cm2. For improved diffraction efficiency, the magnetic film should have high transmittance and a large Faraday rotation angle. In this study, we developed a 3D-MOSLM composed of an artificial magnetic lattice structure of magnetophotonic crystals (MPCs)[2]. The fabricated MPC had a magnetic defect layer of (BiDyY)3(FeAl)5O12 (BiDyYFeAlGarnet: BiDyYFeAlG). Bragg mirrors were constructed by multiple layers of SiO2 and Ta2O5. The MPC was fabricated by ion beam sputtering on a substituted Gd3Ga5O12 (SGGG) substrate, and the resulting structure was SGGG substrate / (Ta2O5/SiO2)2 / BiDyYFeAlG / (SiO2/Ta2O5)2. The thickness of the BiDyYFeAlG layer was 1.05 μm. The thickness of the SiO2 and Ta2O5 layers were determined as λ/4n, where λ was the resonant wavelength of 532 nm and n is the refractive index of each material. The diffraction efficiency of the MPC was % at 532 nm wavelength, about 2300 times higher than the a-tbfe film. We fabricated an optical system using the tiling optical addressing method, which consists of a pulse laser, a digital micro mirror device (DMD), object lenses, an x-y-z stage, and magnetic media. The optical system for the tiling optical addressing method is shown in Fig. 1. A DMD (Discovery 1100, 1024 pixels 768 pixels, maximum driving speed of 22 khz/frame) was used for the tilling optical addressing method. The DMD showed part of 2D hologram pattern. To write the hologram, a pulse laser (Nd:YAG laser) operating at 355 nm with pulse width of approximately 10 nsec and a frequency of 10 Hz was used. The optical parametric oscillator was a MOPO-SL-1P (Spectra-Physics) to control wavelength. The 2D hologram pattern on the DMD was transferred to the magnetic film by two object lenses whose focal lengths are 100 mm and 10 mm. The pixel size was decreased to one-tenth of the original size of the DMD. Therefore, the magnetic pixel size was 1.36 μm. The light energy density for fabricating magnetic pixels was 54 mj/cm2. The total number of pixels in the hologram was pixels. The viewing angle of the reconstructed image was

212 The reconstructed image from the MPC and the reconstructed image from the a-tbfe were compared in the same optical conditions in Fig.2. The reconstruction optical system consisted of a reconstruction illumination source, a polarizer and an analyzer with Cross-Nicol configuration for separating zero order transmitted light and the reconstructed image. The reconstruction illumination to achieve 100 cd/m2 image brightness was a continuous wave laser, with wavelength 532 nm and intensity 10.8 mw/cm2. Figure 2 (b) (d) show the reconstructed 3D holographic image from the MPC, and (e) (g) show the reconstructed image from the a- TbFe. The brightness of the reconstructed image from the MPC was 100 cd/m2. This work was supported by JSPS KAKENHI Grant Nos , , 15J05710, , , and SCOPE ( ). Fig1. The optical system for the tilling optical addressing method. Fig2. (a) A model of 3D image for generating the hologram. The wireframe cube was constructed by point light sources. Reconstructed images from MPC (b) (d) and from a-tbfe (e) (g). (b) and (e) were images from left view point of 11. (c) and (f) were from center. (d) and (g) were images from right view point of 11. References 1. V. M. Bove, Display Holography's Digital Second Act, Proceedings of the IEEE 100, 918 (2012). 2. M. Inoue, R Fujikawa, A. Baryshev, A. Khanikaev, P. B. Lim, H. Uchida, O. Aktsipetrov, A. Fedyanin, T. Murzina, and A. Granovsky, J. Phys. D 39, 151 (2006). 185

213 (Room 107) 22 June 2016, 12:00-12:30 PM Three-dimensional holographic optical tweezers Hui-Chi Chen 1 1 Department of Physics, Fu Jen Catholic University, New Taipei City 24205, Taiwan Abstract The optical tweezers [1] can manipulate the nanoparticle and biological cell for the study of their interaction without damage and physical contact. However, the Gaussian optical tweezers can only manipulate a single or cluster of, translucent particles with the single focus. Shaping the wavefront by computer generated hologram (CGH) [2] can expand the optical manipulation for the 3D real-time multi-particles and the opaque particles, moreover, the orientation control for the non-spherical particles. Figure 1 shows the system setup of holographic optical tweezers (HOT) [3] by a reflective LCD. The phase-only CGH was input by the reflective LCD and then Fourier transformed to the focal area of high NA objective. Liquid sample on the cover glass was placed within the focal area, and then were manipulated by the laser beam. Fig1. The setup of holographic optical tweezers. Firstly, the opaque particle was manipulated by the HOT. Of the optical tweezers system, the opaque particle would be trapped and then kicked off. The HOT with the light distribution of optical vortex can transfer the angular momentum onto the opaque particle. The manipulation of magnetic metal nanoparticle cluster was shown in the Fig.2. The cluster moved along a circle path. 186

214 Fig2. The optical manipulation of magnetic metal nanoparticle cluster. And then, a 3D manipulation for multiple particles was built up. The simulated lens was introduced into the CGH calculation under Fresnel diffraction to create the light distribution away from the focal plane. Meanwhile, the interactive and Fourier-transform(FT) based method, Gerchberg-Saxton (GS) algorithm [4], was used to produce one single phase-only CGH for reconstruct multiple planes within 3D area. Figure 3(a) shows the experimental results of trapped four silicon particle (1μm) in the rotation on the focal plane, Fig.3(b) shows two Si particles were moved away the focal plane (z=0). Fig3. The optical manipulation of several Si particles (a)on the xy plane, (b)within 3D area. Another important application of HOT is the orientation control for the non-spherical particle. The orientation of particle in the optical tweezers depends on the shape of particle and force equilibrium, for example, the long axis of rod-shape particle is aligned along the optical axis of trapping light. Most of signals or images are from circular plane so the side plane signals might be lost during measurement. To control the orientation of rod-shape particle, a two spots tweezers was developed by HOT. Figure 4 show the experimental results of the orientation control for a rod-shaped bacterium, Thermosynechococcus elongates TA01. Fig4. The orientation control for the rod-shaped bacteria. 187

215 References 1. A. Ashkin, J. M. Dziedzic, J. E. Bjorkholm, and S. Chu, Opt. Lett. 11, 288 (1986) 2. E. N. Leith and J. Upatniek, J. Opt. Soc. Amer. 52, 1123 (1962). 3. G. Sinclair, J. Leach, P. Jordan, G. Gibson, E. Yao, Z. J. Laczik, M. J. Padgett, and J. Courtial, Opt. Express 12, 1665 (2004). 4. R. W. Gerchberg, and W. O. Saxton, Optik 35, 237 (1972). 188

216 (Room 107) 22 June 2016, 14:00-14:30 PM Novel 3D Differential Phase Contrast Imaging System Lambertus Hesselink 1, Yao-Te Cheng 1, Max Yuen 1, Sergei Orlov 1, Dieter Akemeier 1, William Aitkenhead 1, Yuzuru Takashima 2, Youngsik Kim 2, Chris Summit 2, Sung Lin Wang 2, George Herring 1, Ching-Wei Chang 1, Piero Pianetta 1, Fabian Pease 1 1 Department of Electrical Engineering, Department of Applied Physics, Stanford University, Stanford, CA, USA 2 University of Arizona, College of Optical Sciences, Tucson Arizona Abstract Making 3-D X-ray measurements of liquids is challenging, as the index of refraction at X-ray wavelengths differs from 1 by an amount of <10-8. On the other hand, the short wavelength compared to the dimensions of physical objects ensures that the optical path length can still be sufficiently large to obtain meaningful interferometric data. The challenge is how to measure phase changes in an X-ray beam that traverses a multitude of objects, as in medical and aviation security applications. About 10 years ago, a significant effort in X-ray interferometry was made at a number of laboratories around the world, with the group from Pfeiffer [1] in Switzerland making pioneering contributions to the field. Differential phase contrast (DPC) imaging was implemented in a three grating set up as shown in Figure 1. An incoherent X-ray source transmits a cone of radiation that traverses a square amplitude absorption grating, incident upon a phase grating that splits the beam into two beams at a very small angle (typically about a micro radian or less). The two beams interfere on a second absorption grating producing Moiré fringes on a large size pixelated detector. DPC imaging since then has been demonstrated in a number of laboratories around the world, including ours for use in medical imaging. The key benefits being improved contrast of phase objects such as fish and soft tissue, and low dose required for relatively high SNR. The drawbacks of the approach are, among others, a small field of view, significant energy dissipation in the absorption gratings (typically almost 10x) and low contrast fringes. At Stanford we embarked on a different path to create DPC measurements. As the key drawbacks are related to the absorption gratings we decided to build a new X-ray source and detector matched to each other, having a spatial coherence that is suitable for making Talbot Moiré images. We refer to the source as PeXSA for Photo Electron X-ray Source Array, and the detector as PcXDA short for Photonic Channeled X-ray Detector Array. In the one grating system under development in our lab, the X-ray source emits a striped X-ray pattern akin to the pattern generated by G0 shown in Figure 1. The PeXSA source incorporates a photo emitter that is illuminated by a 405 nm striped laser beam to produce a similar electron striped beam pattern. The electron pattern is imaged onto the Tungsten target thereby generating a striped X-ray pattern, eliminating the need for G0. The electron source is CsBr, which is known to be hygroscopic, requiring high vacuum for operation. Previous work centered around using a 257nm laser source, taking advantage of the relatively high absorption at this wavelength leading to color centers that enable operation from within the band gap with a low energy source. As 257 nm lasers tend to be bulky, we developed a new technique for generating photoelectrons at 405 nm using a GaN laser. 189

217 Fig1. Three-grating DPC set up In this invited presentation we describe the underlying physics of the Stanford single grating DPC system, and provide data on its operation. In particular, we will discuss the performance of the single grating system versus the three grating system, and show recent results on DPC measurements of tens of different liquids, as well as medical subjects. Classification studies show significant lower false alarm rates than when using conventional CT measurements. The ultimate goal of the project is to provide an automated characterization system for identifying liquids in a cluttered environment, such as may occur in aviation security imaging or in 3-D medial imaging of soft tissue. Acknowledgements We gratefully acknowledge the support of the Department of Homeland Security under contract HSHQDC-12-C References 1. Pfeiffer et al., Nature Physics,

218 (Room 107) 22 June 2016, 14:30-15:00 PM 3D Tomographic Measurement of Interior Surface Vibrations in Thick Biological Tissues Using Multifrequency Sweepable Optical Comb S. Choi 1, F. Nin 2, K. Sato 3, and H. Hibino 2 1 Department of Electrical and Electronics Engineering, Niigata University, Niigata City, Niigata, Japan 2 Department of Molecular Physiology Niigata University School of Medicine, Niigata City, Niigata, Japan Abstract Optical coherence sensing techniques for measuring vibrations of internal surfaces in biotissues have recently received considerable attention. In the field of mechanobiology, heterodyne interferometers based on measuring the Doppler frequency shift such as laser Doppler vibrometers [1], and low-coherence OCT with Doppler vibrometer [2] and Doppler spectral domain (SD)-OCT [3] have been used for measuring high-speed vibrations from various surfaces within the organ of Corti. However, conventional heterodyne techniques typically use a photodiode to measure a single point (i.e.,zero-dimensional scan). Therefore, it is difficult to obtain the lateral phase changes of a continuous widespread surface without lateral x y scanning. From the viewpoint of achieving rapid vibration measurements over a wide field of view, lateral x-y scans may impede the measurement speed, accuracy, and consistency. The implementation of two-dimensional image sensors such as CCD cameras may allow for lateral information of the surface of interest to be acquired simultaneously. However, conventional CCD or CMOS cameras are difficult to implement in Doppler vibrometers because the CCD framerate is generally limited to within a few tens of hertz. In addition, high speed cameras with a frame rate exceeding the kilohertz range are still extremely expensive and the effective pixels number is limitted. In this study, as a novel FF-vibrometry technique, the wide-field heterodyne interferometric vibrometer (WHIV) [4] is combined with multi-frequency swept (MS) en-face OCT system as shown in Figure 1. In the WHIV technique, a heterodyne signal is produced by phase modulation of a reference arm which is detectable by a regular speed CCD or CMOS camera. In MS en-face OCT system, the broadband multifrequency comb was produced by combining a Fabry-Perot filter (FPF) and a super luminescent diode (SLD). The multifrequency could be sweept by controlling the length of the air gap of the FPF using a PZT lens positioner. Fig1. Setup for MS-OCT combined with WHIV technique. 191

219 To validate the vibration measurements using WHIV, a 3D OCT image of the fixed kidney was measured again to fix the target layers (region I, II, and III in Fig.2) for measuring the surface vibration. The sample was rigid, because, when artificially vibrated, it was expected to elicit little difference in the pattern of dynamics across the layers. The specimen and GP were vibrated at 1000 Hz and Hz, respectively. The amplitude of the PZT supply voltage was ~2.0 V, eliciting vibrations of ~1.2 rad amplitude in terms of the angular phase. The obtained vibration parameters at the region I and III (the axial depth of 728.0, 736.0, and μm) was shown in Fig. 3. Fig 2. 3D volume render OCT image of the mouse kidney tissue Fig. 3 Internal surface vibration distriburions; (a), (b), and (c) are vibration amplitudes with the The average vibration amplitudes of spatial fluctuations was approximately 79 ± 3 nm (mean ± SD). Therefore, accuracy of vibration amplitude was estimated to be 3 nm by evaluating the uniformity of the obtained spatial distribution. This difference is likely to be derived from fluctuations of the spatial distributions due to calculation errors in the aforementioned image processing. The 2D spatial vibration parameters with a frequency of 1 khz could be measured by using a regular speed CCD image sensor with approximately 30 fps. We have also improved transverse and temporal resolutions in the system for visualizing the dynamics of the interior surfaces of bio-tissues. Finally, our OCT can be easily combined with high-performance interference microscopy and thereby is likely to serve as a platform for new mechanobiology, targeting vibrating organs including heart and cochlea. References 1. J. W. Foreman, at. al., Appl. Phys. Lett. 7, (1965). 2. N. Choudhury, at. al., Nuttall, Hear. Res. 220, 1 9 (2006). 3. S. S. Hong, and D. M. Freeman, J. Biomed. Opt. 11(5), (2006). 4. S. Choi, at. al., Opt. Commun., 356, (2015). 192

220 (Room 107) 22 June 2016, 15:00-15:30 PM Application of Rare-Earth Doped Ceramics for Transparent Imaging Devices Kohei SOGA 1,2, Masao Kamimura 1,2 1 Department of Materials Science and Technology, Tokyo Universitu of Sicence, Tokyo, Japan 2 Imaging Frontieer Center, Tokyo University of Scieence, Tokyo, Japan Abstract Trivallent rare-earth ions have characteristic optical transitions due to the unique properties of the electrons in 4f state. Since the energy of the 4f states are higher than that of the 5s and 5p satats, spacially outermost 5s and 5p orbitals are filled and the inner 4f orbital is incompete to cause electronic tranisitons. The electrons in the outermost and spherical complete 5s25p6 play a role of shielding for the 4fN-1 electrons from dynamic electric field due to the vibrating surrounding ions and satic electric field which are understood as the filed of average position of the ions. Because of the shielding effects, the rare-earth ions generally have much narrower spectral width than normal d-electron transition metals. As well, the thermal relaxation is much weakened to results in high luminescence efficiency. Also, the energy levels are shiftless and discrete. As a result of these properties, rare-earth doped ceramic materials has been applied for various optical devices such as Nd:YAG lasers and Er-doped fiber amplifiers. Both of them are using the luminescence in near infrared region. A special phenomenon in the rare-earth ions in a ceramic host is so-called upconversion, where a visible luminescence can be obtained by near infrared stepwise excitation process among the discrete energy levels. Since the excitation light, the near infrared light, is invisible, by scanning the excitation light, one can expect visible luminescence pixel under the near infrared excitation to form an image. In 1996, a group of Stanford university at first reported transparent fullcolor 3D diplay by using rare-earth doped fluoride glass [1]. Since then, several types of transparent displays are proposed. For transparency, normally ceramic polycrystalline materials are useless because of strong strong light scattering. However, once it is composited with a reflax index-matched polyer, a transparent composite material with ceramics powder and polymer can be produced. The authors composited Er-doped YF3 crystals and a flexible polymer to produce an upconversion transparent and flexible display [2]. Some other comoposite upconversion displays by compositing NaYF4 and a polymer is reported [3]. Recently, device formation and materials processing for forming the upconversion transparent and flexible display by using waveguides [4, 5]. The present paper will review the research on the transparent and flexible upconversion display including some recent works. References 1. E. Downing et al., Science, 273 (1996) K. Tsujiuchi, K. Soga et al., J. Photopolym. Sci. and Tech., 22 (2009) F. Wang et al., Natuere, 463 (2010) S. Watanbe, K. Soga et al., Adv. Func. Mater., 25 (2015) S. Watanbe, K. Soga et al., J. Colloid and Interfae Sci., 445 (2015)

221 (Room 107) 22 June 2016, 16:00-16:30 PM Analysis of 3D Reconstruction System Using Hand-held RGB-D Camera Yo-Sung Ho 1 1 School of Information and Communications, Gwangju Institute of Science and Technology (GIST), Gwangju, Republic of Korea Abstract 3D reconstruction is the process of capturing the shape and appearance of a real scene. There are several categories such as active, passive, rigid, non-rigid, tuntable, hand-object intraction and surrounding capture. It can be applied to the various fields such as E-commerce, virtual reality, augmented reality, human-computer interaction and so on [1]. Currently, hand-held RGB-D cameras such as Microsoft Kinect, Asus Xtion Pro, Occipital Structure sensor, Google Tango and Intel Realsense are widely available at reasonable prices. Therefore, many users can easily generate their own 3D content using 3D reconstruction. In this paper, we represent a framework and evaluation of a 3D reconstruction system using a hand-held RGB-D camera. The overall procedure of the 3D reconstruction system is shown in Fig. 1. Fig. 1. Procedure of the 3D reconstruction system First, we acquire color and depth images from an RGB-D camera and refine the raw depth image using a joint bilateral filter to fill the hole regions. After depth image refinement, we generate a point cloud by 3D warping and calculate a transformation (rotation and translation) for a pair of frames in the temporal domain using the iterative closest points (ICP) algorithm. The ICP is the core process in the 3D reconstruction system since the accuracy of the transformation determines the quality of the reconstructed 3D model. There are several conventional methods such as point-to-point and point-to-plane methods [2]. Representation of the 3D model in the virtual space is also an important issue. Each frame from the RGB-D camera contains roughly valid 250,000 points in case of images. For example, if there are depth frames lasting one minute, 450,000,000 points would be required; 250,000 point 30 fps 60 sec. = 450,000,000 points/min. Therefore, it is necessary to use a more concise representation of the model than that. There are several breakthroughs such as a 194

222 truncated signed distance function, surfels representation and octomap [3-5]. Finally, we can obtain the reconstructed 3D model which we can observe at arbitrary viewpoints. There are two main measures to evaluate the accuracy of the 3D reconstruction system: relative pose error (RTE) and absolute trajectory error (ATE) [6]. The RTE measures the local accuracy of the trajectory over a fixed time interval, therefore, it is more suitable for evaluating a visual odmetry stystem. The ATE calculates the global consistency by comparing the absolute distances between the estimated and the ground truth trajectory, thus, it is useful for for simultaneous localization and mapping systems. Nevertheless, such two metrics are strongly correlated and both measures internally exploit the root mean squared error. Figure 2 shows the 3D reconstructed model using a part of methods explained above from color and depth images. We used various open source library such as opencv, opengl and libicp [7]. However, there are drift problem which is not exactly matched to the actual 3D model because of the accumulated error generated as time goes by. Therefore, we will additionally apply a bundle adjustment to this project to adjust the camera parameters obtained from ICP [8]. Fig. 2. The 3D reconstructed model Acknowledgment This research was supported by Basic Science Research Program through the National Research Foundation of Korea(NRF) funded by the Ministry of Science, ICT & Future Planning ( ) References 1. Dong-Won Shin, Yo-Sung Ho, "Implementation of 3D Object Reconstruction using a Pair of Kinect Cameras," Asia-Pacific Signal and Information Processing Association (APSIPA), vol. 10, no. 4, pp. FA1-5.5(1-4), Dec K. S. Arun, T. S. Huang, and S. D. Blostein, Least-Squares Fitting of Two 3-D Point Sets, IEEE Transactions on Pattern Analysis and Machine Intelligence, vol. 9, no. 5, pp , Jan B. Curless and M. Levoy, A Volumetric Method for Building Complex Models from Range Images, SIGGRAPH, pp , H. Pfister, M. Zwicker, J. van Baar, and M. H. Gross, Surfels: surface elements as rendering primitives, SIGGRAPH, pp , K. M. Wurm and A. H, OctoMap: A probabilistic, flexible, and compact 3D map representation for robotic systems, International Conference on Robotics and Automation,

223 6. J. Sturm, N. Engelhard, F. Endres, W. Burgard, and D. Cremers, A benchmark for the evaluation of RGB-D SLAM systems, International Conference on Intelligent Robots and Systems, pp ,

224 (Room 107) 22 June 2016, 16:30-17:00 PM Selection of Consecutive Two Frames for Shape from Random Camera Motions Norio Tagawa 1, Syouta Tsukada 1 1 Graduate School of System Design, Tokyo Metropolitan University, Hino, Tokyo, JAPAN Abstract The gradient equation efficiently used for recovering a denth depth map from motion is a firstorder approximation of the intensity invariant constraint before and after relative camera motions [1]. A large image motion as compared with a spatial wavelength of a dominant intensity pattern generates a large approximation error and causes an alias problem. To avoid such a problem, multi-scale strategies with information propagation along the direction of image resolution have been proposed [2, 3]. On the other hand, we have proposed a camera system which enables random camera rotations imitating fixational eye movements of a human eyeball. By the camera rotations, we can observe an image sequence including random image motions having various sizes and ditrections. Since we adjust the average of the motions to be zero, all of consecutive two frames can be used at each pixel for recoverying the identical depth based on the gradient equation without correspondence point tracking which is also a difficult procedure in general. Namely, depth at each pixel is determined as a solution of many gradient equations. Based on the condition, we proposed a method by which a depth map and camera rotations are determined as a MAP estimator [4]. In the method of [4], it may not be appropriate to use all frame pairs for depth recovery. In consideration of the relation between a wavelength of an intensity pattern and a motion size, suitable frame pairs should be selected and used. If the wavelength is short, the pairs having small image motions should be selected, which are expected to have small approximation error in the gradient equation. Therefore, we proposed a method consisting of two steps to select suitable frame pairs [5]. At the first step, concecutive spatial gradients are compared and the frame pairs in which those are largely different are discarded. In the next step, the SNR, i.e., the ratio of the first term and the second term in the Taylor series of the intensity invariant constraint is approximately evaluated, and the frame pairs having high SNR are selected by threshold processing. It is noted that the approximated SNR is defined as a worst value, which can be computed without the true values of image motions. The experiments using real image sequence were performed to confirm the method for frame pair selection. Figure 1 shows the developed camera system and the target object of which the depth should be recovered. The variances of random camera rotations were set as three values, = 6.13x10-6, = 2.32x10-5 and = 9.39x10-5, each of which indicates small, middle and large distribution of rotations. Figure 2 indicates the depth recovery error plotted for each rotation variance, in which the horizontal axis corresponds to the rate of the used frame pairs and the vertical axis means the RMSE of the recovered depth. From this figure, we confirmed that for each rotation variance, the suitable rate for selection exists. Additionally, it is known from Fig. 2 that the suitable rotation size exits according to the intensity pattern. For the texture of the object used in this experiment, the middle rotation variance enables accurate recovery. We can imagine from that for = 6.13x10-6 and = 9.39x10-5 the quantity of suitable frame pairs is small, and by using such small number of frame pairs, the accuracy of recovery tends to lower because of little ovservation. Figure 3 shows the recovered depth map as a 3D plot with a sutable rate of frame pair selection. In the future, the optimal combination of the two steps for consecutive frames selection should be examined by considering the role of each step deeply. The threshold values for both steps are required to be determined based on the quantitative study, which may be performed through simulations using artificial images. 197

225 Fig. 1. Condition of experiment. Fig. 2. Accuracy of depth recovery. (a) r 2 = 6.13x10-6 (b) r 2 = 2.32x10-5 (b) r 2 = 9.39x10-5 Fig. 3. 3D representation of recovered depth map. References 1. B. K. P. Horn and B. Schunk, Artif. Intell., 11, 185 (1981). 2. E. P. Simonceli, Handbook of Computer Vision and Applications (Academic Press), 397, (1999). 3. N. Tagawa, J. Kawaguchi, S. Naganuma, K. Okubo, Int. Conf. Pattern Recog., CD (2008). 4. N. Tagawa, Int. Conf. Pattern Recognition, 1662 (2010). 5. S. Tsukada, Y. Ho, N. Tagawa, K. Okubo, Lecture Notes in Computer Science 9164 (Springer), 306 (2015). 198

226 (Room 108) 22 June 2016, 09:30-10:00 AM Molecular Spin Battery Composed of Air-stable Neutral Radicals and Graphite Yasushi Morita 1,2, Hirofumi Nobukuni 1,2, Junya Nishiyama 1,2, Tsuyoshi Murata 1,2 Miwa Keishima 2,3, Megumi Fujisaki 2,3, Ryotaro Tsuji 2,3 1 Aichi Institute of Technology, Japan 2 CREST, JST, Japan 3 KANEKA Corporation, Japan Abstract In order to develop high capacity batteries exceeding those of high-performance Li-ion batteries (150~170 A h kg 1), we proposed a tailor-made approach by use of organic molecules with multi-stage redox ability for electrode-active materials in 2002 [1]. Based upon this idea, we implemented new batteries using air-stable carbon-centered trioxotriangulene (TOT) neutral radical possessing a singly occupied molecular orbital (SOMO) and two degenerate LUMOs [2,3]. The batteries based on TOT afforded a high discharge capacity exceeding 300 A h kg 1 [4,5]. In quest of further high battery performance, we designed and synthesized novel TOT derivatives as cathode-active materials in terms of SOMO-engineering and controlling intermolecular interactions in solids. The batteries using these molecules demonstrated a good cycle performance under charge-discharge processes. We termed these new batteries "Molecular Spin Batteries" [5], because the cathode-active materials were designed in terms of "synthetic organic spin chemistry" [3]. Recent our special attention has been focusing on socalled full-cell batteries comprising TOT deriveatives and graphite as the cathode- and anodeactive materials, respectively (Fig). In the presentation, we will disclose detailed molecular design and performances of novel TOT-based batteries. Fig. Schematic representation of full-cell molecular spin battery. References 1. (a) Y. Morita, T. Takui, K. Nakasuji, K. et al. Angew. Chem. Int. Ed. 2002, 41, (b) Y. Morita, S. Nishida, T. Takui, K. Nakasuji, et al. Org. Lett. 2002, 4, Y. Morita, S. Nishida, "Phenalenyls, Cyclopentadienyls, and Other Carbon-Centered Radicals" in Stable Radicals: Fundamental and Applied Aspects of Odd-electron Compounds; R. G. Hicks ed., John Wiley & Sons, Chichester, Chapter 3, p , Y. Morita, S. Suzuki, K. Sato, T. Takui, Nature Chem. 2011, 3,

227 4. (a) Y. Morita, T. Okafuji, M. Sato JP Patent (b) Nishida, S.; Yamamoto, Y.; Takui, T.; Morita, Y. ChemSusChem 2013, 6, (a) Y. Morita, S. Nishida, T. Murata, M. Moriguchi, A. Ueda, T. Takui, et al. Nature Mater. 2011, 10, 947. (b) S. Nishida, Y. Morita, "Air-stable Redox-active Neutral Radicals: Topological Symmetry Control of Electronic-spin, Multicentered Chemical Bonding, and Organic Battery Application" in Organic Redox Systems: Synthesis, Properties, and Applications; Tohru Nishinaga ed., John Wiley & Sons, Chapter 6, p ,

228 Current (ma) 2016 Collaborative Conference on 3D & Materials Research (CC3DMR) June 2016 (Room 108) 22 June 2016, 10:00-10:30 AM Enhancing the Capacitive Energy Storage of Activated Carbon through Mechanical Activation Leon Shaw 1, Ling Li 1, and Caihong Liu 1 1 Department of Mechanical, Materials and Aerospace Engineering, Illinois Institute of Technology, Chicago, IL , USA Abstract Lithium-ion capacitors (LICs) have the potential to combine the high energy density of lithium ion batteries and the high power density of supercapacitors into one device. In this study, we have investigated surface functionalization of activated carbon (AC) powder through mechanical activation for cathodes of LICs with non-aqueous electrolytes. Traditionally, surface functionalization is carried out via chemical activation [1-6] or plasma treatment [7-9]. Here, we show for the first time that surface functionalization can be achieved with mechanical activation using high-energy ball milling of AC powder in air at room temperature. It is found that mechanical activation is an effective way to create functional groups on the AC surface, thereby imparting pseudocapacitance and increasing the specific capacitance of the AC powder. The surface functionalization has led to increases in the specific capacitance from 15.8 F/g for the as-received AC (AR-AC) to 33.5 F/g for the AC with 6-h ball milling (6h-AC) at the current density of 0.05 A/g. It should be emphasized that high-energy ball milling has resulted in significant reduction in the specific surface area of the AC powder. However, the surface functionalization induced by mechanical activation has drastically increased the areal specific capacitance, i.e., the areal specific capacitance per BET surface area has been enhanced from 2.3 μf/cm2 for the AR-AC to 68 μf/cm2 for the 6h-AC. The latter is 3 times the theorectical areal specific capacitance of the electrical double layer for graphene (21 μf/cm2) [10], indicating the existence of the pseudocapacitance due to surface redox reactions in the 6h-AC powder with mechanical activation. Therefore, these surface redox reactions not only enhance the areal specific capacitance, but also increase the specific capacitance. The presence of the pseudocapacitance due to surface redox reactions is also confirmed by cyclic voltammery (CV). As shown in Figure 1, the AR-AC Li-ion capacitor displays quasi-rectangular shape in its CV curve, suggesting a double-layer capacitance dominant behavior. In contrast, the 6h-AC Li-ion capacitor exhibits a distorted rectangular or rhombus shape, indicating the presence of pseudocapacitance AR-AC 0.00 (0.15) 6h-AC (0.30) Potential (V) Figure 1. CV curves of AR-AC and 6h-AC Li-ion capacitors at a scan rate of 0.01 V/s. 201

229 Voltage (V) Voltage (V) 2016 Collaborative Conference on 3D & Materials Research (CC3DMR) June Specific Capacitance (F/g) 1st charge 1st discharge 2nd charge 2nd discharge 5th charge 5th discharge 10th charge 10th discharge 20th charge 20th discharge Figure 2. Charge-discharge curves of the AR-AC Li-ion capacitor at the current density of 0.05 A/g st charge 1st discharge 2nd charge 2nd discharge 5th charge 5th discharge 10th charge 10th discharge 20th charge 20th discharge Specific Capacitance (F/g) Figure 3. Charge-discharge curves of the 6h-AC Li-ion capacitor at the current density of 0.05 A/g. It is important to note that the high specific capacitance achieved through mechanical activation is fairly stable over change/discharge cycles. Figures 2 and 3 show the charge/ discharge curves of the AR-AC Li-ion capacitor and the 6h-AC Li-ion capacitor at the current density of 0.05 A/g, respectively. A comparison of these two figures reveals that both LICs have relatively stable cycle stability. Furthermore, the 6h-AC LIC still possesses a specific capacitance that is 100% higher than that of the AR-AC LIC after 20 cycles. The mechanism of capacitance improvement has been diagnosed using a range of analytical instruments, including scanning electron microscopy (SEM), energy dispersive spectroscopy (EDS), Fourier transform infrared spectroscopy (FTIR), Raman spectroscopy, X-ray photoelectron spectroscopy (XPS), and Brunauer-Emmett-Teller (BET) surface area measurement. It is found that high-energy ball milling in air at room temperature can result in the formation of C-O and C=O functional groups on the AC surface. Furthermore, the C-O functional group is mainly formed at shorter ball milling time, while the C=O functional group is predominantly created at longer ball milling time. However, both C-O and C=O functional groups are found to be capable of imparting pseudocapacitive redox reactions and thus improving the capacitance of AC. This work has opened up a new route to increase the specific capacitance of low cost and widely used AC powder for LICs. 202

230 Acknowledgements The financial support from US National Science Foundation with grant number CBET is greatly appreciated. References 1. J. Zhou, J. Lian, L. Hou, J. Zhang, H. Gou, M. Xia, Y. Zhao, T. A. Strobel, L. Tao, and F. Gao, Nat. Commun., 6, 8503 (2015). 2. S. W. Lee, N. Yabuuchi, B. M. Gallant, S. Chen, B.-S. Kim, P. T. Hammond, and Y. Shao- Horn, Nature Nanotech., 5, 531 (2010). 3. A. L. M. Reddy, A. Srivastava, S. R. Gowda, H. Gullapalli, M. Dubey, and P. M. Ajayan, ACS Nano, 4, 6337 (2010). 4. W. Li, D. Chen, Z. Li, Y. Shi, Y. Wan, J. Huang, J. Yang, D. Zhao, and Z. Jiang, Electrochem. Commun., 9, 569 (2007). 5. J. Tan, H. Chen, Y. Gao, and H. Li, Electrochim. Acta, 178, 144 (2015). 6. S. W. Lee, B. M. Gallant, H. R. Byon, P. T. Hammond, and Y. Shao-Horn, Energy Environ. Sci., 4, 1972 (2011). 7. G. Lota, J. Tyczkowski, R. Kapica, K. Lota, and E. Frackowiak, J. Power Sources, 195, 7535 (2010). 8. W. Lu, L. Qu, K. Henry, and L. Dai, J. Power Sources, 189, 1270 (2009). 9. K. Okajima, K. Ohta, and M. Sudoh, Electrochim. Acta, 50, 2227 (2005). 10. C. Liu, Z. Yu, D. Neff, A. Zhamu and B. Z. Jang, Nano Lett., 10, 4863 (2010). 203

231 (Room 108) 22 June 2016, 11:00-11:30 AM Au at the Si(111) surface: silicene and Au nanowires probed by optical spectroscopy Charles H. Patterson 1, Soumya Banerjee 1, Pankaj Kumar 1, and John F. McGilp 1 1 School of Physics, Trinity College, University of Dublin, Dublin 2, Ireland Abstract Optical spectroscopy is a useful tool for probing electron states at surfaces. Usually any surface signal is difficult to separate from a bulk signal. However, if anisotropic surface layers exist above an isotropic bulk, the difference in surface dielectric functions in two perpendicular directions can be probed using a normal incidence spectroscopic ellipsometry technique known as reflection anisotropy spectroscopy (RAS). This talk will review application of RAS [1] to surfaces of group IV and III-V semiconductors and their interfaces [2-4]. It will focus on results of DFT calculations of RA spectra for the Si(111)-(5x2)Au system. This system is of particular interest as it essentially consists of 1-D nanowires separated by semiconducting silicene regions. The Si(111)/Au interface has been studied since the early days of surface science. It is a complex system and forms several ordered or quasi-ordered phases with (5x2), ( 3x 3) R30o and (6x6) surface reconstruction unit cells. The (5x2) atomic structure and indeed its Au surface concentration have been a matter of debate for years. A model for the structure was proposed by Erwin, Barke and Himpsel [5] (EBH) in 2009 which consists of silicene rows separated by metallic chains or nanowires containing Si and 6 Au atoms per (5x2) cell. The model was revised in 2014 by Kwon and Kang [6] (KK) by adding an extra Au atom per unit cell. The latter model is consistent with surface x-ray diffraction experiment [7]. A more recent IR and band structure study has found an additional structure with 8 Au atoms per unit cell [8]. Figure 1. Left panel shows the KK structure with one Si adatom per (5x4) unit cell. Red top layer Si atoms, blue Au atoms, green Si adatoms. Right panel shows RA spectra from experiment [12] (solid curves) and DFT calculations (dotted lines, this work). 204

232 Scanning tunneling microscopy (STM) experiments have shown that Au nanowires in the (5x2) system strongly bind extra Si adatoms in a x4 periodicity [9-11]. Total energy density functional theory (DFT) calculations on the EBH, KK and new 8 atom structures in (5x4) unit cells show that the system can exist in states with at least two holes in the valence band or two electrons in the conduction band by doping the EBH or KK structures with extra Au or Si adatoms. Au acts as a one electron donor and Si adatoms as two electron donors. The propensity for the KK structure to bind Si adatoms is shown to be because of filling of two holes in the KK valence band to yield a gapped state. The talk will describe structures at the Si(111)/Au surface and especially energetics of incorporation of extra Au atoms within the surface layer and adsorption of Si adatoms. The most energetically favorable structure is similar to the structure motifs found in the Si(111)- (6x6) phase which forms at higher Au coverage [13, 14]. An SiAu4 butterfly motif is found in all three of the ordered structures [14] and is important for understanding both ordered and quasi-ordered phases of the Si(111)/Au system. References 1. J. F. McGilp, J. Phys. Condens. Matter 22, (2010). 2. S. Banerjee, J. F. McGilp and C. H. Patterson, Phys. Stat. Sol. B 252, 78 (2015). 3. P. Kumar and C. H. Patterson, J. Phys. Condens. Matter 26, (2014). 4. S. Jorgji, J. F. McGilp and C. H. Patterson, Phys. Rev. B 87, (2013). 5. S. Erwin, I. Barke and F. Himpsel, Phys. Rev. B 80, (2009). 6. S. G. Kwon and M. H. Kang, Phys. Rev. Lett. 113, (2014). 7. T. Shirasawa, W. Voegeli, T. Nomija, Y. Iwasawa, Y. Yamaguchi and T. Takahashi, Phys. Rev. Lett. 113, (2014). 8. F. Hötzel, K. Seino, S. Chandola, E. Speiser, N. Esser, F. Bechstedt and A. Pucci, J. Phys. Chem. Lett. 6, 3615 (2015). 9. J. D. O'Mahony, J. F. McGilp and C. F. J. Flipse, P. Weightman and F. M. Liebsle, Phys. Rev. B 49, 2527 (1994). 10. A. Kirakosian, J. N. Crain, J.-L. Lin, J. L. McChesney, D. Y. Petrovykh, F. J. Himpsel and R. Bennewitz, Surf. Sci , 928 (2003). 11. H. Yoon, S. Park, J. Lee, C. Whang and I.-W. Lyo, Phys. Rev. Lett. 92, (2004). 12. N. McAlinden and J. F. McGilp EPL 92, (2010). 13. D. Grozea, E. Landree, L. D. Marks, R. Fiedenhans'l, M. Nielsen and R. L. Johnson, Surf. Sci. 418, 32 (1998). 14. C. H. Patterson, J. Phys. Condens. Matter 27, (2015). 205

233 (Room 108) 22 June 2016, 11:30-12:00 AM Ultra-High Pressure Synthesis, Stability, Physical Properties and Electronic Structure of Nitrogen-rich Transition Metal Nitrides Masashi Hasegawa 1 1 Department of Crystalline Materials Science, Nagoya University, Nagoya , Japan Abstract Transition Metal nitrides have attractive chemical and physical properties, such as eminent hardness, distinguished catalytic capability, unique superconductivity, peculiar magnetism and so on. Therefore, they, particularly, nitrogen-rich metal nitrides are paid the most attention to now. High pressure synthesis technique recently provides us a lot of novel ones. A diamond anvil cell, DAC, is a well-used small ultra-high pressure generation apparatus in the range above 10 GPa. It can be easily combined with a laser heating system: LH-DAC. It is a powerful tool to synthesize various kinds of nitrogen-rich metal nitrides because one can utilize a direct nitriding chemical reaction between metal and nitrogen supercritical fluid in a closed sample space in DAC. We have reported systematic syntheses of various metal nitrides by using the original LH-DAC system. In this talk, a summary of our recent studies related to the nitrogenrich metal nitrides synthesized in ultra-high pressures will be presented, such as synthesis technique, stability, crystal chemistry, physical properties and electronic structure investigated by the LH-DAC, the high-pressure in-situ synchrotron and lab-based X-ray diffraction and Raman scattering measurements, the synchrotron XPS and the first principle calculations [1-8]. References M. Hasegawa, T. Kondo and T. Yagi, Proc. 43th Symposium on Synthetic Crystals, 43, 107 (1998) M. Hasegawa and T. Yagi, J. Crystal Growth, 217, 349 (2000) M. Hasegawa and T. Yagi, Solid State Commun., 135, 294 (2005) M. Hasegawa and T. Yagi, J. Alloys Compounds, 403, 131 (2005) K. Niwa, M. Hasegawa and T. Yagi, J. Alloys Compounds, 477, 493 (2009) K. Niwa, D. Dzivenko, K. Suzuki, R. Riedel, I. Troyan, M. Eremets and M. Hasegawa, Inorg. Chem. 53, 697 (2014) K. Niwa, K. Suzuki, S. Muto, K. Tatsumi, K. Soda, T. Kikegawa and M. Hasegawa, Chemistry-A European Journal 20, 1 (2014) K. Niwa, T. Terabe, K. Suzuki, Y. Shirako and M. Hasegawa, J. Appl. Phys., 119, (2016). 206

234 (Room 108) 22 June 2016, 12:00-12:30 PM Evolution of Configuration and Size of Self-assembled Pt Nanoparticles on Sapphire (0001) Controled with a Systematic Varation of thermal treatment Ming-Yu Li 1, Mao Sui 1, Quanzhen Zhang 1, Sundar Kunwar 1, Puran Pandey 1 and Jihoon Lee* 1 1 College of Electronics and Information, Kwangwoon University, Nowon-gu Seoul 01897, South Korea. Abstract Fig1. Maps of the fabrication of the self-assmbled Pt nanostructures on the c-plane sapphire via variations of annealing temperature (x axis) versus deposition thickness (y axis). Atomic force microscopy (AFM) top-views of 1 1 μm2 in (a)-(d), and those of μm2 in (e)-(h). Metallic nanoparticles (NPs) has been broadly used in various chemical, biological, and optical applications due to the localized surface plasmon resonance, which can efficenty controlled with variations of configuration, shape, and density. In this paper, the systematic controls of the configuration and size of self-assembled Pt NPs are investigated via the temperature and duration. The annealing temperature effect on the fabrication of the Pt nanostructures is equality studied with various deposition amounts and discussed with a combination of Wolmer-Weber growth model and surface energy minimization mechanism. [1-2] With a higher Pt deposition amount, the Pt nanostructures evolve with two distinctive regimes: Nucleation of the Au NPs and irregular nano-mounds. At relatively lower temperatures, nucleation of Pt NPs sparsly occur initially and gradually happen drastically due to the enhanced surface diffusion with increased annealing temperature, as shown in Figs 1(a)-1(b). With further increased temperature, irregular Pt nano-mounds are fabricated and gradually, aggregated resulting in an obvious vertical growth of Pt nano-mounds as shown in Figs. 1(c)-1(d). Meanwhile, with a lower deposition amount, the round-dome shaped Pt NPs are observed throughout the whole tmerpature range, and gradually increase in size at a expense of the density decrease as a 207

235 function of annealing temperature as shown in Figs. 1(e)-1(h). Depending on the annealing duration, the size of Pt nano-mounds gradually increase with density decrease, which driven by the Ostwald ripening. [3-4] Acknowledgements Financial support from the National Research Foundation of Korea (no and 2016R1A1A1A ), and in part by the research grant of Kwangwoon University in 2016 is gratefully acknowledged. References 1. M. J. Weber, A. J. M. Mackus, M. A. Verheijen, C. van der Marel, and W. M. M. Kessels, Chem. Mater. 24, 2973 (2012). 2. M. S. J. Marshallab, and M. R. Castell, Chem. Soc. Rev. 43, 2226 (2014). 3. J. H. Yao, K. R. Elder, H. Guo, and M. Grant, Phys. Rev. B 47, (1993). 4. D. Lee, M.-Y. Li, M. Sui, Q. Zhang, P. Pandey, E.-S. Kim, and J. Lee, Nanoscale Res. Lett. 10:240 (2015) 208

236 (Room 108) 22 June 2016, 14:00-14:30 PM Behavior of Photogenerated Electrons and Holes on Anatase and Rutile TiO2 Powders Akira Yamakata 1, 2, Junie Jhon M. Vequizo 1, and Hironori Matsunaga 1 1 Graduate School of Engineering, Toyota Technological Institute, Hisakata, Tempaku, Nagoya , Japan 2 Precursory Research for Embryonic Science and Technology (PRESTO), Japan Science and Technology Agency (JST), Honcho Kawaguchi, Saitama , Japan. Abstract 1. Introduction Photocatalysts have attracted considerable attention due to their potential application to the water splitting reaction and degradation of pollutants using solar energy. TiO2 is one of the most often used material for photocatalysts because it is non-toxic and chemically stable during photocatalytic reactions. For TiO2, anatase and rutile are the primary crystal structures, and their differences in photocatalytic activity have been well studied. In many photocatalytic reactions, anatase TiO2 has a higher activity than rutile TiO2. It is often proposed that this difference arises from the higher activity for the reduction of O2, since O2 anion radicals promote the oxidation of organic molecules. Anatase TiO2 also has a higher activity than rutile TiO2 for water reduction reactions. However, in water oxidation, rutile TiO2 has a much higher activity than anatase TiO2. Despite many reports discussing the differences in photocatalytic activity between anatase and rutile TiO2, the principal reason for the difference in photocatalytic activity has not yet been fully elucidated. The photocatalytic activity is determined by the energy states as well as the behavior of charge carriers [1-3]. Therefore, in this work, we have studied the behavior of photogenerated electrons and holes in anatase and rutile TiO2 powders by time-resolved visible to mid-ir absorption spectroscopy [3]. These measurements enable the study of individual behaviors of free- and trapped electrons, and holes excited in the photocatalysts, since these charge carriers give characteristic absorption peaks in visible to near-ir region [1-3]. Figure 1. Difference in the behavior and energy state of photogenerate electrons and holes in anatase and rutile TiO2 powders [3]. 2. Experiments In the experiments, two anatase TiO 2 powders (TIO-1 and TIO-10) and two rutile TiO2 powders (TIO-3 and TIO-6), supplied by the Catalysis Society of Japan, were utilized without further treatment [3]. In each experiment, 355 nm laser pulses (6 ns, 0.5 mj per pulse, Hz) were used to excite the bandgap of the photocatalysts and the transient absorption spectra were measured in vacuum using the home-built spectrometers [1-3]. The decay kinetics of electrons 209

237 and holes were examined in vacuum and in the presence of oxygen gas (O2) and methanol vapor (CH3OH3), which are known to consume electrons and holes, respectively. 3. Results and Discussion Figure 2. Transient absorption spectra of anatase TiO2 powder (TIO-10) irradiated by UV laser pulses (355 nm, 6-ns duration, 0.5 mj per pulse, and 5 Hz). The behavior and energy states of photogenerated carriers in anatase and rutile TiO2 powders were examined upon bandgap excitation. In the case of anatase TiO2 powder, strong absorption was observed at cm-1 (Fig. 2), which is assigned to intraband transition of free electrons in the conduction band (CB) and/or excitation of shallowly trappe delectrons to CB. We found that a considerable number of free electrons are surviving for longer than 1 ms. On the contrary, in the case of rutile TiO2 powder, the free electrons are absent in microsecond domain (Fig. 3): the free electrons are rapidly trapped at defects within a few picosecond and only a trace amount of free electrons can survive for 1 ms. In rutile TiO2, a broad peak was observed at cm-1, which was assigned to the optical transition of deeply trapped electrons from the mid-gap state to CB. The depth was estimated to be >0.9 ev from the absorption edge (7000 cm-1, ~0.9 ev), which is much deeper than that in anatase TiO2 (<1000 cm-1, < 0.1 ev). The difference in the electron trap depth and the lifetime of free or shallowly trapped electrons is responsible for the higher activity of anatase TiO2 for reduction reactions. However, the deep electron trapping in rutile TiO2 positively acts to prevent recombination; thereby extending the lifetimes of both holes and deeply trapped electrons. As a result, the number of holes surviving in rutile TiO2, giving a strong absorption at 25000~17000 cm-1, becomes much larger than in anatase TiO2 (Figs. 2 &3). The longer lifetime of holes promotes photocatalytic oxidation, especially for multi-hole processes such as water oxidation. These findings strongly suggest that the defects in TiO2 powder particles induce peculiar behaviors of charge carriers, which determine the distinctive photocatalytic activities of anatase and rutile TiO2 powders. In addition, we note that these behaviors of photogenerated charge carriers in powder particles are totally different from that in defect-free single crystals [2]. 210

238 Figure 3. Transient absorption spectra of rutile TiO2 powder (TIO-6) irradiated by UV laser pulses (355 nm, 6-ns duration, 0.5 mj per pulse, and 5 Hz). References 1. A. Yamakata et al.: J. Phys. Chem. C, 118 (2014) A. Yamakata et al.: J. Phys. Chem. C, 119 (2015) A. Yamakata et al.: J. Phys. Chem. C, 119 (2015)

239 (Room 108) 22 June 2016, 14:30-15:00 PM Piezoelectric ZnO Thin Films & Their Application for Micro Energy Harvesting Devices Eunju Lee 1, Yeongseon Kim 1, Munhyuk Yim 2, and Giwan Yoon 1 1 School of Electrical Engineering, 2Department of Information & Communications Engineering, Korea Advanced Institute of Science & Technology (KAIST), Daejeon, , South Korea Abstract Recently, much attention has been paid to mechanical energy as a feasible and sustainable power source for independently self-powered wireless flexible/wearable devices or systems. At the same time, many investigations on the energy harvesting devices have been made due to their strong potential for flexible/wearable electronics applications. It is expected that a variety of smart electronic devices will come closer to us and play an important role in enhancing people s life styles and making their social activities more convenient. [1] Most of smart electronic devices will be ubiquitous and available, whenever and wherever, to the users. From this perspective, more innovative and energy efficient flexible/wearable devices using ambient renewable energy need to be developed that are more self-powered, environmentally friendly, biocompatible and sustainable. On the other hand, the physical and electrical properties of zinc oxide (ZnO)-based materials and related devices have been intensively investigated along with their synthesis and fabrication. [2] In particular, the preferential adoption of ZnO for nanogenerators (NGs) fabrication seems to be attributed to its good properties in biocompatibility, voltage-current nonlinearity, catalytic activity, chemical stability, resistance to high temperature electronic degradation. More recently, many researches have been made in an effort to develop even more innovative micro-energy harvesting devices such as ZnO-based nanogenerators incorporating piezoelectric ZnO nanomaterials and nanostructures. Flexible piezoelectric ZnO-based nanogenerators appear to be very attractive energy-harvesting devices, exploiting mechanical energy that is generated randomly over a wide frequency range in the environment surrounding us. Especially, the vertically-integrated flexible nanogenerators (VINGs) based on ZnO materials have been studied due mainly to their high compatibility in process technology with conventional complementary metal oxide semiconductor (CMOS) technology and structural simplicity and robustness, etc. Two key issues for the VINGs design are both forming more reliable potential barriers and increasing conversion efficiency for the inherently n-type ZnO semiconductor. [3] In this work, we present our research results obtained in the process of developing more energyefficient devices, including the fabrication of ZnO-based VING devices which are implemented on flexible substrates. [4, 5] First, we investigated an in-situ N-doping approach to modulate the free-carrier density in inherently n-type-grown ZnO films, as shown in figure 1. Then, we fabricated free carrier-modulated thin film-based flexible nanogenerators (NZTF-FNGs), showing a significantly larger performance improvement, as compared to the conventional ZnO thin film-based flexible nanogenerators (CZTF-FNGs). [4] This is believed to be due to the substantial suppression of the screening effect in the bulk of the ZTFs and the formation of more reliable Schottky barriers at the interfaces caused by an N-doping process. Moreover, the NZTF-FNGs were verified to be well-qualified for micro-energy harvesting applications. Thus, this N-compensatory doping approach seems to be very useful for developing high-quality micro energy harvesting devices. 212

240 Fig 1. ZnO films with thicknesses of (a) 265nm & (b) 387nm, respectively (for example). Furthermore, we studied the performance improvement of ZnO thin film-based FNGs through the design and selection of insulating interlayer materials. Here, an aluminum nitride (AlN) insulating layer was newly adopted as an electron blocking layer in the device design. The use of AlN thin interlayer at the interface between the ZnO nanorods (NRs) and the contact electrode resulted in higher output voltages. [5] In addition, the effects of the AlN thickness on the electric potentials and the output voltages of FNGs were studied. Particularly for the ZnO thin film-based FNGs with the bottom AlN interlayer of 30nm thickness, the average of the best peak-to-peak output voltages was ~1.4V under the periodic bending/release motions of a strain condition. This approach will contribute to the further improvement in the performance of ZnO-based flexible nanogenerators suitable for the future flexible/wearable electronics applications. In summary, we fabricated a new ZnO/AlN-stacked piezoelectric nanogenerator, based on the formation of ZnO nanostructures using nitrous oxide (N2O) gas and the adoption of an AlN film layer. The fabricated nanogenerators showed a significant improvement in their output voltages. This approach could help pave the way for more efficient micro-energy harvesting devices with many applications in portable communications, healthcare & environmental monitoring and self-powered wearable electronics, etc. Acknowledgment This work was supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (Grant No. 2013R1A1A ). This work was also supported partly by the K-Valley Research, Education, Development & Business Project (RED&B, N ) funded by the Korea Advanced Institute of Science and Technology (KAIST). References 1. Z. L. Wang, Advanced Materials 24, 4632, (2012). 2. H. Morkoç and Ü. Ö zgür, Zinc oxide (John Wiley & Sons), (2008). 3. R. Hinchet, S. Lee, G. Ardila, L. Montès, M. Mouis, and Z. L. Wang, Advanced Functional Materials 24, 971, (2014). 4. E. Lee, J. Park, M. Yim, S. Jeong, G. Yoon, Applied Physics Letters 104, (2014). 5. E. Lee, J. Park, M. Yim, Y. Kim, G. Yoon, Applied Physics Letters 106, (2015). 213

241 (Room 108) 22 June 2016, 15:00-15:30 PM Soft Matter Quasicrystals in Two and Three Dimensions E. Knobloch 1, P. Subramanian 2, A.J. Archer 3 and A.M. Rucklidge 2 1 Physics Department, University of California at Berkeley, Berkeley, CA 94720, USA 2 Department of Applied Mathematics, University of Leeds, Leeds LS2 9JT, UK 3 Department of Mathematical Sciences, Loughborough University, Loughborough LE11 3TU, UK Abstract Systems of soft-core particles interacting via a two-scale GEM-8 potential, V(r) = e -(r/r)9 + ae - (r/rs)9 with R/R s = are studied [1, 2]. The potential is responsible for peaks in the structure factor of the liquid state at two different but comparable length scales. Dynamical density functional theory in two dimensions is used to identify a 12-fold quasicrystalline state. This state is present even for deeply quenched liquids and is found in a regime in which the liquid state is unstable with respect to modulations on the smaller scale only. As a result, the system initially evolves towards a small-scale crystal state; however, this state is not a minimum of the free energy and so the system subsequently attempts to reorganize itself into a lowerenergy larger-scale crystal. This dynamical process generates a disordered state with quasicrystalline domains (Fig. 1), and occurs even when the large scale is linearly stable, i.e., it is a nonlinear process. With controlled initial conditions, a perfect quasicrystal can form (Fig.1). The results are corroborated using Brownian dynamics simulations [1,2]. Fig1. The left panels show plots of ln [ρ(r) R2] in the (x/r, y/r) plane obtained from DFT for (a, ρ0r2) = (0.8, 3.5). The right panels are the corresponding Fourier transforms. The latter exhibit 12-fold symmetry, which is indicative of QC ordering. The top density profile is obtained from random initial conditions, while the lower profile was formed starting from an initial density profile having QC symmetry. 214

242 The two-dimensional quasicrystal obtained above is not, however, the global free energyimum (Fig. 2). We therefore investigate the formation and stability of three-dimensional quasicrystalline structures focusing on icosahedral quasicrystals. For this purpose, we use the simpler phase field crystal model. As in two dimensions nonlinear interactions between density waves at two length scales may stabilize three-dimensional quasicrystals. We demonstrate that traits that promote the formation of quasicrystals in two dimensions persist in three dimensions, and identify the parameter regime (Figs. 3, 4) within which the quasicrystal state is the global free energy minimum [2]. Fig2. Grand potential density as a function of a for fixedβμ = 39 for the two different crystal structures and also the QC solution displayed in Fig. 1. Here βis the inverse temperature and μ is the chemical potential. Near a=0.75 there is a point where all three have almost the same value of grand potential, but the QC solution is never the global minimum (see the inset). The crystal A phase is of crystal-liquid type [1, 2] throughout the range of a shown. Fig3. Structures with minimum specific free energy f over a range of p a r a m e t e r s μ and ν, characterizing the growth rate of wavenumber k, computed as equilibria of the amplitude equations. PDE calculations are performed on the dashed circle around the origin with radius 0.1. The region in the third quadrant labeled zero indicates that the trivial state U = 0 is globally stable. 215

243 Fig4. Variation of the specific free energy f with angle θ on a circle in the (μ, ν) plane of radius 0.1. Lines track the variation of free energy f of the labeled structures, solid where they are locally stable, dashed where they are locally unstable. We do not make this distinction for the bcc crystals as these use a different set of basis vectors and so their linear stability cannot be compared directly to that of quasicrystals. The zero state, f = 0, corresponds to the uniform liquid. Hollow circles in the inset show the free energies of locally stable quasicrystalline asymptotic steady states from PDE calculations starting from an initial condition of the imprinted quasicrystal. References 1. A. J. Archer, A. M. Rucklidge, and E. Knobloch, Phys. Rev. Lett. 111, (2013), 2. A. J. Archer, A. M. Rucklidge, and E. Knobloch, Phys. Rev. E 92, (2015) P. Subramanian, A. J. Archer, E. Knobloch and A. M. Rucklidge, arxiv:

244 (Room 108) 22 June 2016, 16:00-16:30 PM Fundamental Study of Nanoscale Protein-Polymer Interactions and Potential Contributions to Solid-state Protein Nanoarrays Jong-in Hahm 1 1 Department of Chemistry, Georgetown University, Washington DC, United States Abstract This talk presents an overview of our on-going research, aiming to provide fundamental understanding on nanoscale protein adsorption behavior and to develop more advanced, nextgeneration protein arrays. Intriguing protein adsorption phenomena on nanoscale surfaces exhibiting varying degrees of chemical heterogeneity are directly probed at the individual biomolecule level. Specifically, we elucidate protein adsorption characteristics on the templates of diblock copolymers, blends, and homopolymers. We also investigate location-dependent protein adsorption behavior with respect to the size and distance of the interfacial regions defined by different polymer blocks. We carry out activity measurements of polymeric surface-bound enzymes and compare quantitatively with their free-state activities. We also explore protein assembly on chemically modified, polymeric nanotemplates to provide a range of feature size/shapes in solid-state protein arrays. Our results demonstrate that self-assembling, chemically heterogeneous, nanoscale domains in diblock copolymers can be effectively used for high density biotemplates. Our approach will be particularly beneficial for fabricating periodic patterns of proteins on surfaces with nanometer sizes without the use of lithographic techniques based on electron beam or extreme UV. Insight gained from our study may be used to control the surface density, conformation, orientation, and biofunctionality of prebound proteins in highly miniaturized proteomic applications, now approaching nanoscale. 217

245 (Room 108) 22 June 2016, 16:30-17:00 PM Microstructural characteristics and mechanical properties of biomedical titanium alloy during friction stir processing Liqiang Wang 1 1 State Key Laboratory of Metal Matrix Composites, Shanghai Jiao Tong University, Shanghai , China Abstract This work systematically investigates the phase transformation and mechanical behavior in biomedical titanium alloy prepared by friction stir processing (FSP). The influences of different processing parameters on the microstructural characteristics and mechanical properties in all of the stir zone, transition zone, and heat affected zone are investigated. This study provides new insights into the surface modification of biomedical titanium alloys through FSP method to achieve the desired mechanical properties with the aim of desired biomedical applications. 218

246 (Room 109) 22 June 2016, 09:30-10:00 AM Nanotheranostics and Nanotoxicology The Nexus of Nano & Bio Ultrasonic fabrication of microfluidic systems from thermoplastic polymers Werner Karl Schomburg, J. Kosloh, P. Maurer KEmikro, RWTH Aachen University, Aachen, Germany Abstract In recent years it has been discovered that micro systems from thermoplastic polymer can be fabricated by ultrasonic processes even faster, more flexible, and also at much lower investment costs than, e.g., by injection molding [1-7]. A micro structure is embossed into a stack of polymer layers by ultrasonic hot embossing in a few seconds and ultrasonically welded to another polymer part even quicker. Figure 1 shows the principle of ultrasonic hot embossing. A polymer layer or a stack of polymer layers is placed on top of a tool patterned with protruding micro structures (Fig. 1a). The sonotrode of an ultrasonic welding machine presses the polymer onto the tool and ultrasonic vibrations generate friction heat between the protruding micro structures on the tool and the polymer, and between the polymer layers (Fig. 1b). The polymer is softened and adapted to the micro structures on the tool. After the ultrasound is switched off, the pressing force is kept constant until the polymer is solidified by cooling down. Then, the sonotrode is driven up again and an embossed polymer part is removed from the tool. This entire process is completed in a few seconds. Additional heating of tool and sonotrode often is not required but may ease the process. Fig1. Ultrasonic hot embossing. Ultrasonic welding of micro structures form thermoplastic polymers can be performed with the same welding machine as ultrasonic hot embossing. Special protruding micro structures, socalled energy directors (cf. Fig. 2a), are molten by the friction heat generated by ultrasonic vibrations (Fig. 2b) and act similar as glue joining the two polymer parts. For welding, less ultrasonic energy and less force are used avoiding damaging other micro structures in the near. Fig. 2. Ultrasonic welding. 219

247 A polymer chip from polycarbonate (PC) with bubble catching cavities, a herring bone micro mixer, and a cuvette for optical measurements has been fabricted by ultrasonic processing (cf. Fig. 2). The required micro groove was embossed into a PC plate, 4 mm in thickness. This process step was facilitated by placing a PC foil, 125 µm in thickness, between tool and plate (cf. Fig. 1a) generating additional friction in the near of the surface to be patterned. Besides this, the foil facilitated the flow of the molten polymer towards the sides. When once a part of the polymer is molten, more acoustic energy is absorbed because the absorption is larger in the molten polymer and there is a difference in the acoustic impedance of solid and molten polymer. As a consequence, even more heat is generated where a part of the polymer has become liquified. Fig 2. Microfluidic system from PC fabricated by ultrasonic processing. Fig. 3. Stripe cut out of a stack of colored PP foils after ultrasonic hot embossin. The molten polymer is moved around by the ultrasonic vibrations. This became obvious when a micro structure was generated by ultrasonic hot embossing in a stack of several colored foils. This is shown in Fig. 3 by a stripe cut out of a stack of eight foils from polypropylene (PP) in the colors blue, red, and yellow. At the right edge of the photo, there are seen a part of the not embossed foils still separated from each other. On the left, these foils have been embossed to a single piece of polymer and the material from the individual foils has been mixed by the ultrasound. The microfluidic system shown in Fig. 2 was sealed by ultrasonic welding a PC foil, 700 µm in thickness, on top Fig 4. Cut through a micro nozzle from PVDF [8]. Fig. 5. Cut through a system with two micro channels separated by a perforated membrane. A micro nozzle from poly vinylidene fluoride (PVDF) with a circular cross-section has been fabricated by ultrasonic hot embossing of two half-circular grooves and welding them on top of each other [8]. Figure 4 shows a cut in axial direction through such a nozzle. In the background, the welding seam is visible. The smallest diameter of that nozzle is 250 µm. Figure 5 shows a cut through two micro channels and a perforated membrane welded in between. The channels were fabricated by ultrasonic hot embossing and ultrasonically welded employing energy directors. In the background the inlets of the micro channels are seen. Such 220

248 a microfluidic system can be employed for micro biological experiments. Cells can be grown on one side of the membrane and their nutrition is supplied through the membrane. Also interesting is the possibility to weld metal parts into polymer micro structures. Metal parts between polymer layers cause friction heat when ultrasonic power is applied, and the metal parts are enclosed by the molten polymer resulting in a sealed metal feed through the polymer. This way, electrical connections are fed into a micro channel as shown in Fig. 6 [9], or metal tubes can serve as inlet and outlet of micro channels as shown in Fig. 7. Fig 6. Electrodes sealed by ultrasonic welding into a micro channel from PVDF [9]. Fig. 7. Micro cuvette with ultrasonically welded steel tubes employed as inlet and outlet. References 1. J. Sackmann, K. Burlage, C. Gerhardy, B. Memering, S. Liao, W.K. Schomburg, Review on ultrasonic fabrication of polymer micro devices, Ultrasonics 56, 189 (2015). 2. S.-J. Liu, Y.-T. Dung, Hot embossing precise structure onto plastic plates by ultrasonic vibration, Polym. Eng. Sci. 45, 915 (2005). 3. H. Mekaru, H. Goto, M. Takahashi, Development of ultrasonic micro hot embossing technology, Microelectronic Engineering 84, 1282 (2007). 4. P. Khuntontong, T. Blaser, W.K. Schomburg, Ultrasonic micro hot embossing of thermoplastic polymers, Proc. 24th Annual Meeting of the Polymer Processing Society, II.364, Salerno, Italy, June (2008). 5. H.W. Yu, C.H. Lee, P.G. Jung, B.S. Shin, J.-H. Kim, K.-Y. Hwang, J.S. Ko, Polymer microreplication using ultrasonic vibration energy, J. Micro/Nanolith. MEMS MOEMS 8, (2009). 6. C.H. Lee, P. G. Jung, S.M. Lee, S.H. Park, B.S. Shin, J-H. Kim, K.-Y. Hwang, K.M. Kim, J.S. Ko, "Replictaion of polyethylene nano-micor hierachical structures using ultrasonic forming", J. Micromech. Microeng. 20, (2010). 7. B. Altmann, R. Ahrens, A. Welle, H. Dinglreiter, M. Schneider, A. Schober, Microstructuring of multiwell plates for three-dimensional cell culture applications by ultrasonic embossing, Biomedical Microdevices 14, 291 (2012). 8. S. Liao, J. Sackmann, A. Tollkötter, M. Pasterny, N. Kockmann, W.K. Schomburg, Ultrasonic fabrication of micro nozzles from a stack of PVDF foils for generating and characterizing microfluidic dispersions, Microsystem Technologies (2015). 9. K. Burlage, C. Gerhardy, H. Praefke, M.A. Liauw, W.K. Schomburg, Slug Length Monitoring in liquid-liquid Taylor-Flow integrated in a novel PVDF Micro Channel, Chemical Engineering Journal 227, 111 (2013). 221

249 (Room 109) 22 June 2016, 10:00-10:30 AM Thermodynamic properties from ab-initio calculations Ti and other case studies Guy Makov 1 Materials Department, Ben-Gurion University, Beer Sheva, Israel Abstract The accuracy of ab-initio calculations of thermophysical properties and of phase stability as a function of pressure and temperature are considered in titanium as a case study. The titanium group elements and their alloys are of scientific and technological interest due to their mechanical and electronic properties. Despite the extensive studies there remains both experimental and theoretical uncertainty in determining the phase diagrams. Titanium has three known stable phases: alpha (stable at ambient conditions), beta (stable at high temperatures), omega (stable at high pressures). In addition, there have been reports of two higher pressure phases at room temperature: gamma and delta, and a possible transition to a bcc phase at very high pressures. Density Functional Theory (DFT) calculations of the total energy, electronic structure and lattice parameters are reported for the different phases as a function of pressure determining the phase sequence at high pressure. Density Functional Perturbation Theory (DFPT) calculations for the vibrational spectrum of the phases as a function of pressure explore the stability of potential high pressure phases. From the vibrational spectrum and the electronic density of states, the free energy and thermal properties (heat capacity and thermal expansion) of titanium phases and their phase equilibria are calculated. The uncertainties in the calculated results are discussed in light of their agreement and disagreement with experimental observations motivating further experimental studies. 222

250 (Room 109) 22 June 2016, 11:00-11:30 AM Ion Segregation in Deliquesced Droplets of Alkali Halide Nanocrystals on SiO 2 Approached by both Surface Science Techniques and Electrical Characteristics Kenta Arima, Yoshie Kawai, Kentaro Kawai and Mizuho Moria Department of Precision Science and Technology, Graduate School of Engineering, Osaka University, Yamada-oka, Suita, Osaka , Japan Abstract Anion concentrations at the air/water interface of saline droplets are important in atmospheric and environmental chemistry, because gaseous halogens emitted from the droplet surface mediate various key tropospheric chemical processes.1-4 The puropse of this study is to reveal the ion segregation in deliquesced droplets of alkali halide nanocrystals on SiO2. Noted that SiO2 was chosen as a model substrate for dust particles. First, we used ambient-pressure X-ray photoelectron spectroscopy (AP-XPS) in the Advanced Light Source (ALS) at Lawrence Berkeley National Laboratory. AP-XPS provides photoelectron spectra in the presence of gases up to several Torr.5,6 After preparing a Si(100) substrate covered by a clean chemical oxide (SiO2), we brought the sample into the XPS chamber to deposit a thin KBr film from a solid KBR source heated to C. Water vapor was introduced up to a pressure of 1.5 Torr while the sample temperature was cooled by a Peltier element. This enabled us to take XPS spectra in the relative humidity (RH) range of 0-100%. Incident photon energy was adjusted so that all photoelectrons from Br3d, K2p, Si2p and O1s have similar kinetic energies of approximately 200 ev. Figure 1(a) shows an O1s spectrum from a thin water film on the SiO2 surface with the KBr thin film. Figures 1(b) and 1(c) show the water layer thickness and the atomic concentration ratio of anions to cations as a function of RH, respectively. At 85% RH in Fig. 1(c), the deliquescence point of KBr, the KBr nanocrystals dissolves and the Br/K ratio increases abruptly. Considering the surface-sensitive character of this measuring condition, this is clear evidence for the segregation of Br- ions to the surface of a saturated saline droplet. In other words, Figs. 1(b) and 1(c) suggest that, as the liquid film grows in thickness, the K+ ions stay close to the substrate while Br- concentrates at the liquid-gas interface at RH higher than the deliquescence point.7 Second, in order to complement the result by AP-XPS described above, the adsorption of water on alkali halide nanocrystals (KBr, KCl, KF, NaCl) on SiO2 was in-situ investigated by noncontact atomic force microscopy (AFM) in an amplitude-modulation mode with electrostatic forces, of which detail is found in Refs. 8 and 9. After forming a clean SiO2 film on a Si substrate, alkali halide crystallites were prepared on the SiO2/Si sample by evaporation of films of aqueous solutions spread over the sample and dried with N2 gas. The RH was controlled by the introduction of dry or wet N2 gas obtained by bubbling through water into a glass bell jar. At each RH topographic and surface potential images were obtained simultaneously at room temperature. Figure 2 shows the change in images of KBr/SiO2/Si samples after the deliquescence point (85%). Namely, the nanocrystals in Fig. 2(a) have dissolved completely producing a large flat droplet in Fig. 2(b). And the surface potential of the film is negative relative to that of the surrounding area in Fig. 2(b). Figure 2(c) shows topographic and surface potential profiles across white lines in Fig. 2(b). The film is ~9 nm high and approximately -15 mv more negative than the surrounding area. We attribute the negative contrast of the surface potential over the areas occupied by the dissolved salt crystals to the preferential segregation of the anions to the solution-air interface, which agrees with the results by AP-XPS in the previous paragraph. Similar experiments revealed that, for KBr, KCl and NaCl, deliquesced droplets showed negative surface potentials relative to the surrounding region, indicating the preferential segregation of Br- and Cl- anions to the air/solution interface, even in the presence of a liquid/solid interface located a few nanometers away. This trend was 223

251 more drastic for larger anions, meaning that heterogeneous reactions of gas-phase molecules with saline droplets to emit gaseous halogens can be more significant with larger anions.10,11 The above results were obtained by methods based on surface science. Although they are quite powerful and accurate, one disadvantage is that it takes long to get results. To overcome this time-consuming problem, we aim at detecing the ion segregation in a thin water film on an oxide by measuring the I-V characteristics of a transistor. This is achieved by fabricating a transistor with a saline droplet acting as a gate material instead of metals. Figure 3 shows the flow chart to fabricate an n-channel transistor on a p-type Si substrate, which is realized by photo lithography, ion implantation, vacuum evaporation of metals and thermal oxidation. The obtained n-channel transistors are shown in Fig. 4(a). Next, we measured I-V characteristics of these transistors, and some examples are shown in Fig. 4(b). In Fig. 4(b), we first took an I-V curve of the transistor with a dry SiO2 surface. Then we put a water droplet on the hydrophillic SiO2 surface to take another I-V curve. The drastic decrease of drain current is detected in Fig. 4(b), which is probably due to OH- ions adsorbed on the SiO2 surface. Although we have not tested the performance of the transistors with a saline droplet as a gate material, such a transistor is expected to serve as a quick and a reliable method to grasp the segregation of ions in a thin droplet on an oxide surface. (a) O1s (Adsorbed water) O1s (Vapor) O1s (SiO 2 ) Relative binding energy (ev) (c) Relative ratio of Br/K 2.0 KBr (0.49 nm) Deliquescence point Relative humidity (%) (b) Water layer thickness (nm) SiO 2 KBr (0.15 nm) KBr (0.18 nm) KBr (1.34 nm) Relative humidity (%) Fig. 1. XPS results. (a) O1s spectrum from a 1.34 nm KBr film on a SiO2/Si sample in the presence of 1.5 Torr of water vapor. (b) and (c) show the water layer thickness and the atomic concentration ratios of Br to K as a function of RH, respectively. 224

252 (c) (nm (mv Topograph Surface potentials Fig. 2. AFM images of KBr nanocrystals on SiO2 (a) before, and (b) after deliquescence. Left and right images represent topography and surface potentials, respectively. (c) Cross- sectional profiles along white lines in (b). SiO 2 mask Source and drain Si substrate (a) (b) S D Metal electrodes SiO 2 layer to model aerosol (c) (f) (e) Droplet acting as gate (d) Fig. 3. Flow chart to fabricate a transistor with gate composed of a droplet. (a) (b) Drain current[ 10-6 A] Without droplet With droplet gate Drain voltage [V] Fig. 4. (a) Picture of fabricated transistors. (b) I-V characteristics of transistors. 225

253 Acknowledgement This work was supported by the Japan Society for the Promotion of Science (JSPS) KAKENHI Grant Number 15H This work was also supported in part by a grant from the Murata Science Foundation and the Mikiya Science and Technology Foundation. The Advanced Light Source is supported by the Director, Office of Science, Office of Basic Energy Sciences, of the U.S. Department of Energy under Contract No. DE-AC02-05CH References 1. L.A. Barrie et al., Nature, 334, 138 (1988). 2. B.J. Finlayson-Pitts et al., Nature, 343, 622 (1990). 3. J.C. McConnell et al., Nature, 355, 150 (1992). 4. G.A. Impey et al., J. Geophys. Res. D, 102, (1997). 5. D.F. Ogletree et al., Rev. Sci. Instrum., 73, 3872 (2002). 6. M. Salmeron et al., Surf. Sci. Rep., 63, 169 (2008). 7. K. Arima et al., J. Phys. Chem. C, 114, (2010). 8. J. Hu et al., Science, 268, 267 (1995). 9. M. Salmeron et al., MRS Bull., 8, 36 (1997). 10. K. Arima et al., J. Phys. Chem.A, 113, 9715 (2009). 11. K. ARIMA et al., J. Surf. Sci. Soc. of Japan, 32, 368 (2011) 226

254 (Room 109) 22 June 2016, 11:30-12:00 AM Ion dependent frequency filtering and learning of semiconducting polymer/electrolyte composite Fei Zeng 1, Siheng Lu, Wenshuai Dong, Xiaojun Li, Ao Liu, Ciating Chang, Yuandong Hu 1 1 Key Laboratory of Advanced Materials (MOE), School of Materials Science and Engineering, Tsinghua University, Beijing, , China 2 Center for Brain Inspired Computing Research (CBICR), Tsinghua University, Beijing , People s Republic of China Abstract Studies on pulse responses have been performed on several semiconducting polymer/electrolyte composites. Frequency selectivity and learning were found and dependent on the types of ions and polymer/electrolyte interfaces. In a Pt/P3HT (or MEH-PPV)/PEO+X+ (X=Li, Mg, Nd)/Pt hetero junction, the system response was depressed to low-frequency stimulations (10~50 Hz) but was potentiated to high-frequency stimulations (higher than 80 Hz). Long term memory and learning was realized when the semiconducting polymer was changed to MEH-PPV. Conventional spike-rate-dependent plasticity (SRDP), i.e., BCM learning rule, was realized. The microstructures suitable for frequency selectivity were examined and confirmed by SEM images. Bi-directional signal transportation could be realized by simple connection or using semiconductor/electrolyte mixtures. It was found that input frequency could modulate ionic doping, de-doping and re-doping at the semiconducting polymer/electrolyte interface. Thus, we established a random channel model to describe dynamic processes at the semiconducting polymer/electrolyte interface and explain the observed learning phenomena. We suggest that semiconducting polymer/electrolyte composites will be useful and powerful in mimicking plasticity and learning of bio- synapses, constructing neuromorphic circuits and information computation. Fig1. Frequency-dependent learning has been achieved using semiconducting polymer/electrolyte cells, which realized conventional spike-rate-dependent plasticity learning protocol. 227

255 References 1. W.S. Dong, F. Zeng, S. H. Lu, A. Liu, X. J. Lia, and F. Pan, Nanoscale 2015, 7, F. Zeng, S. H. Lu, S. Z. Li, X. J. Li and F. Pan, PLoS One 2014, 9, e Dong, W. S. et al. RSC Adv.2015, 5,

256 (Room 109) 22 June 2016, 12:00-12:30 PM On the Existence of Stable Clusters in Polymer Melts: Consequences for Nucleation under Processing Conditions Gerhard Eder 1 1 Institute of Polymer Science Johannes Kepler University, Linz Austria Abstract Despite the fact, that the final morphology in 3D of a crystallized polymer part as a result of the thermo-mechanical history during its processing is dominated by the nucleation process, this step is nowadays still not sufficiently understood. The theoretical models for its description are mainly based on the classical nucleation theory by Becker and Döring, in which equilibrium thermodynamic properties are used, among them the interfacial tension between liquid and solid phase. In all these theories, nucleation occurs when a certain degree of undercooling below the thermodynamic (equilibrium) melting temperature is reached. It turns out, however, that already in the liquid above the equilibrium melting temperature some sort of dormant nuclei are present, which are stable and become immediately active as growing crystals in cooling. This can be understood by a proper extension of classical thermodynamics through two additional thermodynamic properties (i.e. edge force and item energy), which become of importance on nanoscopic scales. Both shear treatment of the melt and pressurization has a strong influence on the number density of dormant nuclei in the melt. Since typical time scales for equilibration to the thermodynamic equilibrium can be quite long as compared to other important relaxation processes like that for rheological properties, deformation by flow has a strong and long-lasting influence on the nucleation process during subsequent cooling. A small number of different model experiments deliver quite a broad picture about these processes, starting with quite old results from quenching after extrusion and short term shearing experiments at moderate undercooling. Additional mid and long term shearing at small levels of undercooling, and variation of pressure profiles prior and during cooling complete the picture. For analysis of the experiments classical methods like PLM, in-line birefringence measurements, but also quite new methods like OCT (optical coherence tomography) have been used. The latter method gives access to time and (3D) space resolved information on the crystallization process and its mutual interaction with flow properties (rheology). 229

257 (Room 109) 22 June 2016, 14:00-14:30 PM 3D devices realized by photolithography using spray coating of photoresist Minoru Sasaki 1, S. Kumagai 1 1 Toyota Technological Institute, Nagoya, Japan Abstract The wiring between device elements connects functions realizing the system with the reliability. Fundamentally, the fabrication technique bases on patterning the planer surface. In addition to flat patterns, the wiring using the slant angled sidewall has been reported. Practically, many devices have vertical sidewalls. The advantage of the wiring using the vertical sidewall is the optical access ability without hiding the device under the opaque metal film. In spite of this unique advantage, the fabrication technique has not been established. If the photolithography can be applied to the vertical sidewalls, new devices will be realized. Here, the devices including 3D wiring across vertical sidewalls are described. The fabrication techniques based on the photolithography (the spray coating of the photoresist and the angled exposure) are applied. Figure 1(a) shows the schematic drawing of the photo cells, which are islands on the oxide film[1]. Wiring using the vertical sidewalls minimizes the shadow region caused by the metal electrode. For realizing 3D wiring, the techniques of the spray coating of the photoresist and the angled exposure are applied. Different from the normal exposure, the angled light generates the reflection, which patterns other surfaces in addition to the first incident surface. This reflection becomes a serious problem being combined with the over-dose condition since the sprayed resist film is thinner at the deeper region. By applying the absorbent liquid immersion, the light intensity decreases while UV propagates inside the trench. Figure 1(b) shows the whole device design. The photo cell array is at the center (1.5x1.5mm2). Table 1 lists the cell designs. The number of cells prepared is 25, 50, and 100 having different cell sizes. Since Al pattern is same (35x70 m2) on the top surface, the larger cell has the larger area ratio for the light detection. When the cell is totally covered by Al film, the element works as the normal diode. Figure 2(a) shows the whole view of 100 photo cell array. Figure 2(b) shows magnified view of the cells. Figure 2(c) shows close-up views at the contact electrodes. The electrical connection is successfully obtained using 1 m-thick Al film with the yield of about 50%. Figure 3 shows the voltage generated being irradiated by the laser (650nm wavelength, 3.15mW/mm2). The generated voltage (input impedance for measurement: 1M ) is measured between electrodes changing the number of photo cells inside. With the number of cells, the output voltage increases. The initial increasing ratio against the laser power is larger for the cells having larger fill factor. The normal illumination tends to give the larger output voltage. Figure 4 shows the schematic drawing of the other device[2]. One thermocouple at the right side is the conventional type on the top surface. Another one at the left side is 3D type. The metal lines extend from the top surface to the vertical sidewall. The difference between the above two thermocouples becomes obvious when the device is covered by the cap lid for sealing the microchannel. The conventional thermocouple on the top surface can not front on the flowing material. The thermocouple on the sidewall can front on the flowing material. Figure 5 shows the optics of the angled exposure. UV light is incident at 50O. The light reflection occurs from the trench bottom and the sidewall. Figure 5 is when the trench has the aspect ratio of 0.5 and the depth of 100 m. Through the transparent area in the mask, UV light incident inside the cavity and reflects on the bottom surface and on the left vertical sidewall. The upper 32.2µm region is free from the incidence of the reflected light. Figures 6(a) show the fabricated thermocopule array. The conventional thermocouples on the top surface are obtained at the same time. Figures 6(b) show the magnified image of the hot junctions. As shown in Fig. 7(a), the device is set on the hot plate. The air flow (30ml/min) at the room temperature is supplied. 230

258 Open voltage [V] 2016 Collaborative Conference on 3D & Materials Research (CC3DMR) June 2016 Figure 7(b) shows the static open voltage, which increases with the hot plate temperature. The increasing ratio is 16 V/K, which is in good agreement with the literature. Four conditions are examined using the thermocouples on the top surface and on the sidewall with and without the air flow. The data from the sidewall with the airflow shows the smallest value. The air flow cools the thermocouple on the sidewall. contact hole 3-D wiring photo cell (a) bypass n p (a) (b) 1.5mm Figure 1: (a)schematic drawing of Si photo cell array. (b)whole device design. (b) 8 (c) Figure 2: Photo cells with 3-D wiring across vertical side walls. (a) Whole image of 10x10 cells. 1x10 cells are the bypass diode. (b) Magnified view of cells. (c) Contact holes. 7 Table 1: Design of cells. Active area ratio is the light detection area against the total area including the region hidden by Al electrode. Number of cells Cell size [ m 2 ] 70µm Al Relative size Active area ratio [%] 5x5 5x10 10x10 250x x x µm 100µm nm laser power [mw] 5x5 array 5x10 array 10x10 array Figure 3: Open voltage as the function of the incident laser power with the parameter of photo cell array. The array is without the bypass diode. At all segments including 5 or 10 cells, the average voltage generated at the single cell is V for all cell arrays. 231

259 electrode pad microchannel flow sidewall bottom O UV metal trench photoresist 6 mas m substrate hot junction (a) thermocouples (b) Figure 4: Schematic drawing of the device design of the thermocouples. (a) One group region arrayed along the microchannel. (b) Magnified hot junctions. Figure 5: Schematic drawing of the angled exposure of the patterning on the vertical sidewall. (a) (a) 25 m (b) Figure 6: (a) Array of fabricated thermocouples. (b) Magnified image of the thermocouple on trench sidewall. Cr and Al are observed to show different brightness. (b) Figure 7: Experimental setup for checking the static performance. Open voltage of the thermocouples under 4 conditions. References 1. S. Kumagai, T. Yamamoto, H. Kubo, M. Sasaki, Proc. of MEMS 2012 (Paris) pp T. Hosono, S. Kumagai, M. Sasaki, IEEJ Trans. SM, 136 (2016) pp T. Yamaguchi, M. Shibata, S. Kumagai, M. Sasaki, Jap. J. Appl. Phys. 54 (2015)

260 (Room 109) 22 June 2016, 14:30-15:00 PM 4d Imaging of Polymer Electrolyte Membrane Fuel Cell Cathodes by Scanning Transmission X-Ray Microscopy Juan Wu 1, Adam Hitchcock 1, Mirna Lerotic 2, David Shapiro 3, Viatcheslav Berejnov 4, Darija Susac 4, Juergen Stumper 4 1 Material science & Engineering & BIMR, McMaster University, Hamilton, ON, Canada 2 2 nd Look Consulting, Hong Kong 3 Advanced Light Source, LBNL, Berkeley, CA, 94720, USA 4. Automotive Fuel Cell Cooperation Corp., 9000 Glenlyon Parkway, Burnaby, BC, Canada Abstract Proton exchange membrane fuel cells (PEMFC) are a promising green energy resource for automotive applications. The cathode is a key rate limiting component of PEM-FC, which is typically composed of Pt catalyst decorated carbon support particles, mixed with a proton conducting perfluorosulfonic acid (PFSA) polymer. The distribution of the PFSA ionomer affects PEM-FC efficiency, Pt utilization, and degradation kinetics. Development of the tools capable to measure the ionomer distribution is a major goal of PEM-FC research. Scanning transmission X-ray microscopy (STXM) has been demonstrated to be a very effective method to measure the ionomer in PEM-FC electrodes [1]. While most STXM studies of PEM-FC to date have used only 2D projection [2, 3], the real electrode material is a complex 3D structure with highly ramified void and component distributions. First attempts of studying PEM-FC materials by STXM tomography have been presented [4]. This work presents a systematic approach for optimizing STXM-based methods for quantitative mapping of the individual chemical constituents in PEM-FC cathodes in 3D so called 4D imaging. 4D imaging provides a quantitative understanding of spatial distribution of multiple chemical species in three dimensions including the internal structure, interfaces, and surfaces of micro and nanoscale systems. STXM has been used to measure microtomed PEM-FC membrane electrode assembly (MEA) samples at the C 1s and F 1s absorption edges. Figure 1 presents typical C 1s and F 1s spectra of the main chemical species, and a color coded map of these constituents derived from an efficient 4-energy imaging procedure [2-4]. For 4D imaging, several different types of samples can be measured using STXM tomography, Figure 2. Typically, rotation angles between +70 and -70, 4 increment, and images at 278, 285, 684 and 693 ev are measured. Chemical maps are generated for each angle, aligned and reconstructed to give quantitative 3D chemical maps. Figure 3 presents two orthogonal views of a standard sample composed of a 2-layer structure we used for 3D calibration. Black regions are filled with epoxy. Flat samples limit the tilting range of sampling leading to artifacts in 3D reconstructions even when SIRT methods are used. Here we are using a compressed sensing (CS) algorithm [5] (provided by 2nd Look Consulting ) to significantly improve the quality of 4D imaging obtained from STXM tomography data. The CS approach [5] gives an optimal reconstruction even when very few tilt angles are acquired [6]. Due to strong absorption by soft X-rays, the maximum sample thickness is ~300 nm, while STXM spatial resolution is ~30 nm. We have used a combination of ptycho-tomography with CS approach to increase spatial resolution and reconstruction quality. Ptychography is a scanned coherent diffraction imaging (CDI) technique which provides a spatial resolution exceeding the limitations of probe forming optics [7]. Soft X-ray ptychography has been developed recently at the ALS [7, 8]. Figure 4 shows results of 2-component 4D imaging of a 233

261 PEMFC cathode obtained by ptycho-tomography. Ptycho images were measured below and above the F 1s edge from -66 to +60 with 9 increments. Carbon support maps were generated from the pre-edge absorption image; the ionomer map was generated from the F 1s difference signal. The estimated spatial resolution is 8 2 nm. Fig. 1 (upper) C 1s (left) and F 1s (right) X-ray absorption spectra of graphitic carbon support, perfluorosulfonic acid and epoxy components, (lower) is a color coded composite of quantitative maps of a PEM-FC MEA (red = Pt, green = PFSA, blue = graphitic catalyst support). Fig. 2 STXM tomography and sample types. 234

262 Fig. 3 (upper) 2 layer standard with TeflonTM fiber (green) and Pt-coated (red) carbon fibers (blue) in epoxy (black). Orthogonal views extracted from a 3D reconstruction of STXM-tomo. Fig. 4 (a) Ptychographic method. (b) 4D ptycho-tomo imaging of ionomer (red- yellow) and carbon support (blue-green). STXM was performed on BL at the Advanced Light Source (ALS). tycho-tomography was performed on BL at the ALS. ALS is supported by BES, DoE Ptychography processing performed using SHARP, CAMERA, LBNL. Research supported by AFCC, NSERC, Canada Research Chairs, and the Catalyst Research for Polymer Electrolyte Fuel Cells (CaRPE-FC) network. References 1. D. Susac, V. Berejnov, and AP. Hitchcock, ECS Transactions, (2011). 2. D. Susac, et al., ECS Transactions, (2012). 3. A.P. Hitchcock, et al., J. Power Sources, (2014). 4. V. Berejnov et al. ECS Transactions, (2012). 5. D.L. Donoho, IEEE Transactions, (2006). 6. Z. Saghi et al, Nano Letters, (2011). 7. D.A. Shapiro et al., Nature Photonics, (2014). 8. S. Bea, et al. J. Am. Ceram. Soc., (2015) 235

263 (Room 109) 22 June 2016, 15:00-15:30 PM Effect of Side Chains on Photovoltaic Performance of Two-Dimensional Conjugated Copolymers Li-Hsin Chan 1, You-Ren Liu 2, Horng-Yi Tang 2 1 Department of Applied Materials and Optoelectronic Engineering, National Chi Nan University, Nantou, Taiwan 54561, ROC. 2 Department of Applied Chemistry, National Chi Nan University, Nantou, Taiwan 54561, ROC. Abstract Recently, researchers have developed a new class of two-dimensional (2D) conjugated polymers with side chains or conjugated side groups that broaden the absorption region of the polymers; do not reduce the high hole mobility of the polymers, and provide a relatively lowlying HOMO energy level. These polymers are of interest for their high-performance when they use in polymer solar cells (PSCs). In our previous works, 2D configured random polythiophene derivatives with conjugated side chains were developed and yielded promising results when utilized in PSCs.1-3 We also found that the coplanarity in the polymer main chains also importantly influenced film morphology and device efficiency.4-5 Herein, two new 2D conjugated copolymers that contain diketopyrrolopyrrole and thiophene with different conjugation lengths as side chains, called PDPPMTD and PDPPBTD, as displayed in Fig. 1, were designed and synthesized via Suzuki cross-coupling polymerization, exhibiting favorable light harvesting, charge transporting properties, and photovoltaic properties.6 In this presentation, the influence of side chains of the resulted copolymers on their photophysical and electrochemical characteristics are investigated. Additionally, the morphological and photovoltaic properties of the polymer/fullerene blend films are studied in detail. These works demonstrate that subtle tuning of the chemical structure of the 2D conjugated copolymers can considerably affect their photophysical and photovoltaic properties. 8 PDPPMTD:PC 61 BM (1:2) Current Density (ma/cm 2 ) PDPPBTD:PC 61 BM (1:2) N S O N S S S N O PDPPMTD n N S S O N S S S N O PDPPBTD n Voltage (V) Fig. 1 Chemical structures of PDPPMTD and PDPPBTD References 1. H.-J. Wang, L.-H. Chan, C.-P. Chen, S.-L. Lin, R.-H. Lee, R.-J. Jeng, Polymer 52, 326 (2011). 236

264 2. H.-J. Wang, L.-H. Chan, C.-P. Chen, R.-H. Lee, W.-C. Su, R.-J. Jeng, Thin Solid Films 519, 5264 (2011). 3. H.-J. Wang, Y.-P. Chen, Y.-C. Chen, C.-P. Chen, R.-H. Lee, L.-H. Chan, R.-J. Jeng, Polymer 53, 4091 (2012). 4. L.-H. Chan, S.-Y. Juang, M.-C. Chen, Yu-Jou Lin, Polymer 53, 2334 (2012). 5. L.-H. Chan, L.-C. Lin, C.-H. Yao, Y.-R. Liu, Z.-J. Jiang, T.-Y. Cho, Thin Solid Films 544, 386 (2013). 6. Y.-R. Liu, L.-H. Chan, H.-Y. Tang, J. Polym. Sci., Part A: Polym. Chem. 53, 2878 (2015). 237

265 (Room 109) 22 June 2016, 16:00-16:30 PM Energy-efficient I/O Interface and Clock Distribution for 3D-stacked Mobile Devices Gyuyng-Su Byun 1 1 Electrical Engineering Department, Southern Methodist University, Dallas, TX, USA Abstract 3D integration enables the stacking of multiple devices directly on the top of a microprocessor or memories, thereby significantly improving both energy efficiency and latency between the 3D-stacked devices. For 3D synchronous digital systems, the clock distribution/generation network (CDN) circuit and architecture is one of the key design considerations. However, previous studies have examined the performance benefits by considering only 2D CDN techniques and organizations such as the size reduction of the clock trees and better algorithms for the CDN flip-flop. In this talk, the energy-efficient 3D CDN circuits and architecture to improve both power efficiency and latency of 3D-stacked mobile devices will be explored. Through utilizing a novel 3D clock receiver and 3D symmetric common-centroid CDN stacking archicture enable a 2.3 times energy-efficiency improvement over prior arts such as H-tree structures in 45nm CMOS. The 3D TSV and on-chip CDN channels are based on the highly accurate 3D electromagnetic (EM) solver (HFSS) and 2D EM Momentum models, respectively. Furthermore, energy-efficient 3D I/O interface will be also discussed for future 3D-stacked devices. 238

266 (Room 109) 22 June 2016, 16:30-17:00 PM Memristor crossbars for pattern recognition Son Ngoc Truong 1, Khoa Van Pham 1, Wonsun Yang 1, Hyun-Sun Mo 1, Kyeong-Sik Min 1,2 1 School of Electrical Engineering, Kookmin University, Seoul, Korea Abstract The memristors that had been mathematically predicted by Leon O. Chua in 1971 as the fourth basic circuit element [1] were experimentally implemented by S. Williams et al, who worked at HP in 2008 [2]. Since then, memristors have been considered possibly to be used in non-von Neumann neuromorphic computing systems. Particularly, the nonlinear charge-flux relationship in memristors can be exploited in mimicking synaptic plasticity of biological neuronal systems such as human brains [3]. In addition to this non-linear relationship, memristor crossbar array can be implemented in 3-D architecture that seems similar with brain s anatomical structure. One of elemental functions in neuromorphic applications is pattern recognition. In performing pattern recognition, memristor crossbars can be fast and energy-efficient, compared to CMOS digital circuits. In memristor crossbar, the input pattern vector can be compared simultaneously in parallel with many reference patterns stored at the crossbar. By doing so, memristor crossbar with very simple cross-point array can quickly find the best match with the input pattern among the stored ones. In this presentation, first, we review memristor technology for brain-mimicking pattern recognition. Then, we compare and discuss various memristor crossbar circuits in terms of noise tolerance, energy efficiency, recognition rate, layout area, etc. And, also, we think of how to extend memristor crossbars to hierarchical architecture with multiple layers for recognizing more complex patterns. Acknowledgements The work was financially supported by NRF , NRF-2013R1A1A2A , and NRF-2015R1A5A , funded by the National Research Foundation of Korea (NRF), and by Global Scholarship Program for Foreign Graduate Students at Kookmin Univ. The CAD tools were supported by IC Design Education Center (IDEC), Daejeon, South Korea. References 1. L. O. Chua, Memristor the missing circuit element, IEEE Trans. Circuit Theory 18, 507 (1971). 2. D. B. Strukov, G. S. Snider, D. R. Stewart, and R. S. Williams, Nature 453, 80 (2008). 3. J. J. Yang, M. D. Pickett, X. Li, D. A. A. Ohlberg, D. R. Stewart, and R. S. Williams, Nature Nanotechnology 3, 429 (2008). 239

267 (Room 110) 22 June 2016, 09:30-10:00 AM Flexible and Stretchable Conductors for Electrochemical Energy Conversion Devices Pooi See LEE 1 1 School of Materials Science and Engineering, Nanyang Technolgical University, Singapore Abstract Flexible and stretchable electrochemical energy conversion devices such as supercapacitors, batteries or electrochromics require the use of deformable conducting substrates for anodes or cathode formation. The conducting electrodes ideally possess the characteristics in maintaining good conductivity under mechanical demanding conditions such as stretching, flexing, rolling or crumpling. In this talk, I will elaborate our strategies in the fabrication of flexible conductors for electrochemical conversion devices such as supercapacitors and electrochromics. Supercapacitors are fabricated on flexible conducting electrodes such as reduced graphene oxides nanocomposites and nanofiber hybrid paper free-standing electrode. The development of flexible electrochromics requires highly transparent flexible conductors that we have developed using hybrid nanowires and cellulose matrix. The resultant transparent conducting electrode improves the interaction with the overlay active materials which enhance the electrons conduction and ionic diffusion. Electrochromo-supercapacitors using hybrid flexible conductors will be presented. In addition, stretchable batteries and electrochromics based on the hybrid conducting electrodes have also been achieved. References 1. J. Wang, C. Yan, K. J. Chee, P.S. Lee, Highly stretchable and self-deformable alternating current electroluminescent devices, Adv Mat. 2015, 27(18), G. Cai, P. Darmawan, M. Cui, J. Wang, J. Chen, S. Magdassi, P.S. Lee, Highly stable transparent conductive silver grid/pedot:pss electrodes for integrated bifunctional flexible electrochromo-supercapacitor, Adv. Energy Mat. 2015, DOI: /aenm

268 (Room 110) 22 June 2016, 10:00-10:30 AM Electrochemical Study of Nano-composite Anode for Energy Conversion Applications (Solid Oxide Fuel Cell) Ghazanfar Abbas 1, Rizwan Raza 2 1 Department of Physics, COMSATS Institute of Information Technology, Lahore, Pakistan Abstract Fuel cell technology is one of the most promising and environment friendly energy conversion technologies with high efficiency. Fuel cells undoubtedly carry out a prevalent exploitation in this mellinium due to high efficiency and energy conversion applications [1]. Solid oxide fuel cell is one the best among the fuel cell family having fuel flexibility quality. Fuel cell is a device which converts chemical energy of fuel (hydrogen or hydrocarbon) into electrical energy. Conventional solid oxide fuel cell consists of Ni-YSZ electrodes having YSZ electrolyte, and hydrogen as a fuel have showed an excellent performance, which fetches a confidence to us to provide clean energy at high temperature. But the bulk particle size and high temperature (1000oC) are the main obstacles for commercialization. The investigation of new Ni free electrodes materials for solid oxide fuel cells is a great challenge for fuel cell community. For this purpose, nanocompositeanode materials of Ba0.15 Fe0.10Ti0.15Zn0.60 oxide (BFTZO) were successfully synthesized by solid stated reaction method. Their crystal structure was investigated by XRD and particle size was found to be 39.17nm. The (BFTZO) anodes were tested in fuel cell with ceria-alkali carbonates composite NKCDC and NSDC electrolytes while BSCF conventional material was used as cathode. The fuel cell was fabricated by dry press technique with 13mmin diameter. Electrical conductivity was found to be 5.86 and 4.81S/cm at 600oC in hydrogen atmosphere by DC and AC approach respectively. The maximum power density was achieved to be 471mW/cm2 at 550oC. The concept Ni free nanostructured electrode/anode materials for solid oxide fuel cells can improve the fuel cell quality in terms of performance and stability [2]. Figure 1 shows the best performance 471mW/cm2 of three layers asymmetric fuel cell having the proposed anode BFTZO in the presence of conventional NSDC electrolyte and BSCF cathode materials. Figure 1: Performance of fuel cell having BFTZ anode, conventional NSDC electrolyte and BSCF cathode. 241

269 References 1. A. Atkinson, S. Barnett, R.J. Gorte, J.T.S. Irvine, A.J. Mcevoy, M. Mogensen, S.C. Singhal, J. Vohs, Nature 3, 17 (2004). 2. G. Abbas, R. Raza, M. Ashfaq, M.A. Chaudhry, M.A. Khan, I. Ahmad, B. Zhu, International Journal of Energy Research 38, 518 (2014). 242

270 (Room 110) 22 June 2016, 11:00-11:30 AM Structure determination of aluminides applying state of the art electron crystallography methods L. Meshi 1, S. Samuha 1,2 1 Department of Materials Engineering and Ilse Katz Institute for Nanosized Science and Technology, Ben Gurion University of the Negev, Beer-Sheva 84105, Israel 2 NRCN, Beer Sheva, Israel Abstract Aluminides is an interesting class of materials which is capable to form quasicrystals (QCs), their corresponding 3D periodic phases and other complex intermetallic phases. Mostly these phases have large volume of the unit cell and appear as nano-sized particles dispersed in metallic matrices. Traditional X-ray diffraction methods cannot be used for characterization of their structure due to the lack of single crystals and overlapping and/or broadening of powder diffraction peaks. Thus, Electron Crystallography (which is a combination of electron imaging and diffraction methods for solution of atomic structure of materials) is sometimes the only viable tool for this purpose due to stronger (than X rays) interaction with matter. This characteristic is both advantage (allows to work on smaller volumes, for instance) and disadvantage (dynamical scattering). Due to the dynamical scattering, electron diffraction as a method for structure solution have seen a limited use until 1994 when Precession ED (PED), which produces quasi-kinematical data, was invented [1]. Second milestone which introduced electron crystallography as a solid method for structure solution of novel materials was invention of Electron Diffraction Tomography (EDT) [2]. Since then, hundreds of structures were solved using these and other Electron Crystallography techniques. Only few of those structures are aluminides, since they do not have constant interatomic distances and angles. Thus, there is no chemical reasonability to rely on during verification of correctness of proposed atomic model. In current presentation, structure solution of complex ternary aluminides applying PED and EDT methods will be presented, underlining the methodology developed during this research [3-6]. References 1. R. Vincent and P.A. Midgley, Ultramicroscopy 53, 271 (1994). 2. U. Kolb, T. Gorelik, C. Kübel, M.T. Otten, D. Hubert, Ultramicroscopy 107, 507 (2007). 3. S. Samuha, Y. Krimer, L. Meshi, J. Appl. Cryst. 47, 1032 (2014). 4. S. Samuha, E. Mugnaioli, B. Grushko, U. Kolb, L. Meshi, Acta Cryst. B 70, 999 (2014). 5. S. Samuha, D. Pavlyuchkov, O.V. Zaikina, B. Grushko, L. Meshi, J. of Alloys and Comp. 621, 47 (2015). 6. S. Samuha, B. Grushko, L. Meshi, J. of Alloys and Comp. (2016) DOI: /j.jallcom

271 (Room 110) 22 June 2016, 11:30-12:00 AM Fabrication and characterization of laminated titanium matrix composite Weijie Lu, Yuanfei Han, Hongqiang Duan, Liqiang Wang, Di Zhang State Key Laboratory of Metal Matrix Composites, Shanghai Jiao Tong University, Shanghai, China Abstract The in situ synthesized ceramic particulate reinforcement can improve the specific strength and stiffness of titanium matrix composite, but reducing the room temperature plasticity. The technical focus of this study is the development of new generations of laminated discontinuous titanium matrix composite that provides significantly improved strength and ductility. An in situ synthesized multilayer (TiB+La2O3)/Ti composite was designed by learning from the microstructure of nature biological materials with excellent mechanical properties. The laminated composite was prepared by combined powder metallurgy and hot rolling. Detail investigation on the microstructural characteristic revealed that pores in the as sintered laminated structure composite are completely disappeared after hot rolling at 1050, the agglomerated reinforcement particles are well dispersed and distributed uniformly along the rolling direction. The thickness of pure Ti layer and (TiB+La2O3) composite layer is decreased from 1mm to about 200μm. Meanwhile, the grains size is refined obviously after rolling deformation. The room temperature tensile test indicate that the elongation of the laminated composite improves from 13% to 17% in comparison with the uniform composite, while the tensile strength has litlle change. It provides theoretical and experimental basis for fabricating the novel high performance laminated Ti composites. Fig. 1 shows the macrostructure of the laminated (TiB+La2O3)/Ti composite. The light particles distributed uniformly in the dark matrix were proved to be the insitu produced reinforcements. As can be seen in Fig. 1, the laminated structure compo site consisted of alternate layers of pure Ti and (TiB+La2O3)/Ti composite with the thickness of about 1 mm. The relative density of the laminated structure composite was over 95%. The process of reducing the layer thickness and the pore defects was required to improve the mechanical properties. 244

272 References 1. Y.F. Han, J.X. Li, G.F. Huang, Y.T. Lv, X. Shao, W.J. Lu, Mater. Des.75 (2015) 2. Y. F. Han, H.Q. Duan, W.J. Lu, L.Q. Wang, D. Zhang, Progress in Natural Science: Materials International 25 (2015) 3. L.J. Huang, L. Geng, A.B. Li, F.Y. Yang, H.X. Peng, Scr.Mater.60 (2009) 245

273 (Room 110) 22 June 2016, 12:00-12:30 PM Research on the Elastic-Plastic Deformation Mechanism of Ti-H System Yingying Zong, Cheng Yang, Debin Shan State Key Laboratory of Advanced Welding and Joining, Harbin Institute of Technology, Harbin, Heilongjiang, China Abstract Due to high activity and small radius, hydrogen is inclined to be in an unstable state when external environmental condition changes. So the behavior and role of hydrogen in titanium and titanium alloys is very complex. Recently, microscopic mechanisms between hydrogen and titanium have been proposed according to experimental results. However, the conflicting views exist and the microscopic mechanism of hydrogen-induced plasticity of titanium is lack of theoretical basis. If the phenomena and problems of hydrogen-induced plasticity in titanium cannot be explained and resolved reasonably, the development of thermohydrogen treatment technique will be limited. Therefore, further study of the behavior and mechanism of hydrogen in titanium and titanium alloys is necessary. And the simulated calculation and experiments are designed to focus on the nature of elastic deformation and plastic deformation properties in Ti- H system. This paper adopted the first-principles method to study the behavior and mechanism of hydrogen in titanium from electronic and atomic scale. First principles simulation results show that: hydrogen atoms in α phase and β phase tend to occupy octahedral interstices because hydrogen atoms dissolved in the octahedral interstices release more energy than in the tetrahedral interstices. The lattice distortion and volume expansion increases with the increase of solute hydrogen atoms in α-ti. When the value of solute hydrogen atom exceeds a certain value, the crystal distortion will be too large which leads the crystal structure to convert from hcp to bcc. For the study concerning electronic structure of Ti-H, the new energy of gap has emerged because the electrons in 1s orbit of H atoms interact with that in 3p, 3d and 4s orbit of the nearest Ti atoms. For the α-ti, the kibbutz number and the electron density of the nearest titanium atom decrease with increasing hydrogen content, so hydrogen would induce the weak bonds in α-ti. For the β-ti, the situation is opposite and hydrogen would induce the strong bonds in β-ti. Meanwhile, for Ti-H system, the bulk modulus is positively correlated with the hydrogen content. Noticeably, the shear and Young's modulus is negative with hydrogen content in α-ti and positive in β-ti, as shown in Figure 1. (a) Elastic moduli (Gpa) H/Ti atomic ratio E B G Elastic moduli (Gpa) H/Ti atomic ratio Fig1. Elastic modulus of (a) α-ti-h system, (b) β-ti-h system. (b) E B G Internal friction spectrums of Ti-H system are shown in Figure 2. Internal friction experiments showed that in the high temperature zone the internal friction of recrystallization P0 and the relaxation peak Pb of boundary are negative with hydrogen content. It implies that the hydrogen 246

274 promotes recovery and suppresses recrystallization. The internal frictions concerning hydrogen with dislocations (P2) and dislocations with point defects (P1) both become more obvious with the increase of hydrogen content, which reveals that hydrogen improves the movement of dislocations. The internal friction peak P4 caused by solute atoms and dislocations is negative with hydrogen content, indicating that hydrogen weakened the interaction between dislocations and solute atoms. Snoek internal friction peak is proportional to the hydrogen content because the hydrogen-enhanced diffusion. Elastic modulus has been measured in the α-phase, β-phase and two-phase zone, the experimental results confirm the theory of hydrogen-induced α-ti weak bonds and hydrogen-induced β-ti strong bonds, and a mathematical model has been proposed. (a) Internal Friction Q H 0.09H 0.23H T/K (b) Internal Friction Q H 0.23H Fig 2. Internal friction spectrum of Ti-H system (a) Whole spectrum, (b) Low temperature internal friction spectrum. 5H T/K Fig 3. Grain boundary and texture of pure-ti at 823K under tension and compression (a) Tension, 3.5%, (b) Compression, 3.5%. Lastly, the hot compression and tension tests were conducted to explore hydrogen-induced plasticity mechanisms under different parameters. Specifically, the difference of the role and behavior of hydrogen in tension and compression deformation has been summarized. And the microstructures were observed by optical, scanning electron and transmission electron microscopy, as shown in Figure 3. In the hot compression test, the value of steady stress and 247

275 yield strength are negative with increasing hydrogen content. According to the mechanical performance characteristics, it can be found that hydrogen facilitate dislocation motion and dynamic recovery, while inhibiting the occurrence of dynamic recrystallization. The steady stress dropped significantly from 0.09 to 0.22wt.% because of hydrogen-induced phase transition. In the process of hot tensile test, breaking stress and yield strength decrease with increasing hydrogen content, but the tensile elongation is not positively correlated with the hydrogen content. There is an optimum processing parameters for hot tensile deformation. The different texture and the local softening effect caused by hydrogen resulting in difference of mechanical properties in tension and compression. The change of mechanical properties of different crystal orientation caused by hydrogen is different. 248

276 (Room 110) 22 June 2016, 14:00-14:30 PM Single-crystal graphene growth on SiC by infrared rapid thermal annealing Masao Nagase Tokushima University, Tokushima, Japan Abstract Graphene is a very promising material for future electronics because of its excellent properties. Wafer-scale single-crystal graphene is strongly required for post-silicon technology. A thermal decomposition method of silicon carbide (SiC) enables us to realize large area epitaxial graphene. We successfully fabricated 10 mm 10 mm graphene samples using the infrared rapid thermal annealing (IR-RTA) method. A surface structure control technique was established to create a uniform single-crystal monolayer graphene. Graphene on semi-insulative SiC substrate can be used for various types of electrical measurements without any transfer techniques to other substrates. In this paper, we discuss the growth method of graphene on SiC and the electrical properties of large-area graphene. Figure 1 shows a photograph and schematic of our IR-RTA system (SR-1800 from Thermo- Riko). The infrared source is a 2-kW lamp that lies along one focus of the spheroidal gold mirror, and the sample is installed on a carbon susceptor that lies along the other focus of the mirror. The typical rate of temperature rise was determined to be 7 C/s for controlling the surface morphology of graphene with minimum roughness. Figure 2 shows the annealed sample at 1610 C in 100-Torr argon ambient. A 10-mm2-sized single-crystal monolayer graphene was successfully grown on the SiC substrate. [1, 2] Fig1. Infrared rapid thermal annealing system: Fig. 2. Graphene sample (a) photograph and (b) schematic The electrical properties of graphene on SiC can be measured without any device fabrication processes. Figure 3(a) shows a schematic of the measurement system of a chip-size graphene gas sensor. The graphene sample was mounted on a spring clip-board with four gold contact pins. In an environment control chamber with a gas inlet, the sheet resistance of graphene was measured using the van der Pauw method. Figure 3(b) shows the time dependence of the sheet resistance of graphene on SiC when changing the ambient environment from air with 54 % relative humidity to dry nitrogen. The sheet resistance decreases as the relative humidity decreases. The logarithmic time dependence of the sheet resistance shown in the inset of Fig. 3(b) indicates that the cause of resistance change is attributed to desorption of water molecule from graphene surface. Since water molecules act as p-type dopants, the electron density in epitaxial graphene increases as the number of absorbed water molecules decrease. In this experiment, as-grown epitaxial 249

277 graphene was used for the sample. The result represents native properties of water desorption from graphene. Fig.3 Chip-size graphene gas sensor: (a) schematic and (b) time dependence of sheet resistance Figure 4 shows a novel micro-device concept. The slightly bent two graphene-on-sic substrates contact each other at the center of the sample. The effective contact diameter was estimated to be below 1 µm. By changing the contact force between samples, the contact characteristics can be controlled. The electrical junction properties were measured using a four terminal configuration, as shown in Fig. 5(a). When the contact force is relatively high, the junction characteristics are ohmic. In a soft-contact condition, non-linear characteristics in a current voltage curve are observed, as shown in Fig. 5(b). In this regime, the tunneling current between two graphene layers will be dominant. This result indicated that a graphene graphene tunneling junction with a submicron size was successfully fabricated by a direct-bonding technique. Fig. 4 Graphene-graphene Fig. 5 (a) Schematic of graphene-graphene contact characteristics measurement. (b) I-V characteristics in tunneling regime. In summary, uniform monolayer graphene was epitaxially grown on a SiC substrate using the IR-RTA method. By using a 10-mm2 graphene sample, the water desorption process was observed as the sheet resistance change. The electrical characteristics of a graphene-graphene 250

278 tunneling junction fabricated by a direct-bonding technique were demonstrated. Large-area epitaxial graphene will open the door to future graphene electronics. This work was partially supported by JSPS KAKENHI Grant Numbers and 15H References 1. K. Kobayashi, S. Tanabe, T. Tao, T. Okumura, T. Nakashima, T. Aritsuki, R.-S. O, and M. Nagase, Appl. Phys. Express 8, (2015). 2. T. Aritsuki, T. Nakashima, K. Kobayashi, Y. Ohno and M. Nagase, Jpn. J. Appl. Phys. 55, (2016). To be published. 251

279 (Room 110) 22 June 2016, 14:30-15:00 PM Epitaxial Graphene Grown on Hexagonal SiC at Reduced Temperature with Mo-Plate Capping: Crystallinity and Carrier Transport Kibog Park 1, Hanbyul Jin 2, Sungchul Jung 1, Junhyoung Kim 2 1 Department of Physics, Ulsan National Institute of Science and Technology (UNIST), Ulsan, South Korea 2 School of Electrical and Computer Engineering, Ulsan National Institute of Science and Technology (UNIST), Ulsan, South Korea Abstract The quality of epitaxial graphene (EG) grown on a hexagonal SiC substrate is found to be improved greatly by capping the surface with a molybdenum plate (Mo-plate) during UHV annealing (Fig.1(a)).1 The significant reduction of D-peak and increase of 2D-peak in the measured Raman spectra, compared with the spectra for no capping, confirm the crystallinity enhancement of EG film grown with Mo-plate capping (Fig.1(c)). Mo-plate capping is considered to induce heat accumulation on SiC surface by thermal radiation mirroring and raise Si partial pressure near surface by confining the sublimated Si atoms between SiC substrate and Mo-plate (Fig.1(b)). These two phenomena can cooperatively facilitate an environment favorable for growing high-quality EG films. The electrical properties of the EG film grown on Si-face 6H-SiC surface at ~950 C were characterized by measuring the channel currents of top-gated field effect transistors (FETs) depending on gate voltages and the magnetotransport with Hall-bar structures. From the FET measurements, the carrier type was found to be n-type and the field effect mobility was estimated to be ~1800 cm2/vs. The magnetotransport measurements also showed that the carrier type was n-type with the sheet carrier density of ( ) 1012 cm-2. The Hall mobility was estimated to be ~2100 cm2/vs, similar to the field effect mobility. Due to the relatively high carrier density, the Quantum Hall Effect was observed only for high filling factors up to 14 T. However, clear Shubnikov-de-Hass oscillations were observed, indicating that the random carrier scattering due to impurities or defects is minimal in the EG film grown with Mo-plate capping. With no need to heat the entire SiC substrate to high temperature over 1300 C as in the conventional annealing under UHV or Ar atmosphere, the Mo-plate capping can be an efficient method to reduce energy consumption significantly in growing high quality EG films. Fig1. Schematic views of (a) the experimental configuration for Mo-plate capping and (b) the environment favourable for growing high-quality EG films (Radiation mirroring and confinement of sublimated Si atoms). Raman spectra of EG films grown on hexagonal SiC surface with and without Mo-plate capping. 252

280 References 1. Han Byul Jin, Youngeun Jeon, Sungchul Jung, Vijayakumar Modepalli, Hyun Suk Kang, Byung Cheol Lee, Jae-Hyeon Ko, Hyung-Joon Shin, Jung-Woo Yoo, Sung Youb Kim, Soon-Yong Kwon, Daejin Eom, and Kibog Park*, Scientific Reports 5, 9615 (2015) 253

281 (Room 110) 22 June 2016, 15:00-15:30 PM High quality graphene for advanced applications Monica F. Craciun Centre for Graphene Science, College of Engineering Mathematics and Physical Sciences, University of Exeter, Exeter, UK Abstract Emerging flexible and wearable technologies such as healthcare electronics and energyharvesting devices could be transformed by the unique properties of graphene. The vision for a graphene-driven industrial revolution is motivating intensive research on the synthesis of highquality and high-throughput graphene. Resistive-heating cold-wall chemical vapour deposition (CVD) is a high-throughput method [1-3], but neither the growth of monolayer graphene nor its quality and suitability for flexible and wearable electronics have been demonstrated. In this talk I will present our recent studies on the growth of monolayer graphene using resistiveheating cold-wall CVD [1], a technique that is 100 times faster and 99% lower cost than standard CVD. We report a completely new mechanism for the growth of graphene by resistively heated stage cold-wall CVD which is markedly different form the growth mechanism of graphene in a hot-wall CVD. Using Raman spectroscopy, atomic force microscopy (AFM) and scanning electron microscopy (SEM) we elucidate the early stage formation of graphene by monitoring the transition from disordered carbon adsorbed on Cu to graphene. A thorough complementary study of Raman spectroscopy, AFM, SEM and electrical magneto-transport measurements shows that our cold-wall CVD-grown large-area graphene film is of comparable quality to natural graphene obtained by mechanical exfoliation of graphite. We demonstrate that graphene grown by cold-wall CVD is suitable for the next generation flexible electronics by embedding it into the first transparent and flexible graphene capacitive touch-sensor [4] that could enable the development of artificial skin for robots. Finally, we demonstrate the first graphene coated textile fibers for future wearable devices that can be woven into cloths [5]. Besides its importance for the quick industrial exploitation of graphene, our work could lead to new generations of flexible electronics and offers exciting new opportunities for the realization of graphene-based disruptive technologies. References 1. T. Kobayashi, M. Bando, N. Kimura, K. Shimizu, K. Kadono, N. Umezu, M. Nobuhiko, H. Kazuhiko, N. Shinji, M. Sae, M. Yukiko, H. Yosuke, D. Hobara, Appl. Phys. Lett. 102, (2013). 2. L. Tao, J. Lee, H. Li, R. D. Piner, R. S. Ruoff, D. Akinwande, Appl. Phys. Lett. 103, (2013). 3. J. Ryu, Y. Kim, D. Won, N. Kim, J. S. Park, E. K. Lee, D. Cho, S. J. Kim, G. H. Ryu, H.- A.-S. Shin, Z. Lee, B. H. Hong, S. Cho, ACS Nano 8, 950 (2014). 4. Bointon TH, Barnes MD, Russo S, Craciun MF. High Quality Monolayer Graphene Synthesized by Resistive Heating Cold Wall Chemical Vapor Deposition, Advanced Materials 27, 4200 (2015). 5. Neves AIS, Bointon TH, Melo LV, Russo S, de Schrijver I, Craciun MF, Alves H. Transparent conductive graphene textile fibers, Scientific Reports 5, 9866 (2015). 254

282 (Room 110) 22 June 2016, 15:30-15:45 PM Graphene oxidation fabricated by low damage atmospheric pressure plasma treatments Zong Han Lu 1 and Chi Hsien Huang* 1 Department of Material Engineering, Ming Chi University of Technology, New Taipei 243, Taiwan Abstract Atmospheric pressure plasma jet (APPJ) system has advantages of low equipment cost, easy operation, and high productivity. It is also widely used for surface treatment. However, APPJ contains high energy ions bombardment which are able to damage an atomic-thick graphene easily. To slove this problem, we simply put a filter between plasma jet and graphene surface as shown in Figure1(a). The filter can shield the high energy ion bombardment and only allow highly reactive radicals to reach the graphene surface for functionalization [1]. In this study, high quality graphene grown by low pressure chemical vaopor deposition confirmed by Raman specscopy with 2D/G ration > 2 and almoso invisible D-band was used for APPJ treatment [2]. Oxygen was introduced into APPJ system for graphene oxidation. The oxygen gas was introduced into APPJ system at a flow rate of 8 slm to generate oxygen plasma. Beacause the oxidized graphene has hydrophilic property, the contact angle (CA) measurents were performed after APPJ treatment to examine the graphene oxidation. As shown in Figure 2, after APPJ treatment, CAs decreased as compared with untreated graphene, indicating the presence oxygen functional groups. The CAs decreased with the increase of treatment time, demonstrating that low damage APPJ treatment is an efficienty to oxidize the graphene and control the oxidation degree. In the future, we will optimize the opening ratio (as schematically shown in Figure 3), treatment time and distance between plasma jet and graphene by Raman spectroscopy and X-ray Photoelectron Spectroscopy. Figure 1 Schematic of low damage atmospheric pressure plasma (APPJ) system 255

283 Figure 2. Contact angles of pristine and oxidized graphene treated by APPJ for various treatment time Figure 3. Schematic of filter with various opening ratio References 1. C. H. Huang, et al., Carbon, 73, 244 (2014). 2. D. Graf, et al., Nano Letters, 7, 238 (2007) 256

284 (Room 110) 22 June 2016, 16:00-16:15 PM Controlling and Probing the Band-Gap of Graphene and Graphene-Related Materials Iddo Amit, Tymofiy Khodkov, Ivan Khrapach, Tobias Octon, Monica F. Craciun and Saverio Russo Centre for Graphene Science, College of Engineering, Mathematics and Physical Sciences University of Exeter, United Kingdom Abstract Few layer graphene systems, such as Bernal stacked bilayer and rhombohedral (ABC-) stacked trilayer, offer the unique possibility to open an electric field tuneable energy gap. This energy gap is evident from direct observation by electronic transport experiments on doubly gated suspended ABC-trilayer graphene. From a systematic study of the nonlinearities in current versus voltage characteristics and the temperature dependence of the conductivity, we demonstrate that thermally activated transport over the energy-gap dominates the electrical response of these transistors. The energy gap value, estimated from the temperature dependence and from the current voltage characteristics, follows the theoretically expected electric field dependence with critical exponent of 3/2. In semiconducting transition metal dichalcogenides, the large hysteresis observed at gate sweeps has been attributed to disorder and absorption of humidity. Through current transient measurements of molybdenum di-telluride field-effect transistors, we have gained insight into the mechanism that governs the current response to charge trapping. We will show that contrary to trapping effects in conventional semiconductors, the main effect of trapped charges in 2D materials is on the threshold voltage of the back gate which changes, as the traps occupation is changed. References 1. J. Doe and R. U. Hu, Journal title 1, 246 (2014). 2. A.B. Green, C.D. Black, Book title (Publisher), 135 (2007). 257

285 (Room 110) 22 June 2016, 16:15-16:30 PM Edges of Graphene Nanoribbons Healed by Low Damage Plasma Treatment for Future Nanoelectronic Devices Po Chen Wu 1 and Chi Hsien Huang* 1 Department of Material Engineering, Ming Chi University of Technology, New Taipei 243, Taiwan Abstract Graphene is a very promising material for future nanoelectronic devices because of its high carrier mobility. However, graphene is a semimetal with a zero-bandgap, which limits its potential application to field effect transistors. Graphene nanoribbons (GNRs), a quasi onedimensional graphene nanostructure, has an effective bandgap because of the lateral confinement of charge carriers to overcome the gapless band structure of graphene. Several approaches have been used to fabricate or synthesize GNRs [1-3]. Among them, E-beam lithography (EBL) followed by oxygen reactive-ion etching (O-RIE) is a very good candidate for well-arranged GNRs required for large-scale devce integration [4]. However, conventional O-RIE always produces a large number of defects (dangling bonds) on the edge of GNR, which drastically degrades its electric transport property [5,6]. In order to eliminate the defects at the edge of GNRs, we proposed hydrogen low damage plasma treatment (H-LDPT) to heal the defects by hydrogen passivation [7]. Figure 1. The SEM image of GNR arrays. (a)120nm (b)150nm (c)220nm Figure. 2. OM images of devices with GNR width of 120, 150, and 220 nm.) In this study, the GNR sample fabrication started with a high quality single layer graphene grown by low pressure chemical vapor deposition. After transfer procedure from copper foil to heaviliy doped Si substrate covered by 300-nm SiO2, GNR arrays patterning with various 258

286 widths were prepared by (EBL). Then we used oxygen reaction-ion etching for 3 minute. After removing photoresist, we otabined GNR arrys as shown in Fig. 1. In our experiment explation we can control etching time to get the smaller width of GNR but extra time could make plane graphene to damage. The GNR arrays was covered by a hard mask and then the source and drain electrodes were deposited by a thermal evaporator to form the GNR-FET devices as shown in Fig. 2. From our preliminary data of Ids-Vsd curve, it shows the devices worked beause the Ids increased with the increase of Vsd. In the future, we will use hydrogen low damage plasma treatment (H-LDPT) to heal the edge of GNRs. The characteristics of H-LDPTtreated GNR arrays will be analyzed by Raman spectroscopy and Ids-Vg characteristic of GNR- FET will be examined. References 1. D. Bischoff et al., App. Phy. Vol.109, (2011) 2. Sunmin Ryu et al., ACS Nano, Vol.5, (2011) 3. Jian Sun et al., App. Phy. Lett. 106, (2015) 4. S. Ryu, et al., ACS Nano, 5, (2011) 5. W. X Lin, et al., Acta Phys. Sin., 62, (2013) 6. H. Terrones, et al., 2012 Rep. Prog. Phys., 75, (2012) 7. C. H. Huang, et al., Carbon, 73, (2014) 259

287 (Room 110) 22 June 2016, 16:30-17:00 PM Theory of Electronic, Optical, and Magnetic Properties of Graphene Nanodisks Alok Shukla Department of Physics, Indian Institute of Technology Bombay, Mumbai India Abstract Graphene is a material with fascinating transport properties, but with a limited scope for optoelectronic applications because of its gapless nature. One way to overcome this hurdle is to work with nanostructures of graphene such as graphene nanoribbons or graphene nanodisks many of which are gapped because of their reduced dimensions, and resultant quantum confinement. However, in order to realize the full potential of graphene nanostructures in optoelectronic applications, it is essential to obtain a deep understanding of their electronic structure and optical properties. In this talk we will discuss the theory of electronic structure and optical properties of graphene nanodisks, within a Pariser-Parr-Pople (PPP) model Hamiltonian based correlated electron approach, developed recently in our group. We will present results of theoretical calculations of the optical absorption spectra of graphene nanodisks of different shapes and sizes. In addition to the linear optical absorption spectra, results on the nonlinear optical process of two-photon absorption will also be presented. Large-scale multiconfiguration interaction methodology employed in this work ensures that our calculations include electron correlation effects to a high order. References 1. P. Sony and A. Shukla, Comp. Phys. Comm. 181, 821 (2010). 2. G. Kondayya and A. Shukla, Phys. Rev. B 83, (2011). 3. G. Kondayya and A. Shukla, Phys. Rev. B 84, (2011). 4. G. Kondayya and A. Shukla, Comp. Phys. Comm. 183, 677 (2012). 5. A Pariser-Parr-Pople Model Hamiltonian based approach to the electronic structure and optical properties of graphene nanostructures, K. Gundra and A. Shukla, invited chapter, pages , in Topological Modeling of Nanostructures and Extended Systems, A. R. Ashrafi et al. (eds.), Carbon Materials: Chemistry and Physics Volume 7, F. Cataldo and P. Milani (Series Eds), Springer Science (2013) 6. K. Aryanpour, A. Shukla, and S. Mazumdar, J. Chem. Phys. 140, (2014) 7. T. Basak, H. Chakraborty, and A. Shukla, Phys. Rev. B 92, (2015). 8. T. Basak and A. Shukla, arxiv:

288 (Room 111) 22 June 2016, 09:30-10:00 AM New Nonlinear Optical Materials of Metal Chalcogenides with Promising SHG Signals Wei-Han Lai 1, Alyssa S. Haynes 2, Laszlo Frazer 3, John B. Ketterson 3, Mercouri G. Kanatzidis 2, and Kuei-Fang Hsu 1 * 1 Department of Chemistry, and Center for Micro/Nano Science and Technology National Cheng Kung University, Tainan 701, Taiwan, 2 Department of Chemistry, Northwestern University, Evanston, Illinois 60208, USA 3 Department of Physics and Astronomy, Northwestern University, Evanston, Illinois 60208, USA Abstract Highly efficient generation of mid-infrared radiation occurs through the nonlinear optical (NLO) second harmonic generation (SHG) process and in the 2 12 m range. The commercial chalcopyrite semiconductors AgGaQ 2 (Q = S, Se) exhibit wide infrared transparency, high nonlinearity, and moderate birefringence, but poor laser damage thresholds. We have developed two series of potential infrared NLO materials of Ba 4CuGa 5Q 12 and Ba 6Ag Sn 4.33 Q 16 belonging to tetragonal 42m and cubic 43m crystal systems, respectively. [1,2] Solid solutions in these compounds with systematically varying band gaps and display strong SHG intensities at specific optical ranges. Figure 1 Crystal structures and their comparative SHG intentisites References 1. W. H. Lai, A. S. Haynes, L. Frazer, Y. M. Chang, T. K. Liu, J. F. Lin, I. C. Liang, H. S. Sheu, J. B. Ketterson, M. G. Kanatzidis, and K. F. Hsu, Chemistry of Materils 27, 1316 (2015). 2. S. M. Kuo, Y. M. Chang, In Chung, J. I. Jang, B. H. Her, S. H. Yang, J. B. Ketterson, M. G. Kanatzidis, and K. F. Hsu* 261

289 (Room 111) 22 June 2016, 10:00-10:30 AM Electrical and optical properties of GaAsNBi/GaAs quantum wells W. J. Fan School of Electrical and Electronic Engineering, Nanyang Technological University, Singapore Abstract To achieve the desired infrared wavelength, adding in into GaAs to form InGaAs/GaAs QW can successfully reach 1um emission. But it is too difficult to reach 1.3 um and 1.55 um due to the larger compressive strain in InGaAs. Another method is to add N into GaAs to form GaAsN DNS. The 1.3 and 1.55 um GaAs-based DNS laser diodes have been reported. However, there is a large room to improve the device performance due to the poor material quality with higher N composition. Recently, a novel material, GaAsNBi has been received great attention due to its potential application in the near-infrared optoelectronic devices. In this paper, we will apply the 16-band k.p method to investigate the band structures and optical transition momentum matrix elements of GaAsNBi/GaAs QWs. The compressively strained and lattice matched GaAsNBi/GaAs QW band structures are calculated. The quantum well structure with the fundamental transition at 1.55um is obtained. E (mev) N=1% Bi=11% strain=-1.09% HH1 HH2 LH1 HH3 HH4 Eg= [100] <-- k (2 /L) --> [110] Squared Wavefunction (A.U.) E3 E2 E1 HH1 HH2 LH1 HH3 HH Z (A) Fig1. Band structure of strained GaAsNBi/GaAs QW. QW Fig2. Wavefunction of the TE E1-HH1 E1-HH2 E1-LH1 E1-HH3 E1-HH TM E1-HH1 E1-HH2 E1-LH1 E1-HH3 E1-HH4 Q (mev) Q (mev) [100] <-- k (2 /L) --> [110] Fig.3. TE mode squared optical transition momentum the QW matrix element (SOTMME) of the QW [100] <-- k (2 /L) --> [110] Fig.4. TM mode SOTMME of 262

290 (Room 111) 22 June 2016, 11:00-11:30 AM Micro-resonator devices and systems R. Cheung Scottish Microelectronics Centre, Institute for Integrated Micro and Nano Systems, School of Engineering, University of Edinburgh, Scotland Abstract The presentation will describe research conducted on the design, fabrication and characterization of micro-resonators based in silicon carbide [1-10], graphene [11-12] as well as other 2-dimensional materials [13-14]. Particular emphasis will be placed upon the design and fabrication processes; actuation and sensing mechanisms; resonance tuning; elastic and electronic properties in the fabricated micro-resonator devices and systems. Referernces 1. Boris Svilicic, Enrico Mastropaolo, Rebecca Cheung, "Tunable MEMS Cantilever Resonators Electrothermally Actuated and Piezoelectrically Sensed", Microelectronic Engineering, 145, pp38-42, Boris Svilicic, Enrico Mastropaolo, Rebecca Cheung, "Widely Tunable MEMS Ring Resonator with Electrothermal Actuation and Piezoelectric Sensing for Filtering Applications", Sensors and Actuators A, Physical, 226, pp , B. Svilicic, E. Mastropaolo, R. Cheung, "Piezoelectric Sensing of Electrothermally Actuated Silicon Carbide MEMS Resonators", Microelectronic Engineering, 119, pp 24-27, E. Mastropaolo, B. Svilicic, T. Chen, B. Flynn and R. Cheung, "Piezo-electrically actuated and sensed silicon carbide ring resonators", Microelectronic Engineering, vol. 97, pp , B. Svilicic, E. Mastropaolo, B. Flynn, R. Cheung, "Electrothermally Actuated and Piezoelectrically Sensed Silicon Carbide Tunable MEMS Resonator", IEEE Electron Device Letters, 33, pp , E. Mastropaolo, G. Wood, I. Gual, P. Parmiter and R. Cheung "Electrothermally Actuated Silicon Carbide Tunable MEMS Resonators", IEEE J. of Microelectromechanical Systems, vol. 21, pp , Enrico Mastropaolo, Isaac Gual, Graham Wood, Andrew Bunting, Rebecca Cheung, "Piezoelectrically driven silicon carbide resonators", J. Vac. Sci. and Technol., B, 28, pp C6N18 - C6N23, E. Mastropaolo, I. Gual, R. Cheung, "Silicon carbide electrothermal mixer-filters", Electronics Letters, 46, pp 62-63, Enrico Mastropaolo, Graham Wood, Rebecca Cheung, "Electro-thermal behaviour of Al/SiC clamped-clamped beams", Microelectronic Engineering, 87, pp , Enrico Mastropaolo and Rebecca Cheung, "Electrothermal actuation studies on Silicon Carbide resonators", J. Vac. Sci. and Technol. B, 26, pp ,

291 11. Eldad Grady, Enrico Mastropaolo, Tao Chen, Andrew Bunting, Rebecca Cheung, "Low frequency graphene resonators for acoustic sensing", Microelectronic Engineering, 119, pp , T. Chen, E. Mastropaolo, A. Bunting and R. Cheung, Observation of second flexural mode enhancement in graphene resonators, Electronics Letters, 51, pp , Rui Zhang, Vasileios Koutsos, and Rebecca Cheung, 'Elastic properties of suspended multilayer WSe2', Applied Physics Letters, 108, , Rui Zhang, Tao Chen, Andrew Bunting, and Rebecca Cheung, 'Optical lithography technique for the fabrication of devices from mechanically exfoliated two-dimensional materials', Microelectronic Engineering, 154, pp 62-68,

292 (Room 111) 22 June 2016, 11:30-12:00 AM Split ring resonators from Infrared to UV range L. Y. M. TOBING and Dao Hua ZHANG School of Electrical and Electronic Engineering Nanyang technological University Nanyang Avenue, Singapore Abstract Split ring resonators (SRRs) have attracted significant interest for their wide range pplications from nanoantennae, chemical sensing, subwavelength resolution lithography, to spectroscopy. Thus far, the saturation of magnetic resonance is only reported through numerical simulations, and its experimental investigation is still challenging due to stringent dimensional quirements in the lithographic patterning.with the improved electron beam lithography process, we have demonstrated the smallest reported U-shape SRRs with size of 60 nm with magnetic resonances at varying the dimension parameters and through a standard planar fabrication approach, we demonstrated the saturation of the fundamental magnetic resonance and the limited resonance wavelength is found to be 580 nm [3]. Very recently, we demonstrated successful fabrications of ultra-small Al resonators with magnetic resonances as short as 376 nm. In addition, we also reported interesting phenomena discovered from ultra-small aluminum resonators. One is the hybrid magnetic-electric mode whose preferential excitation in the ultraviolet becomes a limiting mechanism for the achievable fundamental magnetic resonance, and the other is the resonance splitting arising from mode interaction with aluminum interband transition [4]. It is believed that our systematic results on SRRs will create many applications from infrared to UV range. Referernces 1. L. Y. M. Tobing, Liliana Tjahjana, Dao Hua Zhang* et al, Scientific Reports, 3, 2437, 14 Aug L. Y. M. Tobing, Liliana Tjahjana, Dao Hua Zhang et al, Adv Opt Mater, Volume 2, Issue 3, pages , March L.Y. M. Tobing, Yu Luo, Kay Soon Low1, Dawei Zhang, Dao Hua Zhang, Adv Opt Mater, in press. 4. L. Y. M. Tobing and D. H. Zhang, Adv Mater. 28 (5):889-96, Feb

293 (Room 111) 22 June 2016, 12:00-12:30 PM Split-ring resonator metamaterial fabricated by nanosphere lithography Toshihiro Okamoto 1, Kota Tanikawa 1, and Masanobu Haraguchi 1 1 Department of Advanced materials, Institute of Technology and Science, Tokushima University, Tokushima, Japan Abstract The split-ring resonator (SRR) was first reported Pendry et al. [1] in 1999 and the structure has attracted much attention due to the negative refractive index property, shown theoretically by Veselago [2]. SRRs cause magnetic resonance near the LC resonance frequency and change the permeability of the SRR metamaterial. The size of the SRR must be reduced to around 100 nm for operation in the visible / near-infrared region; however, it is technically difficult to make an SRR this small with high accuracy. In addition, it was a virtually impossible task the threedimensional (3D) and high density configuration of SRRs. A lot of researchers are making SRR by using the electron beam lithography. However, this method is unsuitable for mass production, the process is complex, and the system is expensive. In our group, it succeeded in making metalic SRR by the nanosphere lithography (NSL) method. In addition, we succeeded in the scattered light spectra measurement in visible near-infrared region of single isolated SRR, and we clarified that the long wavelength peak in the light scattering spectra corresponded to a fundamental LC resonance mode [3, 4]. Recently, we succeeded in fabricating SRRs of high density and the 2D configuration of the large area (over mm2) using a nanosphere lithography (NSL) technique. In addition, the SRR film in which SRRs were embedded by the polystyrene was fabricated, and they were stacked. In this presentation, we will introduce the fabrication method and the optical property of our SRR optical metamaterial. Figure 1 shows field-emission scanning electron microscope (FE-SEM) images of the gold SRRs fabricated by NSL method. The average outer diameter of each SRR was 132 nm. The transmitted light spectrum in this structure was decreased at 1100 nm wavelength. This phenomenon means the LC resonance with a magnetic resonance of SRR was excited. It is expected that the film composed of these SRRs works as a magnetic metamaterial in the optical wavelength range. 300nm Fig1. The gold split-ring resonators on the glass substrate. References 1. J. B. Pendry, A. J. Holden, D. J. Robbins, and W. J. Stewart, IEEE Trans. Microw. Theory Tech. 47, 2075 (1999). 2. V. G. Veselago, Sov. Phys. Usp. 10, 509 (1968). 3. T. Okamoto, T. Fukuta, S. Sato, M. Haraguchi, and M. Fukui, Opt. Exp. 19, 7068 (2011). 4. T. Okamoto, T. Otsuka, S. Sato, T. Fukuta, and M. Haraguchi, Opt. Exp. 20, (2012). 266

294 (Room 111) 22 June 2016, 14:00-14:30 PM Uncertainty Quantification using Polynomial Chaos Expansion in Numerical Simulations of Spent Nuclear Fuel Assemblies Imane Khalil 1, Roger Ghanem 2 1 Mechanical Engineering Department, University of San Diego, USA 2 Sonny Astani Department of Civil and Environmental Engineering, Viterbi School of Engineering, University of Southern California, USA Abstract A two-dimensional computational model of a Spent Nuclear Fuel (SNF) 9x9 boiling water reactor (BWR) assembly in a horizontal support basket was developed with the use of the FLUENT computational fluid dynamics package. Heat transfer simulations were performed to predict the maximum cladding temperature for different assembly heat generation rates, different uniform basket wall temperatures, and with helium backfill gas. The heat is transferred through conduction within the fuel rods, convection and radiation across the gas-filled region between the rods and the enclosure. Package designers must accurately predict the temperature of the cladding that surrounds the pellets to assure that it does not exceed 400 C to preserve the integrity of the zircalloy cladding tubes containing the nuclear fuel. Current researchers in this field use different computer codes in their studies and have presented numerical results for models of SNF assemblies but the current inability to benchmark the regional material property models for the full range of applicable conditions increases the uncertainty of the resulting temperature predictions. In order to deal with this uncertainty, our research incorporate Uncertainty Quantification (UQ) method into the numerical simulations and the heat transfer and fluid flow modeling techniques. UQ method used in this research is based on a unique approach that uses the Polynomial Chaos Expansion (PCE) to characterize the solution of stochastic differential equations and is a transformative way of applying uncertainty analysis in model-assisted design optimization. Fig1. Temperature Distrubition Results. 267

295 References 1. Bahney, R. H. and Lotz, T. L., Spent Nuclear Fuel Effective Thermal Conductivity Report Prepared for the U.S. DOE, Yucca Mountain Site Characterization Project Office by TRW Environmental Safety Systems, Inc., July, D.I.: BBA REV 00 (1996). 2. Ghanem, R.G., Spanos, P.D., Stochastic Finite Elements: A Spectral Approach. Springer- Verlag, NewYork, NY (1991). 268

296 (Room 111) 22 June June 2016, 14:30-15:00 PM Plasmonic Photopatterning of Topological Defects in Liquid Crystals as Templates for Directed Colloidal Assembly Qi-Huo Wei 1, 1 Liquid Crystal Institute, Kent State University, Kent, OH 44242, USA Abstract Capabilities to define highly engineered molecular orientations in liquid crystals (LCs) are essential to many LC material applications and device manufacturing, such as Pancharatnam lens, diffractive grating, programmable origami, and controlled colloidal assembly. Currently, only two existing techniques allow for patterning complex LC director fields: one is based on rubbing of polymer films with atomic force microscope tips1 and the other relies on photoalignments through pixel-by-pixel direct writing2 or digital mirror photopatterning3. These techniques are ideal for fast prototyping while limited by their serial processing nature for scaling up manufacturing. In this paper, I will present a parallel photopatterning technique to accurately control complex molecular orientations of LCs by using carefully designed plasmonic metamasks (PMMs). When illuminated with non-polarized white light, the PMMs, made of two dimensional rectangular nano-holes in Aluminum, can generate complex polarization and internsity patterns (Fig. 1a-c). By projecting this structured light pattern onto LC cells, the molecular orientation patterns encoded in the nanohole orientations can be induced in the photoalignment materials coated inside the LC cells and then imposed into the bulk of the LC materials (Fig. 1d-e). I will show that arbitrarily complex two and three dimensional LC director fields with topological defects can be patterned with a diffraction-limited spatial resolution in a single exposure. While these patterned topological defects in LCs are desired by a number of applications, here I will focus on our efforts in utilizing these predefined molecular director fields in assembling and manipulating colloids. Fig. 1. Plasmonic photopatterning of a flow of 5 topological defects. a) SEM image of an illustrative PMM with a cluster of 5 topological defects. b) Transmission optical microscopic image of the plasmonic mask illuminated by non-polarized white light. c) Measured polarization direction of the PMM, the background color represents polarization contrast. d) Cross-polarized optical microscopic image of a LC cell with the photopatterned 5 defects. e) Measured molecular director field of the patterned cell. The scale bars in a-e are 2 μm, 10 μm, 5 μm, 25 μm and 10 μm respectively. The LC cell gap is about 2 μm. 269

297 References 1. B. S. Murray, R. A. Pelcovits, C. Rosenblatt, Phys. Rev. E 90, (2014) 2. M. E. McConney, A. Martinez, V. P. Tondiglia, K. M. Lee, D. Langley, Smalyukh II, T. J. White, Adv Mater 25, 5880 (2013). 3. H. Wu, W. Hu, H. Hu, X. Lin, G. Zhu, J.-W. Choi, V. Chigrinov, Y. Lu, Opt. Express 20, (2012). 4. Y. Guo, M. Jiang, C. Peng, K. Sun, O. Yaroshchuk, O. Lavrentovich, Q. H. Wei, Advanced Materials, DOI: /adma , (2016). 270

298 Collaborative Conference on 3D & Materials Research (CC3DMR) June 2016 (Room 111) 22 June 2016, 15:00-15:30 PM Plasmon Enhanced Two-photon Photoluminescence of Metal nanoparticles Qing-Hua Xu Department of Chemistry, National University of Singapore, Sinagpore Abstract Noble metal nanoparticles, such as Ag and Au, have been known to display many unique optical properties including surface Plasmon resonance. Plasmon coupling arises when metal nanoparticles come to close proximity, resulting in a red-shifted Plasmon band and significant enhancement of various optical responses such as surface enhanced Raman scattering (SERS), which has been widely utilized to develop various applications [1]. In addition to SERS, nonlinear optical responses such as two-photon photoluminescence (2PPL) are expected to be significantly enhanced due to their nonlinear dependence on the incident intensity. Our recent studies showed that 2PPL of metal nanoparticles were significantly enhanced upon formation of nanoparticle aggregates. We have demonstrated in such Plasmon coupling enhanced 2PPL in Au, Ag and Au/Ag alloy nanoparticles of different sizes and shapes with enhancement factor of up to 800-fold in colloid solution and five orders of magnitude on the single particle level [2-9]. As many chemically and biologically important species can induce aggregation of metal nanoparticles, this aggregation induced 2PPL enhancement phenomenon could be utilized to develop various two-photon applications to take the unique advantages of two-photon excitation such as deep penetration into biological tissues and 3- dimensional confined excitation. Applications in two-photon sensing of Hg2+, cysteine, glutathione, thrombin, and DNA nuclease have been demonstrated [4-6]. We have also demonstrated aggregation enhanced two-photon singlet oxygen generation and applications in two-photon bio-imaging and phototherapy [7]. Single particle spectroscopy has been utilized to study 2PPL properties of various coupled nanostructures such as Au nanosphere dimers and trimers [8], dimers of Au nanorods, nanocubes and nanotriangles as well as various heterodimers. 2PPL properties of these nanostructures were found strongly dependent on the particle morphology and coupling strength between nanoparticles. Ultrafast two-pulse emission modulation experiments have been performed to investigate the underlying enhancement mechanisms to reveal their excitation nature of two sequential one-photon absorption processes, in which the intermediate states act as the bridge states to significantly facilitate the absorption of two photons to promote the system to the emitting state [9]. A B 0.20 [Target DNA] (nm) Ag NP thrombin folded 0.5 TBA Extinction TBA 15: 5 -GGTTGGTGTGGTTGG Chemical and Biological Sensing Probe ssdnaa: 5 -TCCATGCAACTCAAAAAAAAAA-SH-3 Probe ssdnaa: 5 -SH-AAAAAAAAAAAAGAGGAGTTAA-3 Target ssdna: 5 - GAGTTGCATGGATTAACTCCTCTT Wavelength (nm) Bio-imaging and Phototherapy 60 C [Target DNA] (nm) 500 D [Target DNA] (nm) Wavelength (nm) Wavelength (nm) TPPL Intensity (a.u.) TPPL Intensity (a.u.) E 10 TPPL/TPPL 0 TPPL/TPPL [Target DNA] (nm) Wavelength (nm) Ultrafast Spectroscopic Studies Fig 1. Aggregation enhanced 2PPL of metal nanoparticles and their applications in sensing, imaging, and therapy. Single Particle Spectroscopic Studies 271

299 . References 1. L Polavarapu, J. Pérez-Juste, Q.H. Xu, L.M. Liz-Marzán, J. Mater. Chem. C, 2 (2014), Z.P. Guan, L. Polavarapu, Q.-H. Xu, Langmuir, 26 (2010), P. Yuan, R. Ma, N. Gao, M. Garai, Q.H. Xu, Nanoscale 7 (2015), P.Y. Yuan, R.Z. Ma, Z.P. Guan, N.Y. Gao, and Q.-H. Xu, ACS Appl. Mater. Interf., 2014, 6(15), C.F. Jiang, Z.P. Guan, S.Y.R. Lim, L. Polavarapu, Q.-H. Xu, Nanoscale, 3 (2011), C.F. Jiang, T.T. Zhao, S. Li, N.Y. Gao, Q.-H. Xu, ACS Appl. Mater. Interf., 5 (2013), P. Yuan, X. Ding, Z. Guan, N. Gao, R. Ma, X.F. Jiang, Y.Y. Yang, Q.H. Xu, Adv. Healthcare Mater. 4 (2015), Z.P. Guan, N.Y. Gao, F. Han, Q.-H. Xu, J. Am. Chem. Soc. 135 (2013), X.-F. Jiang, Y.L. Pan, C.F. Jiang, T.T. Zhao, P.Y. Yuan, T. Venkatesan, and Q.-H. Xu, J. Phys. Chem. Lett. 4 (2013),

300 (Room 111) 22 June 2016, 16:00-16:30 PM Thermodynamic properties by Equation of state of liquid sodium under pressure Huaming Li 1, Xiaoxiao Zhang 1, Yongli Sun 1, Mo Li 1,2 1 College of Physics and Optoelectronics, Taiyuan University of Technology, China 2 School of Materials Science and Engineering, Georgia Institute of Technology, USA Abstract We apply a general equation of state of liquid [1,2] to study thermodynamic properties in liquid metals under high temperature and high pressure. Isothermal bulk modulus, molar volume and speed of sound of molten sodium are calculated within good precision as compared with the experimental data. The calculated internal energy data of molten sodium show the minimum along the isothermal lines as the previous result but with slightly larger values. The calculated values of isobaric heat capacity of molten sodium show the unexpected minimum in the isothermal compression. The temperature and pressure derivative of various thermodynamic quantities in liquid Sodium are derived. It is discussed about the contribution from entropy to the temperature and pressure derivative of isothermal bulk modulus. The expressions for acoustical parameter and nonlinearity parameter are obtained based on thermodynamic relations from the equation of state. References 1. H. M. Li, Y. S. Sun, and M. Li, Equation of state of liquid Indium under high 2. pressure, AIP Advances 5, (2015). 3. V. G. Baonza, M. Caceres and J. Nunez, Phys. Rev. B 51, 28(1995). 273

301 (Room 111) 22 June 2016, 16:30-17:00 PM A new atmospheric model with a cubed-sphere grid for numerical weather prediction Song-You Hong and KIAPS staffs Korea Institute of Atmospheric Prediction Systems (KIAPS), Seoul, Korea Abstract Numerical weather prediction uses mathematical models of the atmosphere and oceans to predict the weather based on current weather conditions. Though first attempted in the 1920s, it was not until the advent of computer simulation in the 1950s that numerical weather predictions produced realistic results. A number of global and regional forecast models are run in different countries worldwide, using current weather observations relayed from radiosondes, weather satellites and other observing systems as inputs. Mathematical models based on the same physical principles can be used to generate either short-term weather forecasts or longerterm climate predictions; the latter are widely applied for understanding and projecting climate change. The improvements made to regional models have allowed for significant improvements in tropical cyclone track and air quality forecasts; however, atmospheric models perform poorly at handling processes that occur in a relatively constricted area, such as wildfires (Kalnay 2003, Korea Institute of Atmospheric Prediction Systems (KIAPS), Seoul, Korea, has embarked a national project in developing a new global forecast system in The KIAPS Integrated Model (KIM) system that consists of a spectral element non-hydrostatic dynamical core on a cubed sphere and a physics package with newly developed modules was prepared. The target resolution in 2020 is a 10-km grid. The GRIMs and WRF models have been used as tools in developing/revising advanced physics schemes, in addition to the usage of reference models. This new global forecast system has been evaluated from July 2015, along with a standard data assimilation of 3-D Var. References 1. KaLlnay, 2003: Atmospheric Modeling, Data Assimilation and Predictability. Cambridge University Press. 274

302 (Room 108) 23 June 2016, 09:30-10:00 AM Element-Block Polymers Based on T 8-caged Silsesquioxanes Kensuke Naka, Takayuki Maegawa, Yasuyuki Irie, Orito Miyashita, Hiroaki Imoto Faculty of Molecular Chemistry and Engineering, Graduate School of Science and Technology, Kyoto Institute of Technology, Goshokaido-cho, Matsugasaki, Sakyo-ku, Kyoto , Japan Abstract Polymeric materials based on element-blocks are a new concept of hybrid polymeric materials, and expected to promote new research and to present new ideas for material design involving all elements in the periodic table. [1] In particular, the use of caged silsesquioxanes, denoted as (RSiO 1.5) n or labeled T n cages as element-blocks has been demonstrated to be an efficient method for designing of element-block polymers. Specifically, polymers incorporating the cage silsesquioxanes in the main chain are expected to possess significantly improved mechanical and thermal stability, because the volume fraction of the caged silsesquioxane units was highest. Partially condensed disilanol silsesquioxanes are obtained by hydrolytic condensation of cyclohexyltrichlorosilane or partially hydrolyzed T 8-cages and used as monomers for polymerization. Di- and tri-functional T 10 and T 12 cages are prepared by rearrangement of T 8 cages caused by F - and employed to obtain soluble and processable polymers incorporating the caged silsesquioxanes in the main chain. A soluble polymer containing caged silsesquioxnaes in its main chain is prepared in one-step by hydrolytic condensation of amino group containing organotrialkoxysilanes. The use of double-deckershaped phenyl-substituted silsesquioxanes (DDSQs) possessing precisely two reactive hydrosilane groups is the most successful approach to making linear hybrid polymers. Introduction of DDSQ in the main chain of polymer backbones showed outstanding thermal stability and significantly increased in glass transition temperatures. However, the limitation of the phenyl substituent and the resulting mixture of cis and trans isomers in DDSQ inhibit the further development of hybrid POSS polymer materials. Development of well-defined caged silsesquioxane monomers having two polymerizable functional groups would enable us to develop various types of polymeric materials based on T n cages as element-blocks. Fig1. Synthesis of para-substituted bis(3-aminopropyl)-hexaisobutyl-t 8 cage and polymerization with pyromellitic dianhydride. In contrast to large number of reports on polymers containing the caged silsesquioxanes in the side chain, few papers have reported the synthesis of polymers with the caged silsesquioxanes in the main chain. These are prepared by a step polymerization system using well-defined caged 275

303 silsesquioxane monomers having two polymerizable functional groups. We have reported that a para-substituted bis(3-aminopropyl) hexaisobutyl-substituted T 8 cage was successfully synthesized via a selective corner-opening reaction of 3-aminopropylheptaisobutyl-substituted T 8 cage (1) and a subsequent corner-capping reaction. [2] The key stage of this route is the corner-opening of the completely condensed 3-aminopropyl heptaisosbutyl-substituted T 8 cage (1) with aqueous tetraethylammonium hydroxide (TEAOH), affording trisilanol aminopropyl hexaisobutyl-substituted T 8 cage (2) as the predominant product. We successfully synthesized para-substituted bis(3-aminopropyl) hexaisobutyl-substituted T 8 cage (3) in significant yield via a subsequent corner-capping reaction. Polymerization of the T 8 monomer (2) with pyromellitic dianhydride resulted in a yellow, self-standing film (2). The optical transmittance of the film was over 90% in the visible region between 780 and 490 nm with a film thickness of 0.1 mm. We also successfully synthesized the para-substituted bisvinyl-hexaisobutyl-t 8 cage via a selective corner-opening reaction with an equimolar amount of TEAOH and subsequent cornercapping reaction. [3] The selective corner-opening of vinylheptaisobutyl-substituted T 8 cage (5) occurs under an appropriate condition. Subsequent corner-capping of resulting trisilanol vinylhexaisobutyl-substituted T 8 cage (6) afforded para-substituted bisvinylhexaisobutyl-t 8 cage (7). Fig2. Synthesis of para-substituted bisvinyl-hexaisobutyl-t 8 cage and hydrosilylation polymerization. Hydrosilylation polymerization of the T 8 caged monomer (7) with comonomers resulted in a transparent polysiloxane hybrid film. The polymer (8) showed 1% and 5% weight losses at 352 and 474 C, respectively, under N 2. DSC analysis of the polymer showed an unclear base-line shift at 30 C, suggesting glass transition temperature (T g). However, no obvious softening was observed even heating the film at 100 C. Introduction of the T 8-unit in the main chain of polysiloxane significantly increase in T g. The film showed excellent transparency in the visible region as well as UV region. The optical transmittance of the film was over 98% in the visible region between 780 and 330 nm with a film thickness of 35 m. The polymer exhibits excellent UV transparency over 80% even at 250 nm with low cutoff wavelength (219 nm). We found that the di-functional T 8 cages significantly reduce their crystallinity in comparison with those of mono-functionalized T 8 cages. The present T 8 monomers would contribute to design novel hybrid polymer materials with well-defined properties. References 1. Y. Chujo and K. Tanaka, Bull. Chem. Soc. Jpn., 86, 633 (2015). 2. T. Maegawa, Y. Irie, H. Fueno, K. Tanaka and K. Naka, Chem. Lett., 43, 1532 (2014). 3. T. Maegawa, Y. Irie, H. Imoto, H. Fueno, K. Tanaka and K. Naka, Polym. Chem., 6, 7500 (2015). 276

304 (Room 108) 23 June 2016, 10:00-10:30 AM Electrostatic self-assembly: Possibilities to retain the porphyrin monomer properties in aggregates Yun Yan College of Chemistry and Molecular Engineering, Peking University, Beijing, Abstract Porphyrins are easily aggregate via π-π stacking in various self-assembled structures. This often resulted in quenching of their fluorescence and the production of singlet oxygen generation. We reported a tetragonal Porphyrin nanostructure with the arrangement of porphyrins can be tailored by the ionic block length of triblock polyelectrolye, where the extent of π-π stacking can be controlled. At very short ionic blocks, the self-assembled porphyrins display monomeric photo physical behavior, which allows retention of sufficient fluorescence and generation of singlet oxygen. Our approach reveals that upon proper strategy of molecular self-assembly, we are able to create dispersed π-conjugated molecules in their self-assembled structures. We expect this will efficiently preserve the excellent photo-physical and chemical properties, which will provide new options for material science. Fig1. The illustration of the perturbed porphyrin self-assembly (PPC) and their ability of singlet oxygen generation and fluorescence. References 1. J. Voskuhl; U. Kauscher; M. Gruener; H. Frisch; B. Wibbeling; C. A. Strassert; B. J. Ravoo, Soft Matter, 9, (2013). 277

305 (Room 108) 23 June 2016, 11:00-11:30 AM Dendritic macromolecular antioxidants Choon Y. Lee Departments of Chemistry, Central Michigan University, Mount Pleasant, MI 48859, USA Abstract Numerous studies report the benefits of naturally occurring antioxidants, such as vitamins C and E and polyphenols, for prevention of various human diseases. These antioxidants neutralize harmful free radicals and prevent cellular damage. However, these antioxidants in the presence of transition metal ions, such as iron and copper, can also contribute to generating large amounts of harmful free radicals, resulting in cellular damage. This contradicting anti-oxidant and pro-oxidant behavior of these antioxidants is a significant concern in the use of antioxidants as preventative therapeutics. To overcome this antioxidant dilemma, we utilized a nanotechnology approach; we designed and synthesized antioxidants in dendritic architectures to separate the antioxidant property from pro-oxidant effects. These dendritic antioxidants displayed far superior free radical scavenging activities than the naturally occurring antioxidants. Most importantly, they did not show pro-oxidant effects in the presence of physiological amounts of transition metals. In this presentation, we will report synthesis and characterization of macromolecular dendritic antioxidants as well as their protective effects on human low-density lipoproteins and DNA. 278

306 (Room 108) 23 June 2016, 11:30-12:00 AM Molecular photoassociation and photodissociation dynamics by femtosecond lasers Yong-Chang Han Department of Physics, Dalian University of Technology, Dalian, China Abstract The photoassociation processes via the pump-dump scheme for the heternuclear (Na + H NaH) and the homonuclear (Na + Na Na 2) molecular systems are studied, respectively, using the timedependent quantum wavepacket method. For both systems, the initial atom pair in the continuum of the ground electronic state (X 1 Σ + ) is associated into the molecule in the bound states of the excited state (A 1 Σ + ) by the pump pulse. Then driven by a time-delayed dumping pulse, the prepared excited-state molecule can be transferred to the bound states of the ground electronic state. It is found that the pump process can induce a superposition of the rovibrational levels v, j on the excited state, which can lead to the field-free alignment of the excited-state molecule. The molecular alignment can affect the dumping process by varying the effective coupling intensity between the two electronic states or by varying the population transfer pathways. As a result, the final population transferred to the bound states of the ground electronic state varies periodically with the delay time of the dumping pulse. Fig1. The effect of the field-free alignment on the photoassociation of the NaH molecule. References 1. B.-B. Wang, Y.-C. Han*, and S.-L. Cong, J. Chem. Phys. 143, (2015). 2. W. Gao, B.-B. Wang, Y.-C. Han*, and S.-L. Cong, J. Theor. Comput. Chem. 14, (2015). 279

307 (Room 108) 23 June 2016, 12:00-12:15 PM Robust Superhydrophobic Sponge with Excellent Anti-Icing Properties Fatang Liu, Q. M. Pan School of Chemical Engeering and Technology, Harbin Institute of Technology, Harbin, Heilongjiang, China Abstract Icing problems have catch the eyes of researchers because of the potential threatens to the diarly life and economic activities, but an effective, facile and environmentally friendly strategy is still highly desirable. The researches on anti-icing are focus on delaying ice formation, keeping a low-tempreture water-repllecy and decreasing ice adhesion with the substrates at present. Bioinspired superhydrophobic surface can be a potential strategy in anti-icing applications. Herein, we show that ice can be readily removed form the surface of superhydrophobic polyurethane (PU) sponges via a facile mechanical squeezing process. The sponges were covered by polydopamine (PDA) layers and then Ag nanoparticles were deposited onto the PDA layers to fabricate a micro-nano-scale porous structure. By simply squeezing the resulting sponges, the ice beads can repeatly shed off easily from the sponge surface up to 90 times at most, exhibiting a comparable icephobic properties to the reported results. The excellent icephobic performance is related to the low ice adhesion between ice beads and superhydrophobic sponges, which were demonstrated by an ice adhesion measurement and a fluorescent labeling method. (a) (b) (c) (d) (e) (f) Fig1. Fluorescent images of the superhydrophobic sponge after icing/deicing for (a, d) 1 cycle, (b, e) 35 cycles and (c, f) 70 cycles. The water droplet was labeled by rhodamine 6G (2 mg ml 1) before freezing. As showed in fig1, the fluorescent area gradually expanded from the edge of sponge skeleton to the whole skeleton almost, suggested that the surface textures of sponge were penetrated gradually by more ice after icing/deicing for 1 cycle, 35 cycles and 70 cycles and the degradation of sponge superhydrophobicity. 280

308 In addition, the superhydrophobic sponge could effectively prolong the ice formation. Compared with the pristine sponge, the delay time could be increased from 200 s to 7800 s at least. Acknowledgment Financial support: Self-planned task of the State Key Laboratory of Robotics and System of Harbin Institute of Technology (SKLRS200901C) and National Natural Science Foundation of China ( ). 281

309 (Room 108) 23 June 2016, 12:15-12:30 PM Facile Fabrication of ultralight foams Chen Ning, Pan Qinmin 1 School of Chemistry and chemical engineering, Harbin Institute of Technology, Harbin, Heilongjiang, China Abstract This study reports a facile approach for the synthesis of ultralight three-dimensional (3D) frameworks with tunable microstructure and composition. The method involved the anchoring of nanoparticles onto the surface of commercial polyurethane (PU) sponges via electrostatic interactions, and subsequent calcinations at 500 o C (Fig1). The resulting frameworks (or foams) possessed 3D interconnected microtubes with hierarchical porous structures (Figure 1a-c) and exhibited ultralow density of 5-9 mg cm 3 (Figure 1d). Furthermore, the microstructure and composition of microtubes could be elaborately controlled by using different structured nanoparticles. For example, Fe 3O 4/C, TiO 2/C and carbonaceous foams could be prepared using Fe 3O 4, TiO 2 annoparticles and polystyrene microspheres. More importantly, these foams showed superhydrophobicity after modification with siloxane, which allowed them to be used for novel aquatic devices with large loading capability. Compared with the previously reported methods, the present strategy is easily extended to fabricate ultralight frameworks for various applications such as oil-water separation, catalyst supports, electrode materials, and so on. Scheme 1. Fabrication of ultralight foams by electrostatic interactions and subsequent calcinations. 282

310 a) b) c) d) 740 nm Fig1. SEM images of (a) the Fe 3O 4/C foam and (b) a microtube; (c) cross-section image of the microtube; (d) ultralight Fe 3O 4/C foam stands on a dandelion. 283

311 (Room 108) 23 June 2016, 14:00-14:30 PM Application of a dual-excitation multi-modal digital holographic microscope to biological imaging X. Quan 1, P. Xia 1, Y. Awatsuji 2, O. Matoba 1 1 Kobe University, Rokkodai 1-1, Nada-ku, Kobe , Japan 2 Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto , Japan Abstract Multi-modal digital holographic microscopy is a combination of epifluorescence microscopy and digital holographic microscopy. In the studies of various fields that involve biological samples, phase images and fluorescence images are showing their own advantages. Phase imaging is non-invasive and has ability to image transparent substances; meanwhile fluorescent imaging is able to tag fluorophores to specific molecules so it is easy to identify what is happening inside of the cells. So far, we have developed the experimental system and have demonstrated the simultaneous observation of fluorescence beads and some biological samples [1]. To improve the ability of the measurement, we have been trying to enhance the observation spectral range of the fluorescence light. Different fluorophores have their own absorption spectrum and emittion spectrum, so using broad spectrum would increase the observable fluorescent colors. In this paper, we reviewed our approach to measure simultaneously the multi-color of fluorescence light and phase image. Fig1. The schematic of the dual-excitation multi-modal digital holographic microscope. Centered by the object arm, the left side is a fluorescent microscope, and the right side is digital holographic microscope. A Nd:YAG and Nd:YVO 4 laser is used for the excitation of fluorescence light, and He-Ne laser is used for the phase imaging. 284

312 We started by using two wavelengths to excite fluorescent markers and called it a dual-exitation multi-modal digital holographic microscope. Figure 1 shows the schematic of the proposed system. Two lasers of Nd:YAG and Nd: YLF at wavelengthes of 473 nm and 532 nm are used as exciting light waves. A He-Ne laser is also used for off-axis digital holography for phase imaging. By using several filters to remove the reflection of the excitation lights and fluorescence light, the appropriate information of the fluorescence and the phase image can be obtained by recording image sensors 1 and 2. Three-dimensional phase images can be reconstructed from the holograms by calculating the inverse propagation of light using Fresnel propagation. SPHERO TM yellow and Nile-red fluorescent particles with diamters from 2.5 m to 4.5 m are used as object samples. Figures 2 and 3 show the demonstration of digital holographic microscopy and dual-excitation fluorescence. Holograms are acquired by recording device 2, and phase information was extracted. From Fig. 2(a) and (b), 5 beads were found clearly. Figures 3(a) and (b) show that the fluorescence images of yellow beads and Nile-red beads, respectively. In Figures 3(a) and (b), one and four beads are recognized. From this experiment, two kinds of beads are clearly separated by selecting the fluorescence wavelength. Dual-mode excitation lights and digital holographic configuration enable obtaining multiple quantities such as multi colored fluorescence and phase quantities at a same time. The system also can be applied to biological studies as it can image multiple fluorescent markers and the phase simultaneously. 10 m 10 m (a) (b) Fig2. Phase images at (a) reconstruction distance of 15 mm, (b) reconstruction distance of -25 mm. 10 m 10 m (a) (b) Fig3. Two colors fluorescence images. (a) yellow fluorescence beads and (b) Nile-red fluorescence beads. References 1. Quan, Xiangyu, et al., Optical Review 22.2 (2015):

313 (Room 108) 23 June 2016, 14:30-15:00 PM On the Coherence Characteristics of Fiber-Based Noise-Like Pulsed Laser Sources Yoonchan Jeong, L. A. Vazquez-Zuniga, S. J. Lee, and Y. C. Kwon Laser Engineering and Applications Laboratory, Department of Electrical and Computer Engineering, Seoul National University, 599 Gwanak-Ro, Gwanak-Gu, Seoul 08826, Korea Abstract Fiber-based, passively mode-locked lasers have been receiving a lot of research attention because they are capable of offering very compact and reliable solutions to a wide range of scientific and industrial applications as ultrafast light sources. Very interestingly, these systems can generate not only stable coherent pulses, such as solitons, Gaussian pulses, dissipative solitons, etc., but also quasi-chaotic pulses, such as noise-like pulses [1,2]. Noise-like pulses are often characterized by the formation of randomly oriented femtosecond pulses bunched in a single wave packet traveling at a fundamental or higher harmonic cavity repetition rate. In general, such pulses lack correlation between successive wave packets [1]. In other words, the degree of coherence of bunched pulses vanishes beyond a single cavity roundtrip time. However, we have observed that for some specific cavity conditions partial coherence could exist in bunched, quasi-chaotic pulses, even when representing very typical noise-like pulse behaviors. Here, we present our up-to-date investigations on noise-like pulses generated from a fiber-based laser cavity in various conditions, paying our attention to their coherence properties, in particular. References 1. A. F. J. Runge, C. Aguergaray, N.G.R. Broderick, and M. Erkintalo, Raman rogue waves in a partially mode-locked fiber laser, Opt. Lett., 39, (2014). 2. Y. Jeong, L. A. Vazquez-Zuniga, S. Lee, and Y. Kwon, On the formation of noise-like pulses in fiber ring cavity configurations, Opt. Fiber Technol. 20, (2014). 286

314 (Room 108) 23 June 2016, 15:00-15:30 PM Soft X-ray Resonant, Nano and Operando Spectroscopy for Lithium Ion Batteries Masaharu Oshima Synchrotron Radiation Research Organization, University of Tokyo, Bunkyo-ku, Tokyo , Japan Abstract Lithium ion batteries (LIB) have attracted great attention because of their excellent properties such as high voltage and energy density. Compared to the conventional cathode materials like LiCoO 2, olivine-type iron compound LiFePO 4 is one of the most promising candidates for cathode materials of LIB, because of its prominent properties such as low cost, high safety and huge power generation. The previous spin-polarized density functional theory calculations for the 3d 6 Fe 2+ in LiFePO 4 have displayed that Fe 3d t 2g up-spin states are fully occupied by five electrons, while one Fe 3d t 2g down-spin state is partially occupied by one electron below the Fermi Level. Furthermore, electrode reaction in a Li-ion battery (LIB) is known to be spatially inhomogeneous, nanoscale spectromicroscopic analysis for cathode materials is beneficial to investigate inhomogeneous litium diffusion which causes local degradation of a Li-ion battery after a number of charge/discharge cycles. In this study, we focus on revealing experimentally the change of the electronic structure, especially in the Fe 3d states through Li intercalation / deintercalation for LiFePO 4, pyrophosphate iron compound Li 2FeP 2O 7 [1], Li 2Fe 1-xMn xp 2O 7 with Mn substitution, and Na pyrophosphate iron compound Na 2FeP 2O 7. The cell voltages for LiFePO 4, Li 2FeP 2O 7, Li 2Fe 0.5Mn 0.5P 2O 7, and Na 2FeP 2O 7 were measured to be 3.4 V, 3.5 V, 4.0 V and 3.0 V, respectively. For nano and operando analysis of cathode materials, we performed pin-point photoelectron spectroscopy and soft X-ray emission spectroscopy of LiMn 2O 4, respectively. First of all, we performed Fe 2p-3d resonant photoemission spectroscopy (RPES) and found that Li intercalation caused occupation of one Fe 3d t 2g down-spin state located at the binding energy of about 2 ev. It should be noted that comparing with LiFePO 4 [2] showing 3.4 V for cell voltage, Li 2FeP 2O 7 [3] with 3.5 V for cell voltage has the Fe 3d t 2g down-spin states at the higher binding energy by 0.1 ev, being well correlated with the 0.1 V higher cell voltage for Li 2FeP 2O 7 than LiFePO 4. Then, we have observed Fe 2p - 3d RPES spectra on Li 2Fe 1-xMn xp 2O 7, which are similar to those on LiFePO 4. We also found that a sharp peak located around 2 ev corresponding to Fe 3d t 2g down-spin states shifts to the higher binding energy by 0.5 ev with Mn substitution [4], well explaining the 0.5V higher cell voltage for Li 2Fe 0.5Mn 0.5P 2O 7, as shown in Fig. 1. Then, we measured Fe 2p - 3d RPES spectra on Na 2FeP 2O 7 [5] and found that the Fe 3d t 2g down-spin state is located at the lower binding energy by 0.1 ev than Li 2FeP 2O 7. Taking into consideration that the Na 3s level is located at the higher binding energy by 0.3 ev than the Li 2s level, the energy difference between anode and cathode which is smaller by about 0.5 ev for Na 2FeP 2O 7 than Li 2FeP 2O 7 can be well correlated with the 0.5 V lower cell voltage. Thus, cell voltages can be well predicted by Fe 2p-3d RPES as the universal relationship. 287

315 Secondly, in order to elucidate the lithium intercalation mechanism in spinel LiMn 2O 4 for a high-capacity Li-ion battery cathode material, we have performed nondestructive soft X-ray scanning photoelectron microscopy measurements using the 3D-Nano-ESCA. [6] Valence band spectra for the Li 1+ Mn 2O 4, LiMn 2O 4 and Li 1- Mn 2O 4 particles obtained by chemical treatment suggest that with Li intercalation the Mn 3d e g shoulder peak appears. Furthermore, uniform distribution of the Li 1s peak intensity within the spatial resolution suggests a possibility that lithium ions might be intercalated or deintercalated from the crystal surface instead of the particles edges, which may coincide with that LiMn 2O 4 has three dimensional diffusion path of Li ions. [7] Finally, the operando XES method [8] was applied to cathode materials LiMn 2O 4 in Li ion battery to reveal the electronic structure change of Mn with changing OCV (open circuit voltage). It was demonstrated that the Mn 3+ and Mn 4+ states are successfully distinguished using high-energy-resolution resonant XES. [9] Multiplet calculations have been performed to determine the electronic structures in comparison with operando XES spectra for Mn chemical states in LIB. This work has been done in collaboration with S. Kurosumi, S. Ito, K. Horiba, S. Nishimura, A. Yamada, N. Nagamura, Y. Harada, H. Niwa, Y. Nanba and D. Asakura. Fig1. Fe 3d peak shift for Li olivine and pyrophosphate (a), and Li 2Fe 1-xMn xp 2O 7 with various Mn composition (b) measured by Fe 2p-3d Resonant Photoemission. References 1. N. Furuta et al., Chem. Mater. 24, 1055 (2012). 2. S. Kurosumi et al., J. Phys. Chem. C 115, (2011). 3. S. Kurosumi et al., J. Power Sources 226, 42 (2013). 4. K. Horiba et al., Rev. Sci. Instrum. 82, (2011). 5. K. Horiba et al., J. Phys: Conf. Ser., 502, (2014). 6. P. Barpanda et al., Electrochem. Commun. 24, 116 (2012). 7. N. Nagamura et al., J. Phys: Conf. Ser., 502, (2014). 8. Y. Harada et al., Rev. Sci. Instrum. 83, (2012). 9. D. Asakura et al., Electrochem. Commun. 24, 116 (2015). 288

316 (Room 108) 23 June 2016, 15:30-15:45 PM Synthesis of MnOx/reduced graphene oxide nanocomposite as a negative electrode for lithium-ion battery Shao-Chieh Weng 1, Chia-Chin Chang 2, Chao-Chung Ho 1 1, 3, 4, 5*, Jow-Lay Huang 1 Department of Materials Science and Engineering, National Cheng Kung University, Tainan 701, Taiwan (R.O.C.) 2 Department of Greenergy, National University of Tainan, Tainan 70005, Taiwan (R.O.C.) 3 Department of Chemical and Materials Engineering, National University of Kaohsiung. Kaohsiung 811, Taiwan (R.O.C) 4 Center for Micro/Nano Science and Technology, National Cheng Kung University, Tainan 70101, Taiwan (R.O.C) 5 Research Center for Energy Technology and Strategy, National Cheng Kung University, Tainan 70101, Taiwan (R.O.C) Abstract We report high performance of the manganese oxide/reduced graphene oxide (MnOx/rGO) nanocomposite (shown in Fig. 1) as a negative electrode for lithium-ion battery. The composite is synthesized by low temperature (83 C) chemical solution reaction, and that shows relatively high specific capacities (660 mah/g) after 50 cycles (Fig. 2). For MnOx/rGO composite, the cycling stability is increased remarkably as that with individual MnOx, and this is due to the synergistic effects of both the components in the composite [1]. The rgo acts as a conductive buffer layer that suppresses the volume change of MnOx, and simultaneously promotes the conductivity of MnOx. The functional groups of graphene oxide facilitate MnOx formation at low temperature and that retains MnOx-graphene oxide connection, leading to improve the capacity and cycling stabilbity [2]. Fig1. The SEM image of manganese oxide/reduced graphene oxide (MnOx/rGO) nanocomposite. 289

317 Fig2. Charge/discharge cyclic performance and coulombic efficiency of manganese oxide/reducde graphene oxide (MnOx/rGO) nanocomposite. References 1. Z. S. Wu, G. Zhou, L. C. Yin, W. Ren, F. Li, H. M. Cheng, Nano Energy 1, (2012). 2. R. C. Lee, Y. P. Lin,Y. T.Weng, H. A. Pan, J. F. Lee, N. L. Wu, Journal of Power Sources 253, (2014). 290

318 (Room 108) 23 June 2016, 16:00-16:30 PM Synthesis of one dimentional FePt nanomaterials under high magnetic field Wenli Pei 1*, C. Wu 2, Q. Wang 2, C.S. He 1, J.J. Wang 1, X. Zhao 1 1 Key Laboratory of Anisotropy and Texture of Materials (Ministry of Education), Northeastern University, Shenyang110819, China 2 Key Laboratory of Electromagnetic Processing of Materials (Ministry of Education), Northeastern University, Shenyang110819, China Abstract FePt nanoparticles have received numerous attentions for its promising applications, such as magnetic storage, permanent magnets and catalysis. [1-4] Controllable synthesis of FePt nanoparticles is an important goal for those properties and applications. [5] Simultaneous reduction of platinum acetylacetonate (Pt(acac) 2) and thermal decomposition of iron pentacarbonyl (Fe(CO) 5) method are commonly used for synthesis of FePt nanoparticles. The influence of chemical parameters on size and morphology of wet-chemical synthesized FePt nanoparticles have been widely studied. [6, 7] However, up to now controllable synthesis of FePt nanomaterials with designed morphology is still insurmountable, and the growth mechanism of FePt nanoparticles is still ambiguous. It has been keeping a challenge to develop a new synthesis process with stricter controllability. Recently, high magnetic field based on the roles of magnetic force, Lorentz force, magnetic torque and magnetization energy has been applied to the fabrication of nanomaterials during wet-chemical process.[8-11] These reports show a promising possibility that the high magnetic field might induce anisotropy growth and assemble nanomaterials to form nanomaterials with designed morphology.[9-10] Thus, in this work, a 6 T high magnetic field was employed to synthesize FePt nanoparticles during wet-chemical process. The schematic drawing of the experimental system under high magnetic field is shown in Fig. 1. The FePt nanoparticles were prepared via a modified wet-chemical polyol method. Pt(acac) 2 and Fe(CO) 5 were used as precursors, 1, 2-hexadecanediol (HDD) was used as reductant, and Oleic acid (OA), Oleylamine (OAm) were applied as surfactant. Typically, Pt(acac) 2 (0.1 mmol) and HDD (0.1 g) were dissolved in solvent dibenzyl ether (10 ml) in a three neck flask under Ar atmosphere. The solution was heated to 105 C for 30 min to remove moisture. OA (5 mmol), OAm (5 ~ 15 mmol) and Fe(CO) 5 (0.2 mmol) were injected into the hot solution and heated to 175 C at rate of 1 C /min, and refluxed for 60 min. The magnetic field of 6 T was applied during whole process. The particles were washed repeatedly with ethanol, centrifuged, and finally dispersed in hexane. The TEM micrographs of FePt nanoparticles synthesized under 0 T and 6 T with various OAm/DE ratios in solvent DE system are show in Fig. 2. Without magnetic field, spherical FePt nanoparticles were obtained when the OAm/DE ratio was 1/7 ml (Fig. 2(a1)). While the OAm/DE ratio was up to 3/5, octopod nanoparticles were formed as shows in Fig. 2(b1). However, the morphology of products obtained under high magnetic field are quite different to that of particles synthesized without magnetic field. It could be found some FePt nanorods in the samples synthesized under 6 T magnetic field, as shown in Fig. 2(b1) and Fig. 2(b2). This indicates that the morphology of FePt nanomaterials is relates to both OAm/DE ratio and high magnetic field. Without magnetic field, the morphology of FePt nanomaterials will transform from spherical to octapod with the increasing of surfactant OAm/OA ratio, which is accord well with other researcher. [11] However, with 6 T magnetic field, the FePt nanoparticles prefer to anisotropy growth and present rod-like morphology. Typical SAED patterns of FePt nanoparticles synthesized without and with magnetic field are have been investigated. It could found that high magnetic field doesn t affect crystallography structure of the products. These FePt nanomaterials are indexed as faced-centered cubic (fcc) 291

319 phase with rings of (111), (200), (220) and (311). For nanorods synthesized in solvent DE system under 6 T with OAm/DE = 3/5 ml, two types of the lattice fringes are observed. One is oriented approximately 55 from the rod-growth direction, the interfringe distance is about nm, which is close to the lattice spacing of fcc-(111). The other is parallel to the rodgrowth direction, and the interfringe distance is about nm, which is close to the lattice spacing of fcc-(200). It can be deduced that FePt nanomaterials anisotropic grow up along the <100> directions, which is same to 1 D FePt nanomaterials synthesized without magnetic field. In case of ODE system, we can also find the lattice fringes (fcc-(111)) are approximately 55 from the rod-growth direction and the lattice fringes (fcc-(200)) parallel to the rod-growth direction. These results indicate although high magnetic field does not change the anisotropy growth along <100> direction, the high magnetic field can facilitate anisotropy growth along easy magnetization axis <001> direction both in solvent DE system and in solvent ODE system. In summary, we have employed high magnetic field to synthesis FePt nanomaterials during wet-chemical process. In solvent DE system, morphology of products was transformed from sphere and octopod to rod-like particles by mean of high magnetic field. HRTEM analysis shows that 1D FePt materials grow up along easy magnetization axes <001> direction. The results indicate that the high magnetic field facilitated FePt nanomaterials anisotropy growth along easy axes. High magnetic field as a powerful driving force can induce FePt nanomaterials to anisotropically grow up into 1 D morphology with easy control and good reproducibility. Fig1. Schematic drawing of wet-chemical synthesis system under high magnetic field. Fig2. TEM micrographs of FePt nanoparticles synthesized under 0 T and 6 T with various OAm/DE ratios:(a1) OAm/DE = 1/7 ml, B = 0 T; (a2) OAm/DE = 1/7 ml, B = 6 T; (b1) OAm/DE = 3/5 ml, B = 0 T; (b2) OAm/DE = 3/5 ml, B = 6 T. 292

320 References 1. S. Sun, C. B. Murray, D. Weller, L. Folks and A. Moser, Science 287, 1989 (2000). 2. H. Zeng, J. Li, J. P. Liu, Z. L. Wang and S. Sun, Nature 420, 395 (2002). 3. V. Mazumder, Y. Lee and S. Sun, Adv. Funct. Mater. 20, 1224 (2010). 4. Z. Li, W. Zhang and K. M. Krishnan, AIP Adv. 5, (2015). 5. S. W. Chou, C. L. Zhu, S. Neeleshwar, C. L. Chen, Y. Y. Chen and C. C. Chen, Chem. Mater. 21, 4955 (2009). 6. S. Sun, Adv. Mater 18, 393 (2006). 7. C. Wang, Y. L. Hou, J. Kim and S. H. Sun, Angew. Chem. Int. Ed. 46, 6333 (2007). 8. Y. J. Jian and L Chang, AIP Adv. 5, (2015). 9. J. Wang, Q. W. Chen, C. Zeng and B. Y. Hou, Adv. Mater. 16, 137 (2004). 10. L. Sun, Q. W. Chen, Y. Tang and Y. Xiong, Chem. Commun. 27, 2844 (2007). 11. J. Wang, Q. W. Chen, C. Zeng and B. Y. Hou, Adv. Mater. 16, 137 (2004). 293

321 (Room 108) 23 June 2016, 16:30-17:00 PM Fabrication and evolution of various configuration and size of Pt nanostructures on GaN (0001): Voids, Hillocks, Nanoparticles, Nanoclusters, Porous Pt Network and Porous GaN Puran Pandey, Mao Sui, Quanzhen Zhang, Sundar Kunwar, Ming-Yu Li and Jihoon Lee College of Electronics and Information, Kwangwoon University, Nowon-gu Seoul 01897, South Korea Abstract The fabrication of various size and configuration of Pt nanostrucutures as well as porous GaN has a considerable research interest due their size and configuration dependent efficient properties [1-2] and thus the usability in various applications such as optoelectronics, [3] data storage [4] and catalytic activity. [5] Fig1. Evolution of various configuration of Pt nanostrucutres with the systematic control of annealing temperature and deposition amount. In this work, the systematic study of the Pt nanostructures and holes on GaN (0001) by the appropriate control of annealing temperature and Pt deposition amount was demonstrated. Figure 1 (a) 1(d) shows the evolution of various Pt nanostrucutres and holes on GaN with the increased annealing temperature. Due to the enhanced thermal diffusion of Pt adatoms with the increased annealing temperature, [6] various configuration of Pt nanostructures such as voids, 294

322 hillocks, isolated nanoparticles (NPs) were observed. At relatively hight temperature, the isolated NPs decayed and formed holes on GaN, namely porous GaN. Furthermore, as shown in Fig. 1(i) 1(iv), the evolution of Pt nanostrucutures from isolated NPs, worm-like NPs, and connected nanoclusters to porous Pt network was demonstrated by the systematic control of Pd deposition amount based on the combinational effects of thermal diffusion, Volmer-Weber growth model and coalescence. [7-8] Acknowledgements Financial support from the National Research Foundation of Korea (no and 2016R1A1A1A ), and in part by the research grant of Kwangwoon University in 2016 is gratefully acknowledged. References 1. B. R. Cuenya, M. A. Ortigoza, L. K. Ono, F. Behafarid, S. Mostafa, J. R. Croy and J. C. Yang, Thermodynamic properties of Pt nanoparticles: Size, shape, support, and adsorbate effects. Physical Review B, 84, (2011). 2 S. Mostafa, F. Behafarid, J. R. Croy, L. K. Ono, L. Li, J. C. Yang... and B. R. Cuenya, Shape-dependent catalytic properties of Pt nanoparticles Journal of the American Chemical Society, 132, (2010). 3 M. H. Yeh, S. H. Chang, L. Y. Lin, H. L. Chou, R. Vittal, B. J. Hwang and K. C. Ho, Size effects of platinum nanoparticles on the electrocatalytic ability of the counter electrode in dye-sensitized solar cells Nano Energy, 17, (2015). 4 P. K. Sekhar, S. N. Sambandam, D. K. Sood and S. Bhansali, Selective growth of silica nanowires in silicon catalysed by Pt thin film Nanotechnology, 17, 4606 (2006). 5 R. C. Jeff Jr, M. Yun, B. Ramalingam, B. Lee, V. Misra, G. Triplett and S. Gangopadhyay, Charge storage characteristics of ultra-small Pt nanoparticle embedded GaAs based nonvolatile memory Applied Physics Letters, 99, (2011). 6 F. Ruffino, G. Cacciato and M. G. Grimaldi, Surface diffusion coefficient of Au atoms on single layer graphene grown on Cu Journal of Applied Physics, 115, (2014). 7 M. Volmer and A. Weber, Nucleus formation in supersaturated systems Z. Phys. Chem, 119 (1926). 8 S. Strobel, C. Kirkendall, J. B. Chang and K. K. Berggren. Sub-10 nm structures on silicon by thermal dewetting of platinum. Nanotechnology, 21, (2010). 295

323 (Room 109) 23 June 2016, 09:30-10:00 AM A Systematic Exploration of Nano-Bio Interactions: the Story of Carbon Nanotubes Bing Yan Shandong University, Jinan, China Abstract Carbon nanotubes (CNT) are widely used in various industrial sectors, biomedicine, and many consumer products. However, their potential toxicity is a major concern. We discovered that CNTs enter human cells1, perturb cellular signaling pathways2, affect various cell functions3, and cause malfunctions in animals4,5. Because the majority of atoms in CNT are on the surface, chemistry modification on their surface may change their biological properties significantly. We modified CNT s surface using nano-combinatorial chemistry library approach6. Novel CNTs were discovered to exhibit reduced toxicity6,7 or re-program cellular signaling machineries7. Exploring large sets of bio-assay data with chemoinformatics and computational chemistry, quantitative nanostructure-activity relationship (QNAR) has been established and predictive models built to predict biocompatible CNTs. References 1. Mu, Q.X., Broughton, D.L., Yan, B. Nano Letters 2009, 9(12), Mu, Q.X., Du, G.Q., Chen, T.S., Zhang, B., Yan, B. ACS Nano 2009, 3, (5), Mu, Q.X., Jiang, G.B., Chen, L., Zhou, H., Fourches, D., Tropsha, A., Yan, B. Chemical Reviews.2014; 114(15): Zhang, Y., Bai, Y.H., Jia, J.B., Gao, N.N., Li, Y., Zhang, R.N., Jiang, G.B., Yan, B. Chem. Soc. Rev. 2014, 43, Bai, Y.H., Zhang, Y., Zhang, J.P., Mu, Q.X., Zhang, W.D., Butch, E., Snyder, S., Yan, B. Nature Nanotechnology, 2010, 5(9), Zhou, H., Mu, Q., Gao, N., Liu, A., Xing, Y., Gao, S., Zhang, Q., Qu, G., Chen, Y., Liu, G., Zhang, B., Yan. B. Nano Lett. 2008, 8 (3), Wu, L., Zhang, Y., Zhang, C.K., Cui, X.H., Zhai, S.M., Liu, Y., Li, C.L., Zhu, H., Qu, G.B., Jiang, G.B., Yan, B. ACS Nano.2014 Mar 25;8(3):

324 (Room 109) 23 June 2016, 10:00-10:30 AM Electrochemical Lithiation of Individual Cobalt Sulfide Nanowire-filled Carbon Nanotube Wenzhi Li 1, Gaohui Du 2 1 Department of Physics, Florida International University, Miami, Florida, USA 2 Institute of Physical Chemistry, Zhejiang Normal University, Jinhua , China Abstract Li-ion batteries (LIBs) have an increasingly diverse range of applications from cars to portable electronic devices. The performance of LIBs depends on electrochemical behavior of the electrode materials. Cobalt sulfide presents one of the promising anode materials for the nextgeneration LIBs as it has a higher theoretical lithium storage capacity compared to the carbonaceous material currently used in commercial LIBs. However, cobalt sulfide exhibits rapid capacity fading due to its large volume change (which causes fracture and pulverization of the electrode) and the low conductivity during the discharging and charging processes. Carbon nanotube (CNT) encapsulation of cobalt sulfide is expected to improve the electrochemical properties of the cobalt sulfide anode materials due to the particular structure, extraordinary strength, and excellent electrical conductivity of the CNTs. In this work, a technique was developed to synthesized CNT encapsulated cobalt sulfide nanowires, then a nano-lib inside a TEM using an individual cobalt sulfide-filled CNT as the working electrode was created to directly observe its lithiation-delithiation behavior. The electrochemical process of cobalt sulfide-cnt nanowire was investigated. The cobalt sulfide-filled CNT samples were synthesized using Co/MgO as catalyst by a thermal chemical vapor deposition method. The morphology and microstructure of the cobalt sulfidefilled CNT were examined by electron microscopy. The in situ nanoscale electrochemical experiments were conducted inside a JEM-2100F transmission electron microscope (TEM) using a Nanofactory TEM-scanning tunneling microscopy (STM) holder (see Figure 1a). To construct the nano-lib, cobalt sulfide-filled CNT sample was attached to a blunt Au wire (0.25 mm diameter), serving as the working electrode. A sharp tungsten (W) STM tip was used to scratch the Li metal surface to fetch some fresh Li inside a glove box filled with argon. The layer of Li on the tip of the W rod served as the counter electrode and lithium source. Both the CNT and lithium electrodes were mounted onto a Nanofactory STM-TEM holder, and the holder was quickly transferred into the TEM column. A native Li 2O layer formed on the surface of the Li metal due to the exposure to air, which was served as the solid-state electrolyte to allow the transport of Li + ions. Thus the electrochemical nano-lib constructed in the TEM consists of three parts: cobalt sulfide-filled CNT electrode, Li counter electrode, and Li 2O solid electrolyte. 297

325 Fig1. (a) Schematic illustration of the experimental setup for in situ TEM. (b) Microstructure of a pristine Co 9 S 8 /Co-filled CNT, consisting of two different regions Co 9 S 8 and Co. The filling of the cobalt sulfide nanowires was resulted from the volume expansion when cobalt inside the CNT was transformed to cobalt sulfide and the extrusion action of CNTs as nanomolds. The cobalt sulfide nanowires are single-crystalline Co 9S 8, and their lengths are up to about 10 µm. Often, a pure cobalt segment is observed in cobalt sulfide filled CNT (see Figure 1b) The key factor in the formation of the Co 9S 8-nanowire-filled CNTs in our approach is the introduction of the appropriate concentration of thiophene (C 4H 4S) as the carbon source. Thiophene constantly supplies sulfur and carbon during the cobalt-catalyzed CNT growth, leading to a reliable production of Co 9S 8-filled CNTs with a high filling ratio. The electrochemical lithiation delithiation behaviors of individual Co 9S 8-filled CNTs were investigated using in situ TEM by constructing a nano LIB device inside a TEM. The microstructure evolution of the cobalt sulfide-filled CNT electrode was monitored by simultaneous determination with TEM, and electron diffraction (ED) (See Figure 2). We have revealed the effect of the carbon cap on the lithium storage behaviors of filled CNT. The Co 9S 8 filled CNT with an open end shows a notable axial elongation of the lithiated filler by 94.2% while the filled CNT with closed ends shows a major radial expansion of 32.4%. Intermittent swelling has been observed in the closed CNT due to the presence of Co segment, which is stable in the electrochemical cycles. During the lithiation process, single crystalline Co 9S 8 nanowire converts to multi crystalline nanowire consisting of Co nanograins and Li 2S matrix, and the reversible phase conversion between Co 9S 8 and nanosized Co is revealed during the multiple cycles. These results reveal that the filled CNT with closed ends is favorable for the electrode material to maintain their original shape during lithiation delithiation cycles, which can reduce irreversible changes, maintain good contact between the filling and the CNT shell, and thus benefit the electrochemical lithium storage performance. The filler inside a CNT with open end will be extruded out of the CNT due to the large volume expansion after lithiation. Fortunately, the extruded filler will be confined by a graphite shell pulled out from the CNT by the extruded filler, and the graphite shell ensures the stability of the extruded filler during the next lithiation delithiation cycles. This finding will be valuable for designing high performance cobalt sulfide-cnt-based anode materials for LIBs. 298

326 Fig2. (a) A Co 9 S 8 /Co-filled open CNT with a diameter of about 128 nm. (b)-(h) Time sequence of lithiation process showing the filling nanowire was extruded out of the open end of CNT in the lithiation process. The red dashed curve and arrows demonstrate the reaction front. Keywords: Carbon nanotube, cobalt sulfide nanowire, electrochemical lithiation, in-situ TEM investigation. Acknowledgements This work was supported by the American Chemical Society Petroleum Research Fund (grant# ND10), the U.S. National Science Foundation (grant# DMR ), the Program for New Century Excellent Talents in University of Ministry of Education of China (NCET ), and the National Science Foundation of China (No ). 299

327 (Room 109) 23 June 2016, 11:00-11:30 AM Design of improved electrocatalysts for energy provision Aliaksandr S. Bandarenka Physics Department-ECS, Technische Universitaet Muenchen, Garching, Germany Abstract Electrocatalysis will play an increasingly important role to overcome challenges associated with efficient generation and conversion of so-called solar fuels. The use of model electrodes, particularly single crystals, represents a good opportunity to better understand the performance of nanostructured catalytic materials: identify active sites, elucidate factors responsible for selectivity and stability of the catalytic centers [1]. The common way of improving the activity of e.g. metal electodes is a modification of the electronic properties of the surface through alloying it with other metals. One can distinguish approaches which are based on bulk, subsurface [2] and surface alloying [3]. Additionally, introduction of specific (often quasiperiodic) defects can also result in a drastic increase in the catalyst activity [4]. In the presentation, examples will be given of how the above-mentioned approaches can be used to design active surfaces; and how the model electrodes can help in better understanding of the performance of real-world electrocatalytic systems for future sustainable energy provision. References: 1. Calle-Vallejo, M.T.M. Koper, A.S. Bandarenka, Chemical Society Reviews 42, 5210 (2013). 2. J. Tymoczko, F. Calle-Vallejo, W. Schuhmann, A.S. Bandarenka, Nature Communications 7:10990 doi: /ncomms10990 (2016 in press). 3. A.S. Bandarenka, M.T.M. Koper, Journal of Catalysis 308, 11 (2013). 4. F. Calle-Vallejo, J. Tymoczko, V. Colic, Q.H. Vu, M.D. Pohl, K. Morgenstern, D. Loffreda, P. Sautet, W. Schuhmann, A.S. Bandarenka, Science 350, 185 (2015). 300

328 (Room 109) 23 June 2016, 11:30-12:00 AM The Electrochemical Actuation of Nanoporous Nickel K. W. Kwan, A. H. W. Ngan Department of Mechanical Engineering, The University of Hong Kong, Hong Kong, PRC Abstract Artificial muscles have been investigated for more than a decade to mimic the properties of skeletal muscles. Many self-contained electrically-powered actuators that can produce high strain have been made to achieve the goal. Interestingly, the desirable actuation is attainable by shy grass, which shows rapid and large movement upon stimulations. A large surface area-tovolume ratio of the actuating unit is the key to produce a large strain. Also, a bilayered system can effectively convert the actuating strain into a large deflection. Fig1. The gold nano-protrusions sitting on an inert supporting layer Fig2. The structure of the second bilayered actuator In the light of this, anodized aluminum oxide with nano-pores was used as a template to produce two types of bilayered thin-films with different nanostructures. The first one has a high density of gold nano-protrusions sitting on an inert supporting layer as shown in Figure 1. Under an application of electrostatic charges in air, the nano-protrusion will repel each other to produce a strain of 0.08 %. A deflection of 1.5 mm for an 8-mm film was achieved [1]. 301

329 The second bilayered actuator possesses an array of nickel nanotubes sitting on a solid nickel layer as shown in Figure 2. Under an electrical potential, the redox reactions in an alkaline electrolyte can create a strain of ~ % on the nanotubes. The resultant deflection of a 15-mm film can also reach 1.5 mm. These two actuators demonstrate the importance of a high surface area-to-volume ratio to the strain. Also, new insights were brought into the actuation of metals, which were mainly achieved by nonfaradaic reactions [2]. References 1. K. Kwan, P. Gao, C. Martin, and A. Ngan, Applied Physics Letters, 106, (2015). 2. J. Weissmüller, R. N. Viswanath, D. Kramer, P. Zimmer, R. Würschum, and H. Gleiter, Science, 300, 312 (2003). 302

330 (Room 109) 23 June 2016, 12:00-12:15 PM Electrochemical Surface-Enhanced Raman Spectroscopy of detecting Endocrine disruptor chemicals Chin-Fung Su, Bo-Yen Kung, Yen-Hsun Su * Department of Materials Science and Engineering, National Cheng Kung University, Tainan, Taiwan Abstract Surface-Enhanced Raman Spectroscopy(SERS) is a promising sensitive and rapid technique for the detection of chemical- and biological-related molecules. [1] However some molecules such as endocrine disruptor chemicals (EDCs) have low affinity to the metal surfaces, which can not be detected by SERS directly. [2] In this research we will produce surface-modified SERS substrate only by electrochemical methods (as can be seen in Fig.1). Electrochemical methods have advantages such as fast, green, and easy control. In addition, electrografting is used for modification to enhance affinity between the nanostructure surfaces and EDCs. (as can be seen in Fig.2). Bisphenol A is a kind of EDCs. In terms of this aspect, Bisphenol A SERS signals are achieved to be determined and enhanced. This technology has the potential application as EDCs sensors in the near future. Fig1. SEM images of SERS substrates produced by Electrochemical deposition(a)gold nanoparticles nucleation(b)gold nanoparticles growth Fig2. Modification on SERS substrates to enhance affinity between gold nanoparticles and Bisphenol A References 1. Shyh-Chyang Luo, Kundan Sivashanmugan, Jiunn-Der Liao, Chih-Kai Yao, Han-Chi Peng, Biosensors and Bioelectronics 61(2014) 2. K.-H. Yang, Y.-C. Liu, C.-C. Yu, Langmuir 26(2010) 303

331 (Room 109) 23 June 2016, 12:15-12:30 PM Exfoliation of MoS2 via Sonication and Examination of MoS2 Nanosheets C. W. Chang 1, M. H. Hon 2, I. C. Leu 3, * 1 Department of Materials Science and Engineering, National Cheng Kung University, Tainan 70101, Taiwan 2 Research Center for Energy Technology and Strategy, National Cheng Kung University, Tainan 70101, Taiwan 3 Department of Materials Science, National University of Tainan, Tainan 70005, Taiwan Abstract We use a simple, green approach to exfoliate layered material, MoS2, with the assistance of sonication. Low boiling point solvents and ionic chemicals were added to exfoliate and were removed easily after fabrication process. This is a green route to fabricate MoS2 nanosheets. The exfoliation of MoS2 to achieve few-layered sheets were attributed to the intercalation of ionic compounds and the wetting ability of low boiling point solvents. The morphology of fewlayered MoS2 sheets was investigated by optical microscopy and transmission electron microscopy. The optical properties of as-prepared sheets were examined by UV-visible spectroscopy and photoluminescence spectroscopy. 0.5 um 5 1/nm Fig1. (Left) TEM image of MoS 2 nanosheet and (right) Selected-area diffraction pattern (SADP) of MoS 2 nanosheet. 304

332 (Room 109) 23 June 2016, 14:00-14:30 PM New Phosphorescent Materials: Insights from Computational Chemistry Alex Brown 1, I Aguiar 2, G.L.C. de Souza 2, and E. Rivard 1 1 Department of Chemistry, University of Alberta, Edmonton, AB, Canada, T6G 2G2 2 Departamento de Química, Universidade Federal de Mato Grosso, Cuiabá, Mato Grosso, Brazil Abstract There is great interest in designing phosphorescent materials that operate in the solid-state for use in organic light-emitting diode (OLED) technologies. While many compounds display strong emission in solution, they are often non-emissive in the condensed phase. However, the disruption of close intermolecular contacts and restriction of intramolecular motions, can lead to so-called aggregation-induced emission (AIE). Recently, Rivard and co-workers [1,2] prepared a new class of pinacolboronate (BPin)-capped tellurophenes that do not emit in solution but exhibit efficient phosphorescence in the solid state (AIE), see Figure 1. Importantly, the emission in the solid state occurs under ambient condtions, i.e., at room temperature and in the presence of water and oxygen. They have also demonstrated that variation of the emission color is possible through molecular design [2]. In this talk, I will discuss our ongoing complementary computational studies on these phosphorescent tellurophene-compounds [1,2]. I will demonstrate how new insight into the underlying photophysics can be obtained using time-dependent density functional theory (TD-DFT). Fig1. Emission characteristics of tellurophene compounds in solution, solid-state, and thin film under ambient conditions. References 1. G.He, W.Torres Delgado, D.J.Schatz, C.Merten, A.Mohammadpour, L.Mayr, M.J. Ferguson, R. McDonald, A. Brown, K. Shankar and E. Rivard, Angew. Chem. Int. Ed. 53, (2014). 2. G. He, B. D. Wiltshire, P. Choi, A. Savin, S. Sun, A. Mohammadpour, M. J. Ferguson, R. McDonald, S. Farsinezhad, A. Brown, K. Shankar and E. Rivard, Chem. Comm. 51, (2015) 305

333 (Room 109) 23 June 2016, 14:30-15:00 PM Transition States: The Geometry of Reaction Dynamics Charles Jaffé Department of Chemistry, West Virginia University, Morgantown, WV, USA Abstract In the early 1970's significant progress was made in the understanding of the geometry underlying the theory of chemical reactions. Central to this work was variational transition state theory. The basic idea was to examine the set of all possible transition states and to identify the one with the minimum flux across it. Phil Pechukas observed that for systems with two degrees of freedom the solution is provided by periodic orbits which touch both equipotentials dividing coordinate space into product and reactant regions. The extension of these ideas to systems with three or more degrees of freedom has been very problematical. In retrospect, the difficulty encountered was the focus on partitioning coordinate space into reactant and product regions, when in reality the question of interest was the partitioning of phase space (the space of all states). Jaffé et al [1] addressed this issue in their study of the chaotic ionization of hydrogen in crossed electromagnetic field. They demonstrated, for the first time, how to construct a transition state in phase space. In a subsequent study [2] they demonstrated the existence of phase space transition states in celestial mechanics where they control the rate of transport of small masses. Since the theory was reformulated in the phase space, progress has been rapid. This reformulation was placed on a firm mathematical foundation by Uzer et al [3]. The central geometrical object is a stationary point in phase space. It must be stable in all but one degrees of freedom and consequently it has the topology of a saddle. Associated with this saddle are a number of invariant manifolds which are central to the theory of reaction dynamics. An exposition of these objects and the role they play in determining the rate of chemical reactions (and the rate of transport of small bodies in the solar system) is the central theme of this talk. Today a sizable number of groups are working on this and related problems. The central theme of these efforts is to understand the geometry of phase space various different situations and the consequences for transport in phase space. References 1. Transition States in Atomic Physics, Charles Jaffé, David Farrelly, and T. Uzer, Phys. Rev. A 60, 3833 (1999). 2. Statistical Theory of Asteroid Escape Rates, Charles Jaffé, Shane D. Ross, Martin W. Lo, Jerrold Marsden, David Farrelly and T. Uzer, Phys. Rev. Lett. 89, (2002). 3. The Geometry of Reaction Dynamics, T. Uzer, Charles Jaffé, Jesús Palacián, Patricia Yanguas and Stephen Wiggins, Nonlinearity 15, 957 (2002), Impenetrable Barriers in Phase Space, S. Wiggins, L. Wiesenfeld, C. Jaffé and T. Uzer, Phys. Rev. Lett. 86, 5478 (2001), A New Look at the Transition State: Wigner's Dynamical Perspective Revisited, Charles Jaffé, Shinnosuke Kawai, Jesús Palacián, Patricia Yanguas and T. Uzer, Adv. Chem. Phys. 130A, (2005). 4. Transition state theory near higher-rank saddles in phase space, George Haller, T. Uzer, Jesús Palacián, Patricia Yanguas and Charles Jaffé, Nonlinearity (2011). 306

334 (Room 109) 23 June 2016, 15:00-15:30 PM Precise Structure Analysis of Materials for Energy and Environment Masatomo Yashima, Kotaro Fujii, Eiki Niwa, Masahiro Shiraiwa, Keisuke Hibino Department of Chemistry, Tokyo Institute of Technology, Tokyo, Japan Abstract In this invited talk, we review our recent works on (1) the visualization of diffusional pathway of mobile ions in some ionic conductors and oxide-ion-electronic mixed conductors and (2) new material exploration. Our group has developed new high-temperature neutron and highresolution synchrotron diffraction techniques to study the precise crystal structures, nuclear and electron density in inorganic materials up to 1900 K. Bond valence method is useful to examine the ion diffusion paths. These techniques enabled precise structure analysis leading to diffusion path and structural disorder in ionic conductors. Here we present the diffusion path of oxide ions in Bi 2O 3, Bi 1.4Yb 0.6O 3, (La 0.8Sr 0.2) (Ga 0.8Mg 0.15Co 0.05)O 3-, CeO 2, Ce 0.93Y 0.07O 1.96, PrBaCo 2O 5+δ (Fig. 1a) [1], (Pr 0.9La 0.1) 2(Ni 0.74Cu 0.21Ga 0.05)O 4+δ (Fig. 1b) [2,3], Pr 2(Ni 0.75Cu 0.25) 0.95Ga 0.05)O 4+δ [4], and La 0.64(Ti 0.92Nb 0.08)O 3 at high temperatures. Fig1. Oxide-ion diffusional pathways in (a) PrBaCo 2O 5+δ and (b) (Pr 0.9La 0.1) 2(Ni 0.74Cu 0.21Ga 0.05)O 4+δ. References 1. Y.-C. Chen, M. Yashima, J. Peña-Martínez and J. A. Kilner, Chem. Mater. 25, 2638 (2013). 2. M. Yashima, M. Enoki, T. Wakita, R. Ali, Y. Matsushita, F. Izumi, T. Ishihara, J. Am. Chem. Soc. 130, 2762 (2008). 3. M. Yashima, N. Sirikanda, T. Ishihara, J. Am. Chem. Soc. 132, 2385 (2010). 4. M. Yashima, H. Yamada, S. Nuansaeng, T. Ishihara, Chem. Mater. 24, 4100 (2012). 307

335 (Room 109) 23 June 2016, 16:00-16:30 PM Microporous polymers for CO2 capture and heterogeneous catalysis Niklas Hedin, Chao Xu Department of Materials and Environmental Chemistry, Berzelii Center EXSELENT on Porous Materials, Stockholm University, SE , Stockholm, Sweden Abstract The effects of climate change urgently require reduced emissions of greenhouse gases to the atmosphere, and Carbon Capture and Storage (CCS) can be interface with the current energy system and offer to reduce such emissions. One of the main obstacles of CCS is the high costs of the current technologies to capture CO 2. Hence, alternative technologies are researched to separate CO 2 from N 2-rich flue gas. Technologies using adsorption-based or membrane separation have the potential to reduce the cost for CO 2 capture, and it is within this context we research micro- and mesoporous polymers. [1] These porous polymers are relative new and have potential applications as adsorbents, or membranes for gas separation and as substrates for catalysis. Their organic building blocks are covalently linked and the porosity forms either by in-between the monomers in highly crosslinked structures or in the free volume of the polymers, which is especially large for monomers with kinks and induced asymmetries. They can exhibit large or even very large specific surface areas and micropore or mesopore volumes. In this context, micropores denote pores that are < 2 nm, while mesopores denote pores in the domain of 2-50 nm. We have researched a range of different MOPs for CO 2-over-N 2 separation using either physisorption [2] or chemisorption [3]. Here, we highlight the possibilities to tune the microporosity and mesoporosity with chemical methods and presents means to modify the polymers with amines that capture CO 2 chemically. Chemisorbents with high heat of sorption of CO 2 (Qst) are relevant for capturing CO 2 from streams with low concentrations of CO 2. Physisorbents with their comparably lower Qst are more relevant to separation when the gas mixture has a higher concentration of CO 2. Open questions concerning the price of the polymers and potential advantages as compared with other adsorbents or membranes will be discussed. Tentative figure of merits for adsorbents for postcombustion capture of CO 2 will be presented. References 1. C. Xu and N. Hedin, Materials Today 17, 397 (2014) 2. C. Xu and N. Hedin, Microporous Mesoporous Mater 222, 80 (2016) 3. C. Xu and N. Hedin, J Mater Chem 3, (2015) 308

336 (Room 109) 23 June 2016, 16:30-16:45 PM Preparation of UV cured long fiber reinforced polymer films and Study on its laminate properties Qin Yan, Bian Yuwei, Tai Chen, Huang Zhixiong Department of Materials Science and Engeering, Wuhan University of Technology,Wuha, Hubei Provence,China. Abstract 3D printing is a kind of rapid prototyping technology, which has aroused wide attention of the society especially about the 3D printing of polymer material such as photopolymers. However, there are some disadvantages about the polymer material. For example, the bending and impact strength is not enough. In this thesis, based on the additive manufacturing of fiber-reinforced polymer, the idea of long fiber reinforced polymer film layer by layer stacking is proposed. Putting the long glass fiber, thickener, TPO and184 photo initiators into the epoxy acrylate to make a piece of fiber reinforced polymer film that can be UV cured. The films of different shape were prepared by laser cutting, and the 3D products with long glass fiber were obtained by layer stacking and UV curing. The effects of the amount of the initiator on the curing time, the effects of fiber length and content on the bending and impact strength of the samples and The effects of stacking forms on the interface bonding of samples were studied. It is shown: suitable photo initiator and concentration can make the fiber-resin UV cured; bending strength of samples is more than 80MPa after adding 20%25mm glass fiber and the impact resistance has been significantly improved compared with the pure resin system, but the inter-laminar shear strength need to be strengthened. References 1. Shin JH, Lee SH, Byeon KJ, Han.KS, Lee H, Tsunozaki K, Fabrication of flexible UV nanoimprint mold with fluorinated polymer-coated PET film[j], Nanoscale Research Letters,2011, (6) 2. llhwan Ryu, Dajung hong, Sanggyu Yim, Effiective surface oxidation of polymer replica molds for nanoimprint lithography, Nanoscale Research Letters, Wohlers T. Make fiction fact fast. Manufacturing Engineering. 1991, 106(3): 44~ Zhao Peizhong,Wei Huakai,Dai Jingtao,Huang Xuren, Hu Fangyou.Study on carbon fiber reinforced resin matrix composites cured by UV radiation[j]. Engineering Plastics Application.2015,9: P Zhong Weihong, Li fan, Zhang Zuoguang, Li Zhimin.Basic research of the short fiber reinforced composite for RPM[J]. Acta Materiae Compositae Sinica.2000, 17 (04) 6. Cheng yuan, Xie wei. High performance UV curing composite and nano composite materia[j]. Reinforced Plastic.2007 (04): Xu yan. He Deliang, Zeng Lingsan.Development of ultraviolet curing coating and its application. Electroplating & Finishing.2000 (1):

337 8. Zhou Wenxiu, Han ming, Huang Shuhuai, Xie Hongquan.Analysis of LOM materials. [J] Materials Review.2002 (03) 9. Zhang Heng, Xu Lei, Hu Zhenhua.Research progress of photosensitive resin for UVcurable 3D printing. China Synthetic Resin and Plastics.2015,32 (4): Liu Tian, Hu Xiaoling, Fang Gan, Yu Jie, Guo Wenyong, You Qingliang. Preparation and Performance Testing of 3D Printing Photo-Curable Resin[J].2014,42 (10) 310

338 (Room 110) 23 June 2016, 09:30-10:00 AM Self-organized nanostructure formation of III-V and grope IV semiconductors by using bismuth Hiroshi Okamoto Graduate School of Science and Technology, Hirosaki University, Hirosaki, Aomori , Japan Abstract Semiconductor nanostructures such as quantum dots (QDs) are expected for various applications, e. g. a laser diode with a temperature-stable operation, [1] a single-photon source in quantum-cryptography system, [2] a solar cell with an ultrahigh conversion efficiency, [3] and a memory device with high reliability. [4] From the perspective of their fabrication, phenomena of self-organized nanostructure formation, such as Stranski-Krastanov (SK) growth or other surface interaction of materials have been utilized for that. We also have reported a novel growth method for In(Ga)As QDs using bismuth (Bi) as a surfactant. The beginning of using Bi for this purpose was as follows. In 1997, we studied Bi containing III-V semiconductor materials such as GaAsBi and InAsBi with the aim of developing new semiconductor materials which have temperature-insensitive energy gap. [5-8] In this period, the author found out following phenomena; Bi incorporation into InAs was occurred in the restricted growthtemperature range at around 365 C, and above this temperature, Bi incorporation would not occur and 3D growth of InAs was tend to be occurred. The later fact means Bi might be an ideal surfactant for the self-organized 3D nanostructure formation. Some time after that, we have successfully grown In(Ga)As QDs using Bi as a surfactant. [9] By utilizing the superior optical quality of the QDs, we have reported fine structure and magneto-optics states in single InAs QDs, [10, 11] single-photon emission from a QD in a microcavity structure, [12] the cavitymode emission of QDs in a photonic-crystal-cavity structure, [13, 14] and tunable slow-light characteristics using a waveguide structure with the QDs. [15] In this report, the study of the self-organized In(Ga)As QDs is reviewed, and resent results for grope IV semiconductornanostructure formation are shown. In both cases, Bi was used for the formation processes. In(Ga)As QDs were grown by vapor phase epitaxy on (100) GaAs substrates. Trimethylbismuth (TMBi) was used for the Bi precursor. [9] The effect of supplying TMBi during the QD growth was examined by photoluminescence (PL) measurement and atomic-force-microscopy (AFM). The results are shown in Figs. 1 and 2, respectively. In these figures, characteristics of the samples grown with and without supplying TMBi (w/ Bi, and w/o Bi) are compared. The PL intensity and peak wavelength for the w/ Bi sample were much stronger and longer than those of w/o Bi sample. In addition, the QD sizes of the w/ Bi sample observed by AFM were more uniform than those of w/o Bi sample. The peak wavelength of the PL spectra indicate that the QDs grown with Bi are suitable for telecommunication devices. It was also found that the longer PL wavelength could be obtained by increasing the covering layer thickness for the QDs, [5] and that a phenomenon of ripening during the QD-growth sequence contributed to improve the QD uniformity (not shown in Figs.). [16] To examine the incorporation of Bi into the QDs, secondary ion mass spectroscopy (SIMS) analysis was performed. By considering the detection limit of the SIMS apparatus, the Bi concentration in this sample was estimated to be less than /cm 3 in the QD layer. This result means that the above-mentioned PL-peak redshift was not due to the energy-gap reduction caused by Bi incorporation but due to the surfactant effect of Bi. Ge nanostructures were formed by resistive-heating (RH) and electron-beam (EB) evaporator on SiO 2 substrates. Here, Bi layers were deposited by the RH evaporation prior to the Ge deposition by the EB evaporation. Figures 3, 4, and 5 show the dependences of deposition 311

339 temperature, Bi thickness, and Ge thickness on the structures, respectively. AFM scanning areas were 0.5 x 1.0 µm 2. Dot-like structures were formed as low as 110 C by using Bi (Fig. 3). From the results shown in Figs. 4 and 5, it was found that the nanostructure formation was not directory related to the Bi thickness or Ge thickness but related to the combination of their settings. This means the nanostructure formation may not be caused by the surfactant effect but other interaction mechanisms at the surface. Further study is needed to reveal the mechanism. In summary, effects of Bi on self-organized nanostructure formation were surveyed. Bi was act as a surfactant to form In(Ga)As QDs, while other effect might cause the formation of Ge nanostructures in a low temperature range. In any case, Bi is an attractive material to form selforganized nanostructures. PL intensity (arb. units) w/ Bi w/o Bi Wavelength (nm) Fig1. PL spectra of the In(GaAs) QD samples. (a) w/o Bi (b)w/ Bi Fig2. AFM images of the In(GaAs) QD samples. (a) Bi: 0.5 nm, Ge:1.2 nm (b) Bi: 0.5 nm, Ge:1.2 nm (c) Bi: 0.5 nm, Ge:1.2 nm (d) Bi: 0.5 nm, Ge:1.2 nm 110 C 130 C 150 C 170 C Fig3. AFM images of the Ge-nanostructure samples: temperature dependence. (a) Bi: 0.1 nm (b) Bi: 0.2 nm (c) Bi: 0.5 nm Ge:1.2 nm Ge:1.2 nm Ge:1.2 nm 130 C 130 C 130 C Fig4. AFM images of the Ge-nanostructure samples: Bi-thickness dependence. 312

340 (a) Bi: 0.2 nm (b) Bi: 0.2 nm Ge:0.6 nm Ge:1.2 nm 130 C 130 C Fig5. AFM images of the Ge-nanostructure samples: Ge-thickness dependence. Acknowledgements This work was partially supported by JSPS KAKENHI Grant Number References 1. M. V. Maximov, N. N. Ledentsov, V. M. Ustinov, Zh. I. Alferov, and D. Bimberg, J. Electron. Mater. 29, 476 (2000). 2. E. Moreau, I. Robert, J. M. Gérard, I. Abram, L. Manin, and V. Thierry-Mieg, Appl. Phys. Lett. 79, 2865 (2001). 3. A. Luque and A. Marti, Phys. Rev. Lett. 78, 5014 (1997). 4. S. Tiwari, F. Rana, H. Hanafi, A. Hartstein, E. F. Crabbe,.and K. Chan, Appl. Phys. Lett. 68, 1377 (1996). 5. K. Oe and H. Asai, IEICE Trans. Electron., E79-C, 1751 (1996). 6. K. Oe, H. Okamoto, 10th Int. Conf. Indium Phosphide and Related Materials (IPRM98), PD pp. 5-6, (Tukuba, Japan May 1998). 7. H. Okamoto and K. Oe, Jpn. J. Appl. Phys. 37, 1608 (1998). 8. H. Okamoto and K. Oe, Jpn. J. Appl. Phys. 38, 2B, 1022 (1999). 9. H. Okamoto, T. Tawara, H. Gotoh, H. Kamada, and T. Sogawa, Jpn. J. Appl. Phys. 49, 06GJ01 (2010). 10. N. I. Cade, H. Gotoh, H. Kamada, H. Tawara, T. Sogawa, H. Nakano, and H. Okamoto, Appl. Phys. Lett (2005). 11. N. I. Cade, H. Gotoh, H. Kamada, H. Nakano, and H. Okamoto, Phys. Rev. B, 73, , (2006). 12. T. Yamaguchi, T. Tawara, H. Kamada, H. Gotoh, H. Okamoto, H. Nakano, and O. Mikami, Appl. Phys. Lett. 92, (2008). 13. T. Tawara, H. Kamada, S. Hughes, H. Okamoto, M. Notomi, and T. Sogawa, Opt. Express 17, 6643 (2009). 14. T. Tawara, H. Kamada, T. Tanabe, T. Sogawa, H. Okamoto, P. Yao, P. K. Pathak, and S. Hughes, Opt. Express 18, 2719 (2010). 15. H. Gotoh, S. W. Chang, S. L. Chuang, H. Okamoto, and Y. Shibata, Jpn. J. Appl. Phys. 46, 2369 (2007). 16. H. Okamoto, T. Tawara, K. Tateno, H. Gotoh, H. Kamada, and T. Sogawa, Jpn. J. Appl. Phys. 50, 06GH07 (2011). 313

341 (Room 110) 23 June 2016, 10:00-10:30 AM Si twinning superlattices on atomically flat mesas: Epitaxial growth and electrical characterization Andreas Fissel 1, Jan Krügener 1, Philipp Gribisch 1, Sofia Herbers 1, Ayan Roy Chaudhuri 1,2 1 Institute of Electronic Materials and Devices, Leibniz University Hannover, Hannover, Germany 2 present address: Materials Science Centre, Indian Institute of Technology Kharagpur, Kharagpur, West Bengal, India Abstract In recent years, new types of heterostructures consisting of only one material constituent in different crystal structures, such as wurtzite/zinc-blende or lonsdaleite/diamond heterostructures, are under discussion, where problems due to different chemical constituents can be avoided [1-3]. In such case, the heterostructure interfaces are inherently defect-free, lattice-matched, and coherent. Several materials can occur in different crystal structures, a property which is called polymorphism, among them such semiconductors as II VI compounds, group III-nitrides or SiC, where the arrangement of lattice planes changes only in one direction (polytypism), [3-6] that is here the [1 1 1]-or [0 0 01]-direction. Heterostructures of polytypes (heteropolytypic structures) or at least structures with periodically modified crystal structure are also under discussion for the most common semiconductor, namely silicon [7-9]. The use of such structure should have some advantages, such as absence of alloy scattering, interface broadening by interdiffusion and strain-induced defects, combined with properties that can otherwise only be achieved by incorporating SiGe or SiGeC into Si technology. It offers, therefore, the potential of increased flexibility in the design of future Si-based electronic devices or can increase the efficiency of Si solar cells. The growth of closed-packed non-cubic Si, however, is still challenging and demands an atomicscale modification of the growth process or other sophisticated techniques, mostly associated with the growth of nanowires. [10-18] Fig1. Cross-sectional high-resolution transmission electron microscopy images of Si twinningsuperlattice on Si (111) with sixfold (left) and eightfold (right) periodicity. In the first part of our presentation, a suitable growth procedure for the periodically incorporation of coherent twin boundaries with defined distance into the Si lattice perpendicular to the [111] direction will be described. In such a way structures with twin boundary configuration with different periodicity (socalled twinning superlattices) are prepared (Fig.1). The procedure is based on the observation, that Si growth on Si(111) surfaces covered by a certain amount of boron results in a change of Si layer orientation. [19,20] However, it was 314

342 found that steps at the surface results in a strong restriction of homogeneous superlattice regions. The presence of steps results in the formation of incoherent twin boundaries during the growth of twinning superlattices, what prevents the formation of a regular superlattice structure across larger areas. The problem could only be overcome by growth of the superlattice on step-free surfaces. It is impossible, however, to prepare atomically flat substrates. In the second part of the talk we will show a suitable method for preparation of atomically flat surfaces on desired location and with dimensions suitable for devices application (up to 10 µm x 10 µm, see Fig. 2). [25,26] Fig. 2. (left) Atomic force image of 10 µm x 10 µm atomically flat mesa on Si (111), and (right) scanning electron microscopic image (diameter: 1mm) of mesas with Al-constants for electrical characterization. In the last part of the talk we will present the first results for electrical characterization of the twinning superlattices grown on atomically flat mesas using capacitance-voltage (C-V) and temperature-dependent current-voltage (I-V) measurements. Since the twinning superlattices were prepared on Boron-covered Si (111) the grown layers are highly p-type doped in the range of cm -3 (p ++ ). Therefore, two different structures are investigated: superlattice on n-type Si (111) substrate, corresponding to a p ++ -n-junction, and on p + -type Si (111) (boron doped, cm -3 ), corresponding to a p ++ -p + -junction. C-V investigations on p ++ -n-diodes clearly indicate the presence of one-sided abrupt junction. In earlier investigation using ultraviolet photo-electron spectroscopy the formation of p-n-junction was already suggested. [23] The I- V characteristics reveal rectifying properties similar to those of conventional p-n-junctions. In temperature-dependent I-V measurements of p ++ -n-diodes a change in the carrier transport mechanism is observed in the range of 170 K. I-V-measurements of p ++ -p + -junctions show clearly ohmic behaviour, whereas in C-V-measurements an unusual behaviour is observed. Acknowledgements This work was supported by the Deutsche Forschungsgemeinschaft (DFG project FI ). References 1. M. Murayama and T. Nakayama, Phys. Rev. B 49, 4710 (1994). 2. F. Bechstedt and P. Käckell, Phys. Rev. Lett. 75, 2180 (1995). 3. Fissel, Physics Reports 379, 149 (2003). 4. R.E. Algra et al., Nature 256, 369 (2008). 5. F.C. Ross, Nature Nanotechnology 4, 17 (2009). 6. Ph. Caroff et al., IEEE Journal of selected Topics in Quantum Electron. 17, 829 (2011). 7. M. Murayama and T. Nakayama, J. Phys. Soc. Jap. 61, 2419 (1992). 8. Z. Ikonic et al., Phys. Rev. B 48, (1993). 9. C. Raffy et al., Phys. Rev. B 66, (2002). 315

343 10. Funtcurberta i Morral et al., Adv. Mat. 19, 1337 (2007). 11. J. Arbiol et al., J. Appl. Phys. 104, (2008). 12. F.J. Lopez et al., Nano Lett. 9, 2774 (2009). 13. R.E. Algra et al., Nano Lett. 11, 1690 (2011). 14. Erin L. Wood and F. Sansoz, Nanoscale 4, 5268 (2012). 15. F. Fabbri et al., Scientific Reports 4, 1 (2013). 16. H. I. T. Hauge et al., Nano Letters 15, 5855 (2015). 17. Y. Qiu et al., Scientific Reports 5, 1 (2015). 18. M. A. Khan et al., Jap. J. Appl. Phys. 55, (2016) 01AE H. Hibino and T. Ogino, Mater. Sci. Eng. B 87, 214 (2001). 20. Fissel et al., J. Cryst. Growth 290, 392 (2006). 21. J. Krügener et al., Surf. Sci. 618, 27 (2013). 22. Roy Chaudhuri et al., J. Appl. Phys. 118, (2015). 23. J. Krügener et al., Phys. Rev. B 83, (2011). 316

344 (Room 110) 23 June 2016, 11:00-11:30 AM Impedance spectroscopic study on metal-manganite interfaces exhibiting resistance switching Toshihiro Nakamura Department of Engineering Science, Osaka Electro-Communication University, Neyagawa, Osaka, Japan. Abstract Recently, a large resistance change by the application of an electric pulse was observed at room temperature in manganites such as Pr 1-xCa xmno 3 (PCMO). This effect provides a possibility of a next-generation nonvolatile memory, called resistance random access memory (ReRAM). The comprehensive understanding for the origin of the resistance switching is required to meet the requirement for the next-generation nonvolatile memory application. Although there have been various proposed models of the resistance switching mechanism, the precise identity of the switching location where resistance change mainly occurs has not been revealed. Impedance spectroscopy is a useful technique for characterizing the resistance switching, which indicates whether the overall resistance of the device is dominated by bulk, grain boundary, or interface component. In this work, the resistance switching mechanism in the PCMO-based devices was investigated by impedance spectroscopy. We prepared layered structures composed of PCMO sandwiched between Pt bottom electrode and top metal electrodes (metal/pcmo/pt devices). The I-V characteristics of the PCMO-based devices were studied by dc voltage sweep measurements to evaluate the memory effects. Bipolar resistance switching between the high and low resistance states was observed by applying electric pulses to the devices through the electrodes. The resistance change was dependent not only on the crystallinity and Ca/(Pr+Ca) composition ratio of the PCMO films but also on the standard Gibbs free energy of the formation of metal oxides and the work function of electrode metal materials. By comparing the impedance spectra in the high and low resistance states, we propose that the resistance switching in the PCMO-based devices was mainly due to the resistance change in the interface between the film and the electrode. According to the theoretical simulation of impedance spectra, the interface component observed by impedance spectroscopy in the Al/PCMO/Pt device might be due to Al oxide layer formed by oxidation of Al top electrode [1]. The interfacial layer of Al oxides is possibly responsible for the large resistance change in the Al/PCMO/Pt device. Large resistance switching ratio is expected by choosing a metal with lower oxidation Gibbs free energy as an electrode material and using the interface resistance component due to metal oxide layer in the PCMO-based devices. Although the contribution of the film impedance to the overall impedance of the device is small than that of the interface impedance, the crystallinity and atomic composition of the PCMO film has a great influence on the reduction of the pulse voltage required for the stable resistance switching. Reference 1. T. Nakamura, K. Homma, and K. Tachibana, Nanoscale Res. Lett. 8, 76 (2013). 317

345 (Room 110) 23 June 2016, 11:30-12:00 AM Conductivity Control of Sn-Doped Coruncum-Structured Ga 2O 3 Films on Sapphire Kazuaki Akaiwa 1,2, Kentro Kaneko 2, Kunio Ichino 1, and Shizuo Fujita 2 1 Department of Information and Electronics, Tottori University, Tottori, Japan 2 Department of Electronic Science and Engineering, Kyoto University, Kyoto, Japan Abstract Gallium oxide (Ga 2O 3) is a promising semiconductor material for high-power device applications owing to its large band gap energy around 5.0 ev. We reported the fabrication of highly crystalline corundum-structured Ga 2O 3 ( -Ga 2O 3) thin films on sapphire substrates by novel mist chemical vapor deposition (mist-cvd) technique [1]. This -Ga 2O 3 on sapphire is advantageous platform for inexpensive device fabrication due to the use of low cost sapphire substrate. Besides, it is easy to conduct the band gap engineering by making alloys with the same corundum structured oxides such as -Al 2O 3 and -In 2O 3. Undoped -Ga 2O 3 films on sapphire substrates showed insulator-like electrical properties. Therefore, for the device application of -Ga 2O 3, conductivity control of -Ga 2O 3 is an important issue. In this presentation, we show the successful fabrication of conductive Sn-doped -Ga 2O 3 films and the detailed electrical properties of them. As a growth method, we used mist-cvd method. Gallium(III) acetylacetonate and tin(ii) cholorides dyhydrates were used as gallium and tin precursors, respectively. As a reaction source, we used water solution of these precursors with addition of hydrocholoric acid. Nitrogen gas was used as a carrier gas. Substrate temperature was set at 500 o C. Fig. 1 shows (a) carrier densities and (b) mobilities of Sn-doped -Ga 2O 3 films as a function of the film thichnesses and Sn/Ga concentration ratios in the source. Carrier densities of films were successfully controlled in the range from cm -3 to cm -3 by changing the Sn/Ga concentration ratio in source. Besides, for the same Sn/Ga precursor ratio, Sn-doped -Ga 2O 3 films showed almost the same carrier concentrations irrespective of the film thicknesses, suggesting uniform dispersion of Sn atoms along the depth directions. However, carrier density control under than cm -3 was not realized because the films rapidly became highly resistive if the Sn/Ga ratio in source got lower. It is reported that -Ga 2O 3 films on sapphire substrates contain misfit dislocations with the density around cm -2 due to the lattice mismatch with several percentages between -Ga 2O 3 film and sapphire substrate [2]. Therefore, conductivity control in low carrier density region is difficult because of strong carrier compensation by electron traps originated from dislocations in -Ga 2O 3 films. In order to achieve conductivity control in - Ga 2O 3 films at the lower carrier concentration, improvement of crystal quality is an essential task. As a next step, in order to enhance the crystal quality, we tried to fabricate the -Ga 2O 3 films on annealed Sn-doped -Ga 2O 3 buffer layers. Fig. 2 shows schematic structure illustration of the -Ga 2O 3 films on annealed buffer layers. First, we fabricated highly Sn-doped -Ga 2O 3 layers on sapphire substrates, which showed higher crystallinity compared with undoped or lower Sn-doped -Ga 2O 3 films. The highly Sn-doped -Ga 2O 3 layers were post-annealed at 450 o C during 24 hours. The annealing treatment makes the layers highly resistive because of the Sn-atom gettering into the dislocation in the films. Then, we fabricated Sn-doped -Ga 2O 3 films with different Sn-doping concentrations. With this structure, we can evaluate the electrical properties of upper Sn-doped -Ga 2O 3 films. The Sn-doped -Ga 2O 3 films grown on annealed buffer layers (let us name the anneled layer as annealed buffer layer ) showed higher 318

346 crystallinity compared with the films directly grown on sapphire substrates. Fig. 3 shows the carrier densities of Sn-doped -Ga 2O 3 films on annealed buffer layers as a function of the Sn/Ga concentration ratios in source. By the insertion of annealed buffer layer, the carrier density was successfully controlled in the range from cm -3 to cm -3, achieving the control in the range under cm -3. The carrier density was almost proportionally decreased with the decrease of the Sn/Ga concentration ratio. However, in the range under cm -3, the change of carrier density dropped down from the linear extraporation, suggesting the influence of carrier compensation by crystal defects. Therefore, for achieving more controllability of carrier concentration, further enhancement of the crystal quality is necessary. We plan to discuss the more detailed electrical properties of Sn-doped -Ga 2O 3 films grown on annealed buffer layers and the results of the optical characterization of them. Fig.1 (a) carrier densities and (b) mobilities of Sn-doped -Ga 2O 3 films as a function of film thichnesses and Sn/Ga concentration ratios in source Sn-dope Ga2O3 (~ 600 nm) Annealed Sn-Ga2O3 (~ 600 nm, insulated) sapphire substrates -Ga2O3 films on annealed buffer layers 319

347 Carrier density [cm -3 ] Sn/Ga concentration ratio in source [%] Fig3. carrier densities of Sn-doped -Ga 2O 3 films on annealed buffer layers as a function of Sn/Ga concentration ratios in source References 1. D. Shinohara and S. Fujita, Japanese Journal of Applied Physics 47, 7311 (2008). 2. K. Kaneko, H. Kawanowa, H. Ito and S. Fujita, Japanese Journal of Applied Physics 51, (2012). 320

348 (Room 110) 23 June 2016, 12:00-12:30 PM Novel Oxide-Ion Conductors based on a New Structure Family NdBaInO 4 Masatomo Yashima, Kotaro Fujii, Eiki Niwa, Masahiro Shiraiwa, Keisuke Hibino Department of Chemistry, Tokyo Institute of Technology, Tokyo, Japan Abstract In this invited talk, we report a novel oxide-ion conductor NdBaInO 4. NdBaInO 4 has been synthesized by solid-state reactions and its crystal structure has been determined by synchrotron X-ray and neutron powder diffraction and ab initio electronic calculations [1]. Rietveld analysis of neutron powder diffraction data taken at 24 o C indicated the space group of P2 1/c and unitcell parameters of a = (3) Å, b = (2) Å, c = (2) Å, = (3), V = (1) Å 3 (R wp = 4.17%, R p = 3.59%, R B = 4.41% and R F = 2.10%). The structure consists of La 2O 3-type Nd 2O 3 and (Nd, Ba) InO 3 perovskite units giving a new perovskite-related structure family. Electrical conductivity measurements showed oxide-ion conduction in this material. The bond valence sums (BVS) map of NdBaInO 4 at 1000 C strongly suggests twodimensional network of oxide-ion diffusional pathways in the Nd 2O 3 unit (Fig. 1). We have discovered the novel material NdBaInO 4 belonging to a new perovskite-related structure family, and its crystal structure has been determined. NdBaInO 4 exhibits oxide-ion conduction. It was found that the Sr substitution at the Nd site improves the oxide-ion conductivity of NdBaInO 4 [2]. The present finding might open a new window in chemistry, physics and materials science. Fig1. Oxide-ion diffusional pathways in NdBaInO 4. References 1. K. Fujii, Y. Esaki, K. Omoto, M. Yashima, A. Hoshikawa, T. Ishigaki and H. R. Hester, Chem. Mater. 26, 2488 (2014). 2. Fujii, M. Shiraiwa, Y. Esaki, M. Yashima, S. J. Kim and S. Lee, J. Mater. Chem. A 3, (2015). 321

349 (Room 110) 23 June 2016, 14:00-14:30 PM Fabrication of Ultrahigh-Density GaAsSb/InAsSb Quantum Dots and Their Photovoltaic Applications Koichi Yamaguchi, Kohdai Nii, Naoki Akimoto, Katsuyoshi Sakamoto and Yuta Minami Department of Engineering Science, The University of Electro-Communications, Tokyo, JAPAN Abstract Ultrahigh-density quantum dots (QDs) have attracted considerable interests for intermediateband solar cells (IBSCs) with high power conversion efficiency (PCE) [1]. The ultrahigh QD density and high concentrated sunlight are needed to enhance two-step photoexcitation of carriers via intermediate bands. According to theoretical calculations based on a detailed balanced model [2], the QD density of more than cm -2 and 200 suns are requested for achievement of higher PCE beyond 45 %, as shown in Fig.1. Up to now much interest was paid to the growth of closely stacked QD layers to develop the IBSCs. However, in a case of a conventional QD density (about cm -2 ), several hundreds of QD layers must be stacked on the substrates by the epitaxy growth. Therefore, the fabrication of in-plane ultrahigh-density QDs with more than cm -2 is one of important challenges for improvement of IBSCs. In addition, the carrier lifetime in QD states should be increased for enhancement of two-step photoexcitation. A type-ii band alignment is a desirable structure for extension of the carrier lifetime. Recently, we demonstrated in-plane ultrahigh-density InAs QDs with cm -2 by Sbmediated molecular beam epitaxy (MBE) [3,4]. Figure 2 shows an atomic force microscopy (AFM) of ultrahigh-density InAs QDs with cm -2, grown on InAsSb /GaAs (001). The coalescence and ripening of InAs QDs were effectively suppressed, and, as a result, in-plane ultrahigh density was maintained. Furthermore, the ultrahigh-density QD layer was embedded by the GaAsSb capping layer to form a type-ii band structure and to reduce the compressive strain. Fig1. Theoretical power conversion efficiency of IBSCs using GaAsSb/InAs QDs as functions of QD density and sun concentration. Fig2. AFM image of ultrahigh-density InAs QDs on InAsSb/GaAs (001) (QD density: 1 x cm -2 ). 322

350 Photoluminescence (PL) spectra of ultrahigh-density InAs QDs shifted continuously to higher energies with increased optical excitation power. This was attributed to filling of inhomogeneous ground states via tunneling between neighboring QDs. Indirect transitions in the GaAsSb/InAs QDs were observed for small QDs. In large QDs, the coexistence of direct and in-direct transitions were observed at high optical excitation. Figure 3 shows the PL decay time of ultrahigh-density InAs QDs with GaAs and GaAsSb capping layers, which are type-i and type-ii heterostructures respectively. In a case of the GaAsSb cap, a redshift of PL spectrum and a long PL decay time of 5 ns were observed, as compared with those of the GaAs cap sample. Figure 4 shows external quantum efficiencys (EQE) of a type-i cell (GaAs cap) and a type-ii cell (GaAsSb cap), which included one QD layer with an ultrahigh density of 1 x cm -2. EQE of the type-ii cell was enhanced at a long wavelength region from 900 nm to 1200 nm. One of the reasons is a long carrier lifetime due to a type-ii band structure. In this conference, we present the self-formation of in-plane ultrahigh-density InAs QDs and discuss about a superior QD-IBSC structures. Fig3. PL decay time of ultrahigh-density InAs QDs with GaAs and GaAsSb capping layers. Fig4. External quantum efficiency of a type-i QD cell (GaAs cap) and a type-ii QD cell (GaAsSb cap). References 1. A. Luque and A. Marti, Phys. Rev. Lett. 78, 5014 (1997). 2. K. Sakamoto, Y. Kondo, K. Uchida and K. Yamaguchi, J. Appl. Phys. 112, (2012). 3. E. Saputra, J. Ohta, N. Kakuda, and K. Yamaguchi, Appl. Phys. Express 5, (2012). 4. T. Sano, E. Saputra and K. Yamaguchi, The 40th Int. Symposium on Compound Semiconductors (ISCS2013), WeB

351 (Room 110) 23 June 2016, 14:30-14:45 PM Comparison of YPO 4: Tb 3+, Yb 3+ and YVO 4: Tb 3+, Yb 3+ Phosphors as Quantum Cutting by Cooperative Energy Transfer from Visible Light to Near Infrared emission Y. S. Su, T. W. Shen, Y. H. Su * Materials Science and Engineering, National Chang Kuang University, No.1, University Road, Tainan City 701, Taiwan (R.O.C.) Abstract Near infrared quantum cutting by cooperative energy transfer from Tb 3+ to Yb 3+ was investigated by photoluminescence masurements on (Yb xy 0.99 x) PO 4 and also (Yb xy 0.99 x) VO 4 (x= 0, 2, 5 and 10) doped with 1% Tb 3+. We compare their differences in structure, particle morphology and photoluminescence strength. Under the excitation of 473 and 486 nm continuous wave lasers, we found that one Tb 3+ ion absorbed one blue photon with the transition from 5 D 4 to 7 F 5 (λ ~ 544 nm) and cooperatively transfer energy to two Yb 3+ ions, which is followed by the emission of two photons (λ ~ 980 nm). Application of cooperative energy transfer has prospects for increasing the energy efficiency of crystalline Si solar cells by photon doubling of the high energy part of the solar spectrum. References 1. P. Vergeer, * T. J. H. Vlugt, M. H. F. Kox, M. I. den Hertog, J. P. J. M. van der Eerden, and A. Meijerink, Physical Review B 71, (2005) 324

352 (Room 110) 23 June 2016, 14:45-15:00 PM Triangular MoS 2 Transistor Yuan-Liang Zhong 1, Jyun-Hong Chen 1, Lain-Jong Li 2, Chii-Dong Chen 3 1 Department of Physics and Center for Nanotechnology, Chung Yuan Christian University, Chung-Li 32023, Taiwan 2 Physical Sciences and Engineering Division, King Abdullah University of Science and Technology (KAUST), Huwal , Kingdom of Saudi Arabia 3 Institute of Physics, Academia Sinica, Taipei 115, Taiwan Abstract Semiconducting transition-metal dichalcogenides, MoS 2, is a novel material as a channel material of field-effect transistors (FETs). We have synthesized single-crystal MoS 2 by using chemical vapor deposition method and fabricated FET with back and side gates on silicondioxide substrate. Triangular MoS 2 FET was applied by different direct electric fields (in-plane and out plane) for measuring current-voltage curves to study the characteristic of devices and the electron transport mobility. The temperature dependence of mobility follows a μ ~ T -γ with γ = 1.62 and 1.73 for side and back gate at closed to room temperature, above ~170 K. This temperature dependence behavior has been predicted in theory by a model of the intrinsic phonon-limited mobility via dielectric engineering due to the strong suppression of chargedimpurity scattering. Figure 1 shows the triangular MoS 2 for field effect transistor and piezoelectric effect transistor. We have studies piezotronics by an AFM tip as gate with mechanical load [1]. On the other hand, the triangular MoS 2 field effect transistor may also be suitable for developing the valleytronics device by applying different direct electric fields. Fig1. A triangular MoS 2 for (a) field effect transistor or (b) piezoelectric effect transistor. [1] References 1. Junjie Qi, Yann-Wen Lan, Adam Z. Stieg, Jyun-Hong Chen, Yuan-Liang Zhong, Lain-Jong Li, Chii-Dong Chen, Yue Zhang, Kang L. Wang, Nature Communications 6, 7430 (2015) 325

353 (Room 111) 23 June 2016, 09:30-10:00 AM Many-body proximity effects in f-electron superlattices Norio Kawakami, Robert Peters, Masaya Nakagawa Department of Physics, Kyoto University, Kyoto , Japan Abstract Artificially layered rare-earth compound, such as CeIn 3/LaIn 3 and CeCoIn 5/YbCoIn 5 superlattices, have been created recently [1]. We will refer to these materials as f-electron superlattices, since essential physics is governed by f-electrons in rare-earth layers. These superlattice systems are made of a periodic arrangement of f-electron layers and normal-metal layers, and their intriguing properties strongly depend on the number and arrangement of the different layers. Motivated by rapid progress in the experiments, we theoretically study such layered f-electron superlattices, and find that the Kondo proximity effect plays an essential role, leading to a strong dependence of the physical quantities on the superlattice structure [2]; the Kondo effect occurring in different f-electron layers causes the constructive or destructive interference in the normal-metal layers, giving rise to spatially-modulated peak/dip structures in the density of states, which show the strong-temperature dependence characteristic of the Kondo effect. We then apply our results to the recent striking STM experiments for a naturally layered f- electron material, CeCoIn 5, which have revealed the layer-dependent electron correlations experimentally [3]. Remarkably, our simple model explains all the characteristic properties observed experimentally, such as a layer-dependent shape of the resonance at the Fermi energy, displaying a hybridization gap for the Ce-layer and a peak structure for the Co-layer, etc. Our proposal also resolves the unphysical assumptions in the preceding theoretical treatments based on the Kondo cotunneling model. If time allows, we also address a novel Kondo effect induced by laser in optical lattices [4]. This is an extension of f-electron physics to optical lattices. The laser-induced Kondo effect is highly controllable by tuning the laser strength and the frequency, and thus offers another versatile platform to study the Kondo physics. References 1. H. Shishido et al., Science 327, 980 (2010). 2. R. Peters et al., Phys. Rev. B 88, (2013); Phys. Rev. B 89, (R) (2014) 3. P. Aynajian et al., Nature 486, 201 (2012) 4. M. Nakagawa and Norio Kawakami, Phys. Rev. Lett. 115, (2015) 326

354 (Room 111) 23 June 2016, 10:00-10:30 AM Spintronic Sensors, Internet of Things, and Smart Living Philip W. T. Pong, X. Liu, K. H. Lam Department of Electrical and Electronic Engineering, The University of Hong Kong, Pokfulam Road, Hong Kong Abstract The rapid advancement of electronic devices and networking technologies enables the largescale connectivity of sensors in various emerging applications such as manufacturing, power grids, healthcare, building and transportation. This unprecedented expansive network, named Internet of Things (IoT), augmented with sensors can collect and exchange data among various devices and across different networks, creating great opportunity for smart grids, smart homes, intelligent transportation and smart cities. There are already over 3.5 billion sensors out there in applications, and it is estimated that the number of sensors will reach one trillion by 2020 and over 100 trillion past 2030 [1]. Spintronic sensors [2, 3] with superb sensitivity, low power consumption, compactness, wide bandwidth, room-temperature operation and CMOS compatibility can be an important piece of cornerstones for IoT to realize smart living in the 21 st century. In this paper, we will explore the applications of spintronic sensors in energy, healthcare, building, and transportation. The challenges in these four aspects of smar living will be discussed, and the possible solution with spintronic sensors will be presented. Spintronic sensors can have a lot to offer to IoT which in turn make everything in our lives smarter. References 1. Trillion Sensors Summit, Trillion Sensor Roadmap, available on 2. L. Jogschies, D. Klaas, R. Kruppe, J. Rittinger, P. Taptimthong, A. Wienecke, L. Rissing, and M. C. Wurz. Recent Developments of Magnetoresistive Sensors for Industrial Applications. Sensors, 15, (2015) 3. W. Wang, Y. Wang, L. Tu, Y. Feng, T. Klein, and J. Wang. Magnetoresistive Performance and Comparison of Supermagnetic Nanoparticles on Giant Magnetoresistive Sensor-Based Detection System. Scientific Reports, 4, 5716 (2014) 327

355 (Room 111) 20 June 2016, 11:00-11:30 AM Nanoscale Wiring by Cu Electrodeposition in Supercritical Carbon Dioxide Emulsified Electrolyte toward 3D Integrated Circuits Masato Sone 1,2, Tso-Fu Mark Chang 1,2, Tetsuya Shimizu 1, Nao Shinoda 1 1 Precision and Intelligence Laboratory, Tokyo Institute of Technology, Midori-ku, Yokohama, Kanagawa , Japan 2 CREST, Japan Science and Technology Agency, 4259 Nagatsuta-cho Midori-ku Yokohama Japan Abstract Copper wiring into nanoscale holes with high aspect ratio by electrodepostion is an important problem for 3-D integration in integrated circuit technology toward miniaturization of electronic devices [1]. However, void and pinhole found in Cu wiring for the integration can cause trouble for miniature device. Cu electroplating method without void and pinhole is needed. We have proposed novel electroplating methods with supercritical carbon dioxide (sc- CO 2) emulsion (EP-SCE) [2]. The electrochemical reaction is carried out in an emulsion of sc- CO 2 in electrolyte with surfactants. Sc-CO 2 has low viscosity and compatibility of hydrogen. Thus, this method is applicable in fine Cu wiring. The aim of this report is to examine Cu electrodeposition by using sc-co 2 emulsified electrolyte into nano-scale Cu wiring on the viewpoints of dissolution of Cu seed layer, gap-filling capability into nano-scale holes and contamination in the plated Cu. Fig1. Experimental apparatus; (a)co 2 gas tank, (b)co 2 liquidization unit, (c)liquidization unit, (d)high pressure pump, (e)thermal bath, (f)reaction cell (SUS316L) with PEEK coating inside, (g)substrate, (h)cross stirrer, (i)power supply, (j)back pressure regulator, (k)trap The high-pressure experimental apparatus (JASCO Co., Ltd) is shown in Fig. 1. Copper-sulfatebased electrolyte was purchased from Okuno Industry. 40 vol.% CO 2 at 313 K and 15 MPa under agitation were used with sc-co 2 apparatus [3]. Surfactant, polyoxy- ethylene lauryl ether, was added for formation of emulsion, and the concentration was 1.0 vol.% with respect to the electrolyte. Cu particles (63 m, min. 95%) were added for formation of the suspension. Current density of electroplating was 1.0 A/dm 2. Hole test element group (TEG) had an integrated 328

356 structure with Cu seed layer on TiN barrier layer sputtered on Si was used for filling in high aspect ratio holes. The holes were 70 nm in diameter, 350 nm in depth. The cross-sectional SEM images of holes filling with electrodeposited copper were observed by a scanning electron microscope (FE-SEM, S-4300SE, Hitachi high technologies Co., Ltd). At First, we conducted EP-SCE on the hole TEG, Then Cu seed layer on the substrates was dissolved, and Cu electroplating could not be conducted. It is also reported that Cu dissolved in Cu sulfate plating solution. [4] Moreover, the dissolution of CO 2 into the electrolyte can cause the acidity of the solution to be higher and the Cu seed layer to dissolve into the solution. In Cu plating on Cu substrate, the current efficiency by conventional electroplating (CONV) was 84%, though that by EP-SCE was 61%. This means dissolution of Cu may occur in the emulsion of sc-co 2. Thus, we concluded that EP-SCE is not adequate for Cu wiring. In order to inhibit dissolution of Cu, we made sc-co 2 suspension by addition of Cu particles to sc-co 2 emulsion. Electroplating method with sc-co 2 suspension is denoted as EP-SCS [3]. It is interesting that when the Cu particles were added into the emulsion of the electrolyte in supercritical CO 2, the smooth Cu surface was obtained by EP-SCS. It is widely accepted that the electroplating reaction in the suspension with Cu particles gives rough surface of the plated films, because the Cu particles were deposited with plated Cu at the same time. However, our results did not show such a phenomenon. Thus, we suggest that Cu particles in the EP-SCS at high pressure suspension could be dissolved into the continuous phase of the Cu electrolyte. Fig2. Cross sectional SEM images of hole test element group (TEG) with holes of 70 nm in diameter and aspect ratio of 2 filled (a) by conventional electroplating of Cu and (c) by EP-SCS of Cu. Next, filling experiments were also conducted on TEG holes with 70 nm in diameter and aspect ratio 2 by CONV and EP-SCS, as shown in Fig. 2. The holes were filled by COV, but there were observed many defects. These voids could come from the surface tension between air and the electrolyte or the viscosity of the electrolyte. On the other hand, Cu can be filled in holes without voids and pinholes by EP-SCS method. Moreover, we applied the EP-SCS into the filling of the holes with 70 nm in diameter and aspect ratio 5 as shown in Fig.3 For the EP-SCS, complete filling of all the holes with electro- deposited Cu was observed with no voids, as shown in figure 3(c). These complete gap-filling results by the EP-SCS mean that the scco 2 suspension improved trans- port property because of low viscosity of scco 2 and minimized problem casued by the evolution of H 2 bubbles because of high solubility of H 2 in scco 2. The addition of Cu particles in the sc-co 2 emulsion suppressed the dissolution of the Cu seed layer. 329

357 Fig3. Cross sectional SEM images of (a) Hole test element group (TEG) with holes of 70 nm in diameter and aspect ratio of 5, (b) expanded image of (a), and (c) TEG filled with Cu electroplated in scco 2 suspension Recently, Ni film obtained by this technique was found to contain carbon more than by conventional electroplating methods [5]. The reason is suggested that dissolved CO 2 was reduced to carbon and the carbon was codeposited with Ni. It is expected that impurities cause high electric resistance problem in the electrodeposited Cu. Thus, we have to investigate impurity concentration in the film obtained by this electroplating method. Glow discharge optical emission spectroscopy (GDOES) was conducted to measure impurity concentration. Electroplated Cu films obtained by EP-SCE and EP-SCS had a smooth surface without void. GDOES shows that low level of carbon concentrations in the film by EP-SCE and EP-SCS same as by CONV, although high carbon concentration was detected in the film by CONV with surfactant. These results indicate that EP-SCE and EP-SCS are applicable for pure Cu wiring. We examined Cu electrodeposition in sc-co 2 emulsified electrolyte into nano-scale Cu wiring on the viewpoints of dissolution of Cu seed layer, gap-filling capability into nano-scale holes and contamination in the plated Cu. The addition of Cu particles in the sc-co 2 emulsion on EP- SCS suppressed the dissolution of the Cu seed layer. The complete gap-filling in EP-SCS experiments are because sc-co 2 has low viscosity enough to fill such fine holes with high aspect ratio. Moreover, the contamination in EP-SCS did not occur. References 1. Luhn, A. Radisic, C.V. Hoof, W. Ruythooren, J.P. Celis, J. Electrochem. Soc. 157, D242 (2010) 2. T.F. M. Chang, M. Sone, A. Shibata, C. Ishiyama, Y. Higo, Electrochim. Acta, 55, 6469 (2010) 3. N. Shinoda, T. Shimizu, T.F.M. Chang, A. Shibata, M. Sone, Thin Solid Films, 529, 29 (2013) 4. N. M. Martyak, P. Ricou, Mater.Sci. Semicon. Process., 6, 225 (2003). 5. T. Nagoshi, T.F.M. Chang, T. Sato, M. Sone Microelectron. Eng., 110, 269 (2013) 330

358 (Room 111) 23 June 2016, 11:30-12:00 AM Composite Right/Left-Handed Transmission-line Metamaterials in the Mid-IR Region Zhijun Liu 1, Yi Luo 1, Xiangxiao Ying 1, Yang Pu 1, Yadong Jiang 1, and Jimmy Xu 1,2 1 School of Optoelectronic Information, University of Electronic Science and Technology of China, Chengdu, Sichuan , China 2 School of Engineering, Brown University, Providence, Rhode Island 02912, USA Abstract In the past decade, there has been a growing interest in metamaterial that allows one to engineer material electromagnetic properties not found in nature such as negative index, ultrahigh permittivity, optical magnetism, and spoof-surface-plasmon propagation etc. These novel properties can provide device functionalities not otherwise available, including super lenses with subwavelength resolution, tunable resonators, amplitude/phase modulators, and zeroindex lasers with uniform spatial mode, among many others. To date, most of the metametrial demonstrations have been based on planar split-ring resonator design. Composite right/lefthanded (CRLH) transmission-line metamerial, however, offers an alternative design approach, which was first introduced in the microwave region, and subsequently was used to demonstrate a variety of microwave guided-wave devices, e.g. multi-band and enhanced bandwidth components, power combiners/splitters, compact resonators, phase shifters, and phased array feed lines, as well as radiated-wave devices, e.g. resonant and leaky-wave antennas [1]. The transmission-line metamaterial concept is scalable from microwave to infrared, which opens space for new device functionalities especially in the relatively unexploited terahertz and mid-ir regions, where many key components are yet to be developed [2]. In this talk, I will present our effort to scale the microwave CRLH transmission-line metamterial concept to the mid-ir optical frequencies, where metals deviate from a perfect conductor. The metamaterial is designed as a three-layered structure. Its unit-cell is sketched in Fig.1 (a), where a SiO 2 dielectric layer is sandwiched between a ground plane and arrays of top U - shaped metal pads. The top and bottom metals form the shunt capacitance (C R). A gap between adjacent top U shaped metal pats forms the series capacitance (C L). The conductance of the top metal layer along the longitudinal and the transversal directions provides the series inductance (L R) and shunt inductance (L L), respectively. The equivalent circuit model of the designed structure is shown in Fig.1 (b) and a CRLH dispersion property is calculated in the framework of transmission-line theory. Fig. 1 (c) and (d) show SEM images of the fabricated CRLH metamaterial sample, in which a copper film was first deposited on a Si substrate by using the e-beam evaporation technique, and then a SiO 2 film was grown by using PECVD growth, and finally the U -shaped top Au pats were fabricated by a standard e-beam lithography and metal lift-off process. The metamaterial sample is characterized with angle-variable Fourier transform infrared (FTIR) reflection spectroscopy, where the sample and the detector were mounted on a θ-2θ rotational stage, which allows for a continuous scan of the incident angle from 15 to 85. Due to the leaky-wave nature of the metamaterial modes, the incident IR light can couple to CRLH modes under the condition of momentum (wavevector) matching, which eventually leads to absorption dips in reflection spectrum due to the metallic and dielectric losses. With the measured absorption frequency and the incident angle, the mode dispersion can be readily extracted. Fig. 1 (e) shows the reflection spectra of the metamaterial at different incident angles for incident s- polarization with the incident plane defined as along the metamaterial array axis. For each of the spectra, there are several absorption dips, which result from our designed metamaterial modes and the SiO 2 absorption as well. Our designed CRLH mode absorptions are expected to shift in frequency for different incident angles, while the absorptions of SiO 2 don t shift in frequency due to nature of intrinsic material absorption. Based on this principle, we identified 331

359 the mode at 47.3 THz as the right-handed metamaterial mode, which blue-shifts with increasing angle of incidence, and the mode at 21 THz as the left-handed metamaterial mode, which actually shifts to the opposite direction. In contrast, the remaining absorption features don t shift in frequency, which are attributable to SiO 2 absorptions. Our analysis is further supported by the reflection spectrum of a SiO 2 reference sample without the top U shaped metal pats as shown in the dotted line, which shows all SiO 2 absorption features in the layered structure except our designed CRLH metamaterial modes. The resultant CRLH metamaterial and findings of the underlying mechanism could be of great interests for advanced thermal sensing, camouflaging, controllable thermal shielding and emission. Fig1. (a) Schematic representation of unit-cell, (b) equivalent transmission-line circuit model, (c) and (d) SEM images of the designed mid-infrared CRLH metamaterial, (e) reflection spectra of the metamaterial for incident s-polarization at different incident angles. The dotted line is comparison spectrum for a SiO 2 sample. The dashed lines are drawn as aids to visualize the peak shifts. References 1. A. Lai, C. Caloz, and T. Itoh, IEEE Microwave Magazine 5, 34 (2004). 2. Z. Liu, P. W. C. Hon, A. A. Tavallaee, T. Itoh, and B. S. Williams, Applied Physics Letters 100, (2012). 332

360 (Room 111) 23 June 2016, 12:00-12:15 PM Novel Magnetically Tunable Microstrip Antenna Mousa Al-Omari, Sheikh Sharif Iqbal Mitu Electrical Engineering Department, sics Department, King Fahd University of Petroleum and Minerals, Dhahran, KSA, Saudi Arabia Abstract In recent wireless sensor and communication systems, reconfigurable antennas are of great interest to support dynamic wireless systems. RF switches are widely used in reconfigurable antennas but require complex control mechanism [1]. As an alternative, ferrimagnetic materials can be used to control the resonance and radiation properties of a planar antenna [2]. When magnetized, gyrotropic nature of ferrite substrate can introduce reconfigurable properties of a microstrip antenna, which depends on the direction and magnitude of the external magnetizing field (H 0) [3]. The designed magnetically tunable Microstrip patch antenna on a composite ferrite (Y220 ferrite slabs with ε r=15.4, M S = 1950 G, ΔH = 10 Oe) amd dielectric (RT\duriod 5880) substrate is shown in figure 1. The frequency tuning properties of the 4-GHz antenna with L=22.5 mm and w=26 mm is shown in figure 2. Note that the antenna demonstrated a gain of 7 db and its resonance frequency can be tunned from 4.25 to 5 GHz by changing the oppositely applied magnetic biasing from 0 to 75 KA/m. By integrating split ring resonators (SRR) within the ferrite material, it is observed that the the main beam of the antenna can be scanned with considerable reduced biasing requirements. An SRR, in its simplest forms, is a highly conductive metallic ring with multiple insertions [4]. When a time varying magnetic field perpendicular to the plane of the SRR is incident on the SRR surface, a current gets induced in the ring. Due to the gap/insertion and the continuously varying RF magnetic field, the current starts to change direction every cycle storing charge in the gap. The electric field build up due to this stored charge induces a magnetic field within the area enclosed by the ring and hence resonates. A large number of periodic repetitions of this SRR unit-cell behave as an effective medium with a negative μ eff, which is similar to magnetized ferrite material. The dimensions of the SRR unit cell were optimized to resonate at 4 GHz. Beam scan for the single MPA is achieved by producing a phase taper in the dominant component (y-component in this case) of the radiated E-field. By optimally embedding SRR structure on the ferrite substrate, the magnetic field induced in the SRR couples with the externally applied DC biasing field (H 0) of the ferrite, resulting in a larger net field. This coupling of the fields can be used to decrease the external DC field requirements as shown in figure 3. Note that the optimize SRR integrated patch antenna demonstrated a frequency tuning of 19% in addition to beam reconfigurability with significantly reduced external magnetizing field. 333

361 Fig1. Coaxially feed Patch antenna on a magnetized ferrite-dielectric substrate. Fig2. Frequency tunable properties of the antenna and the radiation pattern. Fig3. Frequency tunable properties of the antenna and the radiation pattern. References 1. Haupt, R.L. ; Haupt Assoc., Boulder, CO, USA ; Lanagan, M., Reconfigurable Antennas, Antennas and Propagation Magazine, IEEE,Volume:55, Issue: 1, pp , S. S. I. Mitu etal. "Analogue/Digital Ferrite Phase Shifter for Phased Array Antennas", IEEE Antenna and Wireless Propagation Letters (IEEE-AWPL), ISSN: , Vol. 9, April, M. A. Amiri, C. A. Balanis and C. R. Birtcher, Gain and bandwidth enhancement of ferrite-loaded CBS antenna using material shaping and positioning, IEEE Antennas and Wireless Propagation Letters, Vol. 12, J. Zhou, T. Koschny and C. M. Soukoulis, Magnetic and electric excitations in split-ring resonators, Optics Express, Vol. 15, No. 26,

362 (Room 111) 23 June 2016, 14:00-14:30 AM Controlling the size and shape of uncapped Au nanostructures with femtosecond laserassisted synthesis Katharine Moore Tibbetts 1,2, Behzad Tangeysh 2, Johanan H. Odhner 2, and Robert J. Levis 2 1 Department of Chemistry, Virginia Commonwealth University, Richmond, VA Department of Chemistry and Center for Advanced Photonics Research, Temple University, Philadelphia, PA Abstract The unique optical and electronic properties of plasmonic metal nanoparticles make these materials desirable for many applications including biomedicine, sensing, and catalysis. Because the plasmonic properties are highly sensitive to the size and shape of the particles, controlling these properties during synthesis is crucial for specific applications. Many size- and shape-selective syntheses of Au nanoparticles (AuNP) by chemical reduction of [AuCl 4] - have been reported [1,2], which typically require the use of organic surfactants and/or polymers to stabilize the particles and direct anisotropic particle growth. However, cytotoxic surfactants such as cetyl trimethylammonium bromide (CTAB) must be removed for biomedical applications [3] and polymers such as polyvinylpyrrolidone (PVP) can block access to particle surfaces in sensing and catalytic applications [4]. These drawbacks highlight the utility of synthesizing uncapped, naked AuNP with controlled sizes and shapes. Recently, high-intensity, strong field ultrashort pulsed laser radiation has been found to transform aqueous solutions of [AuCl 4] - to AuNP without the addition of any chemical reducing agents [5-9]. Irradiation of an aqueous solution of [AuCl 4] - results in photolysis of water and [AuCl 4] -, leading to reduction of the [AuCl 4] - to Au 0 and growth of AuNP, typically with only several minutes of laser irradiation. While polymers are often added to the solution prior to irradiation in order to control the particle size, we have found that some degree of control over the AuNP size and shape is possible without added polymers. This presentation will highlight our recent advances in manipulating the strong field photochemical reduction of aqueous [AuCl 4] - to control the size and shape of uncapped AuNP. Both spherical and triangular AuNP with varying sizes have been synthesized. Control over the diameter of spherical AuNP was achieved upon varying the initial solution ph of the aqueous KAuCl 4 solution by addition of HCl or KOH. The average particle size was found to decrease as ph increased, where TEM analysis showed particle sizes of 19.4±7.1 nm at ph 2.5, 9.2±4.1 nm at ph 3.4, and 4.8±1.9 nm at ph 5.4 (Figure 1, top row). At higher ph, the AuNP formed were slightly larger (6.6±3.1 nm at ph 8.4). Au nanotriangles were synthesized at a ph of 3.0 by exposing the KAuCl 4 solution to a short period of irradiation (< 60 s), followed by slow addition of H 2O 2 over a period of up to 48 hours. Decreasing the laser irradiation time produced Au nanotriangles with longer edge lengths, where the edge lengths for nanotriangles synthesized with 30, 15, and 5 sec of irradiation produced nanotriangles with edge lengths of 40.6 ±14.0 nm 89.6 ±31.4 nm, and 346±95 nm, respectively (Figure 1, bottom row). SEM analysis shows that the nanotriangles are ~10-20 nm thick and HRTEM/EDX analysis shows that they have atomically flat {111} surfaces with no attached ligands [9]. To understand the mechanisms underlying the size and shape control attained in the absence of capping agents, the [AuCl 4] - reduction kinetics were analyzed with UV-VIS spectroscopy and the intermediate species leading to Au nanotriangles analyzed by TEM and HRTEM. The reduction rate of [AuCl 4] - increases significantly with ph, consistent with the formation of smaller AuNP, and follows an autocatalytic rate law. The kinetics analysis shows that [AuCl 4] - is reduced to Au(0) via three reaction mechanisms: direct photolysis of [AuCl 4] - by multiphoton absorption of the laser radiation, autocatalytic reduction of [AuCl 4] - onto the surface of 335

363 AuNP by laser-produced H 2O 2, and reduction of [AuCl 4] - by reactive species e - aq and H. produced upon photolysis of H 2O by the laser. Following the generation of spherical AuNP seeds during the short period of laser irradiation, Au nanotriangles form over the course of 2 48 hours upon added H 2O 2 by autocatalytic reduction onto the surfaces of the seed particles. The triangular nanostructures form by oriented attachment of these spherical AuNP seeds, with additional [AuCl 4] - depositing onto the growing Au nanotriangle surfaces through autocatalytic reduction by the added H 2O 2, eventually forming single-crystal nanotriangles (Figure 2). Fig1. TEM images of spherical AuNP (top) and Au nanotriangles (bottom). Fig 2. Growth of Au nanotriangles by oriented attachment. References 1. M. L. Personick and C. A. Mirkin, J. Am. Chem. Soc. 135(49), (2013). 336

364 2. P. Zhao, N. Li, and D. Astruc, Coord. Chem. Rev. 257(3-4), (2013). 3. A. M. Alkilany, P. K. Nagaria, C. R. Hexel, T. J. Shaw, C. J. Murphy, and M. D. Wyatt, Small 5(6), (2009) 4. J. M. Krier, W. D. Michalak, L. R. Baker, K. An, K. Komvopoulos, and G. A. Somorjal, J. Phys. Chem. C 116(33), (2012) 5. T. Nakamura, Y. Mochidzuki, and S. Sato, J. Mater. Res. 23(4) (2008) 6. P. H. D. Ferreira, M. G. Vivas, L. de Boni, and D. S. dos Santos, Opt. Express 20(1) (2012) 7. B. Tangeysh, K. M. Tibbetts, J. H. Odhner, B. B. Wayland, and R. J. Levis, J. Phys. Chem. C 117(36), (2013) 8. J. H. Odhner, K. M. Tibbetts, B. Tangeysh, B. B. Wayland, and R. J. Levis, J. Phys. Chem. C 118(41) B. Tangeysh, K. M. Tibbetts, J. H. Odhner, B. B. Wayland, and R. J. Levis, Nano Lett. 15(5), (2015) 337

365 (Room 111) 23 June 2016, 14:30-15:00 PM Void shrinking and interfacial grain boundary migration in the diffusion bonding of 1Cr11Ni2W2MoV steel Hong Li, Miaoquan Li, Chao Zhang School of Materials Science and Engineering, Northwestern Polytechnical University, Xi an Shaanxi, China Abstract Diffusion bonding is an impotant solid state bonding method, which can be used in laminated object manufacturing and layered manufacturing for many metals and alloys. The quality of bond is dependent on its microstructure, which is determined by two important physical processes: void shrinking and interfacial grain boundary (IGB) migration. In this study, the solid state bonding of 1Cr11Ni2W2MoV steel was performed. The void shrinking process and IGB migration were observed and discussed according to the experimental results and theoretical analysis. Four shapes of void in the bonding interface were observed, which is influence by the bonding temperature and bonding time. With an increase in the temperature and time, the void size decreases gradually. Besides, the IGB migration was observed. There are three migrating tyes, which are related to the void size and location in the bonding interface. The interaction mechanism between void and IGB is analyzed in detail. Due to the void shrinking and IGB migration, the microstructure and mechanical property of bond re comparable to that of the base steel. Figure 1 shows the morphology of void and IGB in the bonding interface of 1Cr11Ni2W2MoV steel. The solid arrows present the initial bonding interface. It can be seen that some tiny voids distribut in the bonding interface and a part of IGB migrates from the initial bonding interface. Void IGB Fig1. Morphology of void and IGB in the bonding interface of 1Cr11Ni2W2MoV steel. References 1. H. Li, H.B. Liu, W.X. Yu, M.Q. Li, Materials Letters, 108 (2013). 2. C. Zhang, H. Li, M.Q. Li, Science and Technolgy of Welding and Joning, 20 (2015). 3. M. Lagos and C. Retamal, Scripta Materialia, 64 (2011). 338

366 (Room 111) 23 June 2016, 15:00-15:15 PM Configuration, size and density evolution of Pd nanostructures on sapphire (0001) by the control of deposition amount at various annealing temperature Sundar Kunwar, Mao Sui, Puran Pandey, Quanzhen Zhang, Ming-Yu Li and Jihoon Lee College of Electronics and Information, Kwangwoon University, Nowon-gu Seoul 01897, South Korea Abstract In recent times, metal nanoparticles (NPs) have been extensively investigated due to potential to improve the performances of various devices such as in optoelctronics, solar cells, biomedical, sensors, and fuel cells [1-4]. The control of configuration, size and density of metallic NPs lead to the exceptional tunability of physical, optical and catalytic properties. The evolution of the nanostructures differs depending upon the selection of metal species, substrates and the processess of fabrication. In this paper, various configurations, size and density evolution of palladium (Pd) nanostructures on sapphire (Al2O3) has been studied by the systematic control of deposition amount (DA) at various annealing temperatures. Fig1. Evolution of small to large Pd NPs, irregular nanostructures and voids on sapphire with DA variation between 1 to 200 nm at 850 o C for 450 s. Fig. 1 shows the overall evolution of self-assembled Pd nanostructures, initially, densely packed small to widely spaced large Pd NPs are synthesized via the control of DA between 1 and 40 nm based on the Volmer-Weber growth model and surface energy minimization mechanism [5]. Further increment in the deposition amount formed the irregular nanostructures due to the coalescence growth and limited diffusion of Pd thin film [6]. The diffusion of deposited thin Pd film is further limited at relatively higher thickness as a result void are fabricated. Depending on the evolution of size, density and configuration, five distinctive regimes of Pd nanostructures are observed: a) nucleation and evolution of small NPs between 1 and 3 nm b) medium NPs with the dominating vertical growth between 5 and 20 nm 339

367 c) laterally expanded large NPs between 30 and 40 nm d) irregular coalesced Pd nanostructures between 50 and 80 nm and finally e) void formation and evolution between 100 and 200 nm. Acknowledgements Financial support from the National Research Foundation of Korea (no and 2016R1A1A1A ), and in part by the research grant of Kwangwoon University in 2016 is gratefully acknowledged. References 1. C. Y. Cho, K. S. Kim, S. J. Lee, M. K. Kwon, H. Ko, S. T. Kim,... & S. J. Park, Surface plasmon-enhanced light-emitting diodes with silver nanoparticles and SiO2 nano-disks embedded in p-gan. Applied Physics Letters, 99, (2011). 2. E. A. Parlak, T. A. Tumay, N. Tore, Ş. Sarıoğlan, P. Kavak, & F. Türksoy, Efficiency improvement of PCDTBT solar cells with silver nanoparticles. Solar Energy Materials and Solar Cells, 110, (2013). 3. J. L. Li, & M. Gu, Gold-nanoparticle-enhanced cancer photothermal therapy. IEEE Journal of selected topics in quantum electronics, 16, (2010). 4. A. Tittl, P. Mai, R. Taubert, D. Dregely, N. Liu, & H. Giessen, Palladium-based plasmonic perfect absorber in the visible wavelength range and its application to hydrogen sensing. Nano letters, 11, (2011). 5. F. Ruffino, & M. G. Grimaldi, Atomic force microscopy study of the growth mechanisms of nanostructured sputtered Au film on Si (111): evolution with film thickness and annealing time. Journal of Applied Physics, 107, (2010). 6. M. Zinke-Allmang, L. C. Feldman, & M. H. Grabow, Clustering on surfaces. Surface Science Reports, 16, (1992). 340

368 (Room 111) 23 June 2016, 15:15-15:30 PM Preparation and characterization of pure titanium/hydroxyapatite nanocomposties manufactured via selective laser melting Changjun Han, Qian Wang, Qingsong Wei, Shifeng Wen, Jie Liu, Yusheng Shi State Key Lab of Materials Processing and Die&Mould Technology, Huazhong University of Science and Technology, Wuhan, Hubei Province, China Abstract Pure titanium (Ti) is typically used in additive manufacturing processes to produce tailor-made implants for orthopedics and dentistry due to the good biocompatibility and high mechanical strength. However, the poor integrity with native bones is a major challenge in their clinical application. Ti and hydroxyapatite (HA) composites can be used to promote the bone ingrowth and integration with the surrounding tissue. In this work, the Ti/HA nanocomposite powders were prepared by ball milling and fabricated by selective laser melting (SLM) process. The effects of the ball milling parameters (milling time, ball-powder ratio and milling speed) on the morphology, particle size, element distribution and phase of the Ti/HA nanocomposites were investigated. Mixtures of Ti surface conditioned powder with nano-hydroxyapatite up to 10 wt.-% were processed by SLM. The powder metallurgy characteristics for the fabrication of Ti/HA nanocomposites are developed. 341

369 Poster Session, 20 June 2016, 17:30-18:00 PM Atmospheric plasma modified nanoarrays of MoS 2 nanosheets with Au nanoparticals for elevating SERS biodetection Yi-Qun TSENG, Ting-Yu LIU Dept. Materials Engineering, Ming Chi University of Technology, New Taipei city, Taiwan Abstract The flexible nanoarrays of MoS 2 nanosheets and Au nanoparticals (AuNPs) were succesufully fabricated and then treated by atmospheric plasma to increase sensitivity and decrease flurouence for surface enhanced Raman scattering (SERS) biodetection. Molybdenum disulfide (MoS 2) nanosheets contained the distinctive atomic stacked structure of S-Mo-S bonds, which could easily capture AuNPs by Au-S binding without any reducing agent. Therefore, we would take the advantages of the excellent potential MoS 2 nanosheets with well-designed AuNPs nanoarrays as SERS substrate for biological molecules and organic pollutants detection. The results show that the diameter of AuNPs is about nm, and the size of the MoS 2 nanosheets is about 200 nm 200 nm with the thickness of 1-5 nm, measured by transmission electron microscopy. X-ray diffraction patterns show that the main lattice planes of (111) of o ) and (002) of MoS o 2 ) were observed in the nanohybrids of AuNPs grown on the MoS 2 nanosheets. The main SERS vibration modes (734 and 1380 cm - 1 ) of adenine (10-4 M) were detected by Raman spectroscopy. Furthermore, SERS signal would be significantly enhanced and background flurouence could be effectively removed by atmospheric plasma treatment (Fig. 1). The novel flexible SERS substrate made by Au-MoS 2 nanoparticle arrays after atmospheric plasma modification shows that promising applications by detection of biomolecules and water pollutants, such as adenine, rhodamine 6G dye, acid orange II and malachite green (MG). Fig1. Illustration of atmospheric plasma modified Au-MoS2 SERS substrate for elevating SERS signal Referernces 1. Ataca, C., et al. "Mechanical and electronic properties of MoS2 nanoribbons and their defects." The Journal of Physical Chemistry C (2011):

370 2. Su, S., C. Zhang, L. Yuwen, J. Chao, X. Zuo, X. Liu, C. Song, C. Fan and L.Wang (2014). "Creating SERS hot spots on MoS2 nanosheets with in situ grown gold nanoparticles." ACS Appl Mater Interfaces 6(21): S. M. Nie and S. R. Emery, Probing single molecules and single nanoparticles by surfaceenhanced Raman scattering, Science, vol. 275, pp ,

371 Poster Session, 20 June 2016, 17:30-18:00 PM Development of Highly-Transparent Slippery Liquid-Infused Porous Surface (SLIPS) through Biomimicking Name Kuan-Kai Tseng, Wei-Hao Lu, Chih-Wei Han, Kai-Yang Lin, Yu-Min Yang Department of Chemical Engineering, National Cheng Kung University, Tainan, Taiwan Abstract Since Wong et al. [1] gave the examples of slippery liquid-infused porous surfaces using Teflon nanofibrous membranes and epoxy-resin-based nanostructured surfaces with perfluorinated fluids, the term SLIPS is now commonly accepted to describe this new type of Nepenthes pitcher plant inspired liquid-repellent surfaces. The stability of non-wetting property under high pressure, high temperature, or during drop-impact processes, gives SLIPS advantages over the conventional Lotus inspired liquid-repellent surfaces. In this work, successful development of highly-transparent SLIPS with omniphobicity from superhydrophilic nanoparticulate thin films through superhydrophobicity functionalization and lubricant infusion was demonstrated. As shown in Fig. 1, an aqueous electrostatic layer-bylayer (ELbL) assembly process [2] was utilized to fabricate nanoparticulate thin films on glass substrate by using SiO 2 nanoparticles and polyelectrolytes. After high temperature sintering at 550 C for 4 hours, superhydrophilicity and an average transmittance of 92.2% in the visible light region ( nm wavelength) were exhibited by the 20-bilayer nanoparticulate thin film with hierarchical nano/microstructure. On the other hand, superhydrophobicity and an average transmittance of 87.9% resulted from a post-treatment of the nanoparticulate thin films with trichloro (1H, 1H, 2H, 2H-perfluorooctyl)silane for 1 hour. Moreover, stable and highlytransparent (average transmittance = 94.5%) SLIPS can be achieved by infusing fluorinated lubricant Fomblin Y into the porous silanized nanoparticulate thin films. Table 1 shows that the SLIPS exhibited extreme liquid repellency as signified by low sliding angles (less than about 10 o for droplet volume of 5 μl) against seven pure liquids (water, ethylene glycol, pentadecane, nonane, octane, heptane, and haxane) with surface tension values ranging from 72.8 to 18.6 mn/m. It is noteworthy that Moth eye and Rose petal inspired artificial surfaces can be fabricated by the same methodology with different experimental procedure as also shown in Figure 1. Antireflection/superhydrophilicity and transparency/adhesion properties were exhibited by the former and the latter surfaces, respectively. 344

372 Fig. 1. Outline of the Experimental Procedures and the Properties of Each Type of Film. Table 1. Static Contact Angle (SCA) and Sliding Angle (SA) of Pure Liquid Droplet on the SLIPS. Test liquids (Surface tension, mn/m) Water (72.8) Ethylene glycol (47.7) Pentadecane (27.1) Nonane (22.6) Octane (21.4) Heptane (19.9) Hexane (18.6) SCA ( o ) SA ( o ) Referernces 1. T. S. Wong, S. H. Kang, S. K. Y. Tang, E. J. Smythe, B. D. Hatton, A. Grinthal, J. Aizenberg, Nature 477, 443 (2011). 2. Y. M. Yang, Chapter 10 in Self-Cleaning Materials and Surfaces: A Nanotechnology Approach, W. A. Daoud (Ed.), Wiley (2013). 345

373 Poster Session, 20 June 2016, 17:30-18:00 PM Methodical Controls on Configuration, Size, and Density of the Au Nanostructures on 4H-SiC (0001) via Deposition Thickness, Annealing Temperature, and Annealing Duration Ming-Yu Li 1, Mao Sui 1, Puran Pandey 1, Quan-zhen Zhang 1, Sundar Kunwar 1, and Jihoon Lee 1,2 1 College of Electronics and Information, Kwangwoon University, Nowon-gu Seoul , South Korea. 2 Institute of Nanoscale Science and Engineering, University of Arkansas, Fayetteville AR 72701, USA. Abstract The metallic nanoparticles (NPs) with the tunable configuration, size and density exhibited prominent physical and optical properties, which resulted in a wide range of applications in chemical, electrical, and optical devices. Meanhile, SiC is a semiconductor material with a unique combination of physical and electronic properties including wide bandgap, high saturated electron velocity, and high thermal conductivity, which led to numorous applications in high-power, high-temperature, high-speed, and radiation-hard devices. Fig1. Various self-assmbled Au nanostructures fabricated on the 4H-SiC (0001). Atomic force microscopy (AFM) top-views of (a)au nano-crystals, (b) Au nanoparticles, and (c) Au nano-mounds. AFM top views are of 3 3 μm 2 in (a) and of 1 1 μm 2 in (b) and (c). Insets in each images are enlaeged nanostructures anlong with the 2-D Fourier filter transform spectra. In this work, we propose three effective approaches to control the shape, size, and density of the self-assembled Au nanostructures on 4H-SiC (0001): Deposition thinkness, annealing temperature, and annealing duration. Depedning on the deposition thinckness, the round-dome shaped Au NPs are fabricated initially and gradually evolve into heagnal Au nano-crystals based on the Volmer-Weber growth model, and surface energy minirization mechanism as shown in Figs. 1(a)-1(b). [1-2] Regardless of the shape, the size expansion of Au nanostructures is always observed with a conpensation of density decrease along with the increased deposition thickness. Depedning on the annealing temperature, self-assmbled Au nanostructures undergo two distict regimes: I) irregular Au nano-mounds and II) round-dome shaped Au nanoparticles. At relatively lower temperatures, the irregular Au nano-mounds formed and gradually aggragated from a continuous Au layer based on the diffusion limited mechanism as shown in Fig. 1(c). [3-4] With further increased temperatures, the round-domed shaped Au nanoparticle 346

374 gruadually developed with size and densiy due to the enhanced diffusion. Dependig on the annealing duration, the size increase of round-dome shaped Au NPs is compensated with density decrease due to the Ostwald-ripening. [5-6] Acknowledgements Financial support from the National Research Foundation of Korea (no and 2016R1A1A1A ), and in part by the research grant of Kwangwoon University in 2016 is gratefully acknowledged. References 1. Y. Sun, K. Liu, X. Hong, M. Chen, J. Kim, S. Shi, J. Wu, A. Zettl, and F. Wang, Nano Letters 14, 5329 (2014). 2. M. Bowker, A. F. Carley, P. R. Davies, D. J. Morgan, J. Crouch, G. Lalev, S. Dimov, and D.-T. Pham, ASC Nano 4, 2228 (2010). 3. J.-Y. Kwon, T.-S. Yoon, K.-B. Kim, and S.-H. Min, Journal of Appled Physics 93, 3270 (2003). 4. T. A. Witten and L. M. Sander, Physical Review B 27, 5686 (1983). 5. J. H. Yao, K. R. Elder, H. Guo, and M. Grant; Physical Review B, 47, (1993). 6. F. Ruffino and M. G. Grimaldi, Journal of Applied Physics 107, (2010). 347

375 Poster Session, 20 June 2016, 17:30-18:00 PM Multicolor nanoprobes based on silica-coated gadolinium oxide nanoparticles with highly reduced toxicity Timur Sh. Atabaev, Hyung-Kook Kim and Yoon-Hwae Hwang Department of Nano Energy Engineering & BK PLUS Nanoconvergence Technology Division, Pusan National University, Miryang , Republic of Korea Abstract In recent years, multimodal contrast agents have attracted considerable attention in biomedical imaging. This study reports the development of a multimodal nanoprobe based on silica-coated gadolinium oxide nanoparticles (NPs) for T1-enhanced magnetic resonance (MR) and multicolor optical imaging. MR relaxivity measurements showed that these core shell NPs could generate strong positive contrast enhancement in T1-weighted MR imaging (MRI). Owing to the nominally co-doped Eu 3+ and Tb 3+ ions in the Gd 2O 3 host, the synthesized nanoprobes could simultaneously emit blue, green and red fluorescence signals. Furthermore, the cytotoxicity results showed that a thin silica coating on the surface of gadolinium oxide NPs could increase the biocompatibility of the fabricated nanoprobes considerably. We showed that excellent multicolor fluorescence and MRI functionalities of these nanoprobes could have potential in biomedical applications. 348

376 Poster Session, 20 June 2016, 17:30-18:00 PM Structure, optical, electronic and magnetic properties of Fe-doped ZnO nanoparticles synthesized by solution combustion method and first principle calculation Pornsawan Sikam 1, Pairot Moontragoon 1,2,3, Jutapol Jumpatam 1, Supree Pinitsoontorn 1,2,3, Prasit Thongbai 1,2,3 1 Department of Physics, Khon Kaen University, Khon Kaen, 40002, Thailand 2 Integrated Nanotechnology Research Center (INRC), Department of Physics, Khon Kaen University, Khon Kaen, 40002, Thailand 3 Nanotec-KKU Center of Excellence on Advanced Nanomaterials for Energy Production and Storage Abstract For a decade ZnO, a non-magnetic, an ecological friendly material and n-type semiconductor with wide direct band gap of 3.37 ev [1], has rigorously attracted research attention for its exceptional properties and resourceful applications in transparent electronics, ultraviolet (UV) light emitters, piezoelectric devices, chemical sensors, solar cells, gas sensors, varistors, transistors and magnetic and thermoelectric materials [2-3]. In this work, pure ZnO and Fe-doped were investigated in both an experimental and theoretical aspects. The Zn 1-xFe xo nanoparticles were prepared by a combustion method. The crystal structures were characterized by the X-ray diffraction (XRD), morphology by the scanning electron microscope (SEM) technique, elementsal analysis or chemical characterization of a sample by an Energy-dispersive X-ray spectroscopy (EDS), the magnetic properties by vibrating sample magnetometer (VSM), and optic properties by ultraviolet-visible (UV-vis) spectroscopy. In the first principle calculation, the structural properties, electronic structure and magnetic properties for pure ZnO and Zn1-xFexO have been investigated by means of density functional theory with Local Density Approximation (LDA), General Gradient Approximation (GGA) and GGA with Hubbard model scheme (GGA+U), packaged in the Vienna Ab initio Simulation Package (VASP). The calculation was performed using selfconsistent projected augmented plane wave (PAW). The zinc oxide was modeled using super-cell in ideal hexagonal wurtzite structure. The prepared samples of pure ZnO and Zn 1- xfe xo with iron concentration of 6.25% by mole had a phase of the hexagonal wurtzite structure with crystallite sizes about nm. The calculation results indicate that the pure ZnO has direct energy band-gap of 1.84 ev for GGA+U calculation, which are underestimated when compared to the results from the experiment part, Eg=3.17 ev. The calculated magnetic dipole moments of the Zn 1-xFe xo when the Iron contents (x) are 0.000, and equal to 0.00, 3.91 and 7.83 µb, respectively. The density of states of 6.25% of iron doped ZnO also show an intermediate band from d orbital of iron atoms located near the valence band. This indicates that small amount of doped iron engineers the band structure. These results show that the doped iron atoms seem to play an important role for the appearance of intermediate band and ferromagnetism. 349

377 Fig. 1. The isosurface of difference between spin up electron density and spin down electron density (spin up spin down) of Fe xzn 1-xO when (a) x= and (b) x= and, (c) the specific magnetization as a function of field measured at 50K of Fe xzn 1-xO with iron content of 12.5%. Referernces 1. S. Labauyai, V. Promarak, and S. Maensiri, Optical properties of Mg xzn 1-xO nanoparticles synthesized by a direct thermal decomposition route. Optoelectronics and Advanced Materials: Rapid Communications. 2 (2008) P. Moontragoon, S. Pinitsoontorn, P. Thongbai, Mn-doped ZnO nanoparticles: Preparation, characterization, and calculation of electronic and magnetic properties, Microelectronic Engineering 108 (2013) S. Jantrasee, S. Pinitsoontorn, P. Moontragoon, First-Principles Study of the Electronic Structure and Thermoelectric Properties of Al-Doped ZnO, Journal of Electronic Materials 43 (2014)

378 Poster Session, 20 June 2016, 17:30-18:00 PM Two-dimensional nanoparticle arrays as flexible SERS substrats by decorated gold nanoparticles on nanoclay Chih-Hao Wang, Ting-Yu Liu Dept. Materials Engineering, Ming Chi University of Technology, Taiwan Abstract The nanoparticle arrays of Au-nanoclay were succefully fabricated for surface-enhanced Raman scattering (SERS) biosensing (Fig. 1). Montmorillonite clays were exfoliated to a single layer of nanoclays by inserted poly(propylene glycol)-bis(2-aminopropylether) with a molecular weight of 2000 g/mol and utilize to reduce gold nanoparticles directly. The flexible nanohybird SERS substrate display the huge Raman enhancement by hot spots produced from self-assembly of AuNPs on the nanoclays. The characterizations of Au-nanoclays would be evaluated by transmission electron microscopy, X-ray diffraction and Raman spectroscopy using a 633 nm laser. The result shows that the diameter of Au nanparticles is 10-40nm and the size nanoclays is about 100 nm 100 nm. The biomolecules (adenine and Orange 7 dye) could be quickly and sensitively (the determined limit concentration is about 2.8x10-9 M) detected by the flexible Au-nanoclays SERS substrate using Raman spectroscopy. It would be anticipated to further apply to rapidly detect DNA, virus, and bacteria. Fig. 1. Illustration of SERS detection process using Au-nanoclays SERS substrate 351

379 Poster Session, 20 June 2016, 17:30-18:00 PM Synthesis of flower-like NiO/Fe 3O 4 composites and Its Sensing Performance Hong Wang, Min Gong, Mingtian Li, Xiafei Zhou, Yanzhao Zao Department of Materials and Chemical Engineering, Sichuan University of Science and Engineering, Zigong, , P.R. China Abstract Flower-like Fe 3O 4/NiO composites were synthesized successfully by a facile hydrothermal route. The structures and morphologies of composites were characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), energy dispersive spectroscopy (EDS) and transmission electron microscopy (TEM). The controlling factors on the morphology of the resulting products were investigated and the formation mechanism of Fe 3O 4/NiO composites was also proposed. Gas-sensing investigations showed that the as-synthesized composites possessed superior selectivity and high sensitivity to organic gases such as acetone, which allowed its application in gas-sensor materials. Fig. 1 showed SEM images of Fe 3O 4/NiO composites. As could be seen, flower-like Fe 3O 4/NiO composites were observed on a large scale. Fig1. SEM images of Fe 3O 4/NiO composites 352

380 Poster Session, 20 June 2016, 17:30-18:00 PM Graphene as a cell transplantation vehicle Jooyeon Park, Byung-Soo Kim School of Chemical and Biological Engineering, Seoul National University, Seoul , Republic of Korea Abstract Mesenchymal stem cell (MSC) implantation has emerged as a potential therapy for myocardial infarction (MI). However, the therapeutic efficacy has been greatly limited by poor survival of MSCs implanted to MI. One of the main causes for the poor survival is reactive oxygen species (ROS) generated in the ischemic myocardium after the restoration of blood flow. ROS cause the death of implanted MSCs mainly by inhibiting adhesion of the MSCs to extracellular matrices (ECM) in the lesion site (i.e., anoikis). In this study, we proposed to use graphene oxide (GO) flakes to protect the implanted MSCs from ROS-mediated death and thereby improve the therapeutic efficacy of the MSCs. GO can adsorb proteins, such as fibronectin (FN). MSCs, which adhered to FN-adsorbed GO flakes and then exposed to ROS in vitro or implanted to ischemia-damaged and reperfused myocardium, survived far better than unmodified MSCs. Furthermore, the improved MSC-engraftment by the adhesion of MSCs to GO flakes prior to implantation resulted in enhanced paracrine secretion from the MSCs following MSC implantation, which in turn promoted cardiac tissue repair and cardiac function restoration. This study demonstrates that GO can effectively improve the engraftment and therapeutic efficacy of MSCs for ROS-abundant ischemia and reperfusion injury through protecting implanted cells from anoikis [1]. Referernces 1. J. Park, B. Kim, J. Han et al., ACS Nano 9, 4987 (2015). 353

381 Poster Session, 20 June 2016, 17:30-18:00 PM Polymer Antireflection Film on Dye-Sensitized Solar Cells Jenn-Kai Tsai 1, Yu-Shin Tu 1, Teen-Hang Meen 1, Tian-Chiuan Wu 1, Sheng-Joue Young 1, Yu-Pin Lou 1, Guan-Jia chen 1, Jyun-Yang Tang 1, Ming-Yang Shiu 1, and Liang-Wen Ji 2 1 Department of Electronic Engineering, National Formosa University, Yunlin 632, Taiwan. 2 Institute of Electro-Optical and Materials Science, National Formosa University, Yunlin 632, Taiwan Abstract In this study, mainly for the use of anodic aluminum oxide (AAO) template for preparing polymeric anti-reflective film to improve incident penetration of dye-sensitized solar cells (DSSCs). AAO template nanostructures replication in PMMA by spin-coating to be the antireflection film. Using poly-dimethylsiloxane (PDMS) attached to the DSSC surface. This method can effectively improve the penetration of DSSCs incident light. Effectively enhance the short-circuit current density (J SC) increased from to ma/cm 2 and the photoelectric conversion efficiency (η) increased from 6.26 to 6.79%. In this paper, titanium dioxide nanoparticles (TiO 2 NPs) diameter of about 25 nm was deposited on the fluorine-doped tin oxide (FTO) glass substrate by doctor blade coating, then using mechanical compression technology to compress the film [1-2]. The sensitizer N3 dye was used on the DSSC. AAO template nanostructures replication in poly-methyl methacrylate (PMMA) by spin-coating on the polymer film transfer method [3]. The fabricated PMMA films could generate the gradient of the refractive indices, greatly reduce the reflectivity [4]. PMMA has been chosen as working material because of its high resolution, low cost, and optical transparency in the wavelengths between visible and near-infrared regions. Moreover, since the thin PMMA films are flexible, antireflection structures can be mounted on curved optical structures for some interesting applications. The surface morphology of AAO template and PMMA with sub-wavelength structures were observed under the field-emission scanning electron microscope (FESEM). Figure 1(a) and (b) are top-view images of AAO template and PMMA film, respectively. The results can be seen AAO template pore and PMMA sub-wavelength structures diameters of about 150 and 110 nm, respectively. Their size are not the same due to the heating process PMMA will gradually dissolve and volume shrinkage. PMMA structure affected by van der Waals' force to occuring the aggregation if their length were too long. Figure 1 (c) is a cross-sectional image of PMMA film, the sub-wavelength structures height of about 234 nm. This can be determined through the PMMA after heating can complete the AAO template tubular pores characteristic copied onto the PMMA film. Fig. 1. FE-SEM images. (a) top-view of AAO template; (b) and (c) top-view and cross-sectional of PMMA with sub-wavelength structures. 354

382 At previous study of the transmittance measurement the light of 550 nm wavelength, we found that the transmittance of bare glasses without and with a PMMA antireflection structures are and 84.58%, respectively. According to the equivalent medium theory, a PMMA subwavelength structure glass can effectively enhance transmittance. This is mean that the subwavelength structures applied on the DSSC photoanode side will increase the light intensity into the photoanode and generate more photoelectrons. Figure 2 shows a comparison of the results measured under AM 1.5G illumination at 100 mw/cm 2 current-voltage (I-V) characteristics of DSSCs, the corresponding parameters of DSSCs are also summarized in Table 1. Sample A and B prepared under various parameters of without and with a PMMA antireflection structures on the photoanode side. Comparing the current density (J SC), it increased from to ma/cm 2. It cause the efficiency increased from 6.26% to 6.79%. Attached to the PMMA film has proved subwavelength structures can further enhance the light transmittance and increase solar cell efficiency. In these samples, the open-circuit voltage (V OC) was almost constant. The fill factor (F.F.) was a little increased from to 61.90% due to the photocurrent increased induced by more incident light. Current density(ma/cm 2 ) without with Voltage(V) Fig. 2. Current densities against voltage (I-V) characteristics of DSSCs with and without antireflection film. Table 1. Characteristics of DSSCs with and without antireflection film Transmittance Sample (%) V OC J SC F.F. η (V) (ma/cm 2 ) (%) (%) A B In this study, the good antireflective film was successfully fabricated by PMMA with the subwavelength structure using AAO nanostructure and attached on DSSC photoanode side glass substrate by PDMS. This method is simple, fast, and low cost. The sunlight incident into DSSC was increased, from to 84.58%. Effectively enhance the short-circuit current density (J SC) and the photoelectric conversion efficiency (η), increased from to ma/cm 2 and from 6.26 to 6.79%, respectively. After experiments show that DSSC with sub-wavelength antireflection films prepared PMMA can effectively improve the overall performance. 355

383 Referernces 1. J. K. Tsai, W. D. Hsu, T. C. Wu, T. H. Meen, W. J. Chong, Nanoscale Research Letters 8, (2013). 2. Y. Kanamori, E. Roy, Y. Chen, Microelectronic Engineering 78-79, 287 (2005). 3. C.-J. Ting, M.-C. Huang, H.-Y. Tsai, C.-P. Chou, C.-C. Fu, Nanotechnology, 19, 2053 (2008). 4. T. H. Meen, J. K. Tsai, Y. S. Tu, T. C. Wu, W. D. Hsu, S. J. Chang, Nanoscale Research Letters. 9, 523 (2014). 356

384 Poster Session, 20 June 2016, 17:30-18:00 PM Surface Treatments on the Pure Titanium Implants G4 (Grade 4) Used in Debtal Implantology Saniye Ozgur, H. A. Yeprem Metallurgical and Materials Engineering Department, Yildiz Technical University, Istanbul, Turkey Abstract Nowadays, functionalizing and the use of implanted dental devices is a well-acknowledged practice in the field of orthopaedic as well as dental surgery. Today, many different kind of surface modification techniques are being applied on dental implant surfaces such as G4 and G5 grades Ti alloys. Surface science and engineering are relatively new field of research in which surface characterization has been widely used to design material properties with specific purposes, including biomedical applications. With increase in the world population s age, the need for new metal-based components to guarantee a good quality of life also increases. Titanium and its alloys have been successfully used for manufacturing metallic implants and prostheses for dental and orthopedic procedures. Modifying the implant surfaces and improving their implant-to bone interaction, an optimized metalic implant surface modification is needed. Compared to the conventional pure Ti-Grade 4 surface, many different surface topography modifications are applied in order to improve bone and implant interactions. There are different mechanical and chemical applications for instance, grit blasting with various types and sizes of abrasives, acid etching and electrochemical processes with different solutions, plasma-sprayed coating methods by organic or inorganic materials or hybrid techniques which contains combination of some of them. There are many different techniques to improve the osseointegration between tissue and implant material. It is also important to provide high biomechanical properties and better biocompatibility. On that aspect, processing and controlling of implant surfaces in the manufacturing stage is vital for final product quality. 2D inspection methods generally give information for roughness specifications (for example; Ra, Rq, Rz, Rt,etc) [1, 2]. In this study, different surface modifications are investigated on dental implants. In particular, roughness characteristics, mechanical and structural properties of Grade-4 Ti alloys are evaluated Referernces 1. R. Bhola, S.M. Bhola, B. Mishra, D.L. Olson, Trends Biomater. Artif. Organs, 25(1), (2011) 2. A. Bagno, C. Di Bello, J Master Sci Mater Med, 15(9), (2004) 357

385 Poster Session, 20 June 2016, 17:30-18:00 PM Ultra Fine Grained Pure Titanium Grade 4 Surface Morphologies as Dental Implant Materials A. G. Bulutsuz, 1 H. Aygül Yeprem, 2 M. E. Yurci 1 1 Department of Mechanical Engineering, Yildiz Technical University, Istanbul, Turkey 2 Department of Metallurgical and Materials Engineering, Yildiz Technical University, Istanbul, Turkey Abstract The long-term interfacial attachment with a good biocompability between dental implant and bone may be achieved by manufacturing a homogenaus rough surface morphology on the implant surface. The surface also should provide a durable chemical and stable mechanical interface between implant and bone which is possible with a homogeneous cell proliferation on the implant surface. This paper reports the surface morphologies; microstructures and mechanical properties of these titanium billets that firstly processed severe plastic deformed, afterwards, surface modificated by means of sand blasting technique. Ultra fine grained titanium specimens were produced by equal channel angular pressing resulted in higher mechanical strength and hardness values than coarse grained titanium. Sand blasting procedure is used to improve surface roughness and consequently the osteointegration perofomenece for cell proliferation, the fixation in the bone, and the stability of the dental implant [1, 3]. In order to quantify and reveal the microstructure effect on the morphology, optical profilometer, stylus profilometer and scanning electron microscope techniques were used. Referernces 1. S.K. Moon, J.S. Kwon, S.W. Baik, G.R. Jeon, J.H. Ro, T.G. Eom, K.N. Kim, Advanced Materials Research, 647, 80 (2013) 2. K. Anselme, P. Linez, M. Bigerelle, D. Le Maguer, A. Le Maguer,P.Hardouin, Hildebrand, F. H. Iost, A., J.M. Leroy, Biomaterials, 21, 1567 (2000) 3. E. Conforto, B.O. Aronsson, A. Salito, C. Crestou, Materilas Science ans Engineering C, 24,611 (2004) 358

386 Poster Session, 20 June 2016, 17:30-18:00 PM Organic/inorganic nano-hybrids with high dielectric constant for organic thin film transistor applications Yang-Yen Yu, Ai-Hua Jiang, Chien-Hsun Chen Department of Materials Engineering, Ming Chi University of Technology, 84 Gunjuan Rd., Taishan Dist., New Taipei City 24301, Taiwan. Abstract The organic material, soluble polyimide and organic-inorganic hybrid polyimide (PI)-barium titanate (BaTiO 3) nanoparticles dielectric materials (PBX, where X is the concentration of BaTiO 3 nanoparticles in the polyimide matrix) were successfully synthesis through sol-gel process. The effects of various BaTiO 3 content on the hybrid film performances and optimizing the conditions were investigated. Furthermore, pentacene-based OTFTs with PI-BaTiO 3/ polymethylmethacrylate (PMMA) or cyclic olefin copolymer (COC) modified gate dielectrics were also fabricated and examined. The hybrid materials show well dispersion of BaTiO 3 nanoparticles in polyimide matrix and good thermal properties. The XRD diffraction patterns reveal that the BaTiO 3 nanoparticles have a perovskite structure. The hybrid films have a good formability and planarity. The PBX hybrid dielectric films have tunable dielectric constant values in range of 4.0 ~ 8.6 and the capacitance in range of 9.2 ~ 17.5 nf-cm -2. After adding the modified layer, the dielectric constant values and capacitances become slight smaller. The modified dielectric layer displays a hydrophobic surface (a large water contact angle) without producing crosslinking. The electrical characteristics of pentacene-based OTFTs were enhanced after the surface modification. The best condition of the dielectric layer is 10 wt% BaTiO 3 in hybrid film with the COC-modified layer; moreover, the device exhibit the threshold voltage of 0.12V, field effect mobility of cm 2 V -1 s -1, and on/off current of Referernces 1. Y. Wen, Y. Liu, Y. Guo, G. Yu, W. Hu, Chem. Rev. 111,3358 (2011). 2. H. Sirringhaus, Adv. Mater. 26,1319 (2014). 3. H. Klauk, Chem. Soc. Rev. 39,2643 (2010). 4. S.H. Chae, W.J. Yu, J.J. Bae, D.L. Duong, D. Perello, H.Y. Jeong, Q.H. Ta, T.H. Ly, Q.A. Vu, M. Yun, X. Duan, Y.H. Lee, Nat. Mater. 12,403 (2013). 5. L. Shan, D. Liu, H. Li, X. Xu, B. Shan, J.-B. Xu, Q. Miao, Adv. Mater. 27,3418 (2015). 6. V. Benfenati, S. Toffanin, S. Bonetti, G. Turatti, A. Pistone, M. Chiappalone, A. Sagnella, A. Stefani, G. Generali, G. Ruani, D. Saguatti, R. Zamboni, M. Muccini, Nat. Mater. 12,673 (2013). 7. C. Liao, F. Yan, Polym. Rev. 53,352 (2013). 359

387 Poster Session, 20 June 2016, 17:30-18:00 PM TiO 2-based hybrid thin films as gate dielectrics for organic thin film transistor applications Yang-Yen Yu, Su-nu liu, Yi Hsun Chiu Department of Materials Engineering, Ming Chi University of Technology, 84 Gunjuan Rd., Taishan Dist., New Taipei City 24301, Taiwan. Abstract We report on a systematic study of hydroxyl-containing polyimide (PI)-TiO 2 nanoparticles (NPs) hybrid dielectric materials, to determine the effects of TiO 2 NPs loadings (X) for X = 0, 2, 5, 8, 10, 13 and 15 wt%, on p-type pentacene organic thin film transistors (OTFTs). A condensation reaction to produce well-dispersed TiO 2 NPs within the PI matrix was followed by spin coating to form a dielectric thin film directly on a silicon substrate. The thermal, optical, surface, dielectric, and electrical properties of the PI-TiO 2 hybrid dielectric composite were correlated to TiO 2 content for each sample. The hybrid dielectric composites exhibit tunable insulating properties, including high dielectric constant, high capacitances, and low leakage current densities. Bottom-gate top-contact OTFTs fabricated using various PI-TiO 2 hybrid dielectrics, exhibit low threshold voltages, moderately high field-effect mobility rates, and high ON/OFF ratios. This study opens a route towards transparent and highly stable hybrid dielectric materials with tunable dielectric properties, by careful selection of NPs and polymer matrix combinations. Referernces 1. H.H. Hsu, C.Y. Chang, C.H. Cheng, Appl. Phys. A 112,817 (2013). 2. T. Shinya, L. Zhongda, T.P. Chow, Jpn. J. Appl. Phys. 52, 08JN24 (2013). 3. A.J. Ben-Sasson, G. Ankonina, M. Greenman, M.T. Grimes, N. Tessler, ACS Appl. Mater. Interfaces 5,2462(2013). 4. Y. Lu, C. Le Paven, H.V. Nguyen, R. Benzerga, L. Le Gendre, S. Rioual, F. Tessier, F. Cheviré, A. Sharaiha, C. Delaveaud, X. Castel, Cryst. Growth Des. 13,4852 (2013). 5. X. Zhao, S. Wang, A. Li, J. Ouyang, G. Xia, J. Zhou, RSC Adv. 4,14890 (2014). 6. G. Xia, S. Wang, X. Zhao, L. Zhou, J. Mater. Chem. C 1,3291(2013). 7. T. Wei, L. Jinhua, Z. Jiaqing, Z. Weimin, Y. Feng, G. Xiaojun, IEEE Electron Device Lett (2015). 360

388 Poster Session, 20 June 2016, 17:30-18:00 PM Synthesis of Monodisperse Silica Particles Using Rotating Cylinder System Young-Sang Cho, and Cheol Hwan Shin Department of Chemical Engineering and Biotechnology, Korea Polytechnic University, Siheung-si, Gyeonggi-do, Korea Abstract developed by various researchers for the applications of chemcial sensors, templates for porous materials, and colloidal crystals. For the synthesis of such particles, most researches have been carried out by adopting simple mechanical mixing during synthesis in batch-type reactor. In this study, Stober reactions for silica nanospheres were performed to control the diameter of the particles by adjusting the reaction parameters such as the amount of monomer and catalyst. The sol-gel reaction was carried out by varying the reaction temperature from 20 to 60 ºC using batch type Tylor vortex reactor. Figure 1a contains the schematic figure of rotating cylinder system for the synthesis of silica nanospheres with narrow size distribution. During the rotation of inner cylinder, the reactants are effectively mixed due to the formation of Taylor vortex in the annular region of the reactor. The number of vortices inside the reactor can be affected by the height of the cylinder, L, and the size of a vortex depends on the gap distance, d = R 2 R 1. Taylor vortex can be formed in the certain range of Taylor number, which can be defined as the following dimensionless group [1]. Ta d R R1d Figure 1b contains the scanning electron microscope image of monodisperse silica nanospheres synthesized using rotating cylinder system. The rotating speed of inner cylinder was fixed as 505 rpm and the sol-gel reaction was performed at room temperature. As contained in the SEM image, spherical silica nanospheres with about 250 nm in diameter was successfully synthesized with narrow size distribution. The detailed synthesis conditions are summarized in Table 1 as a reference sample. For particle synthesis, 9.27 ml of solution #1 was first loaded to Taylor vortex reactor and the mixing was performed for 20 minutes. Then, ml of solution #2 was added to the reactor for the formation of particles by Stober process. Fig1. (a) Schematic figure of rotating cylinder system (side view). (b) Scanning electron microscope image of monodisperse silica nanospheres synthesized using rotating cylinder system. The rotation speed of inner cylinder was fixed as 505 rpm. Scale bar indicates 1 µm. 361

389 Table 1. The Synthesis Conditions of Monodisperse Silica Nanospheres Shown in Fig. 1. #1 #2 Reaction Conditions NH 4OH H 2O EtOH TEOS EtOH Temperature RPM 1 ml 2.25 ml 19 ml ml 6 ml 20 C 505 For the control of particle size, the concentration of ammonia was adjusted to change the amount of the catalyst for sol-gel reaction. In solution #1, the volume of ammonium hydroxide was changed by 50 % or 150 % compared to the conditions shown in Table 1. By fixing the other reaction parameters, the size of silica particles could be controlled from 50 to 350 nm, as displayed in the electron microscope images of Figure 2. When small amount of ammonia was used, silica nanoparticles could be obtained, whereas nonspherical silica particles were formed for the sample prepared with excess amount of ammonium hydroxide, as contained in the morphologies of Figure 2. The spherical shape of silica colloid was not maintained when 150 % of NH 4OH was used as catalyst, implying that the aggregation of particles and successive growth resulted in the formation of triangular shapes shown in the SEM image of Figure 2b. Fig. 2. Scanning electron microscope image of monodisperse silica nanospheres synthesized using (a) 50 % and (b) 150 % of NH 4OH compared to the reference sample. Scale bars indicate 100 nm. Besides the amount of catalyst, the concentration of silica precursor was also adjusted to control the size of silica nanospheres. For this purpose, the volme of TEOS was changed by 75 % and 140 % compared to the amount shown in Table 1, and the resultant particle morphologies are displayed in Figure 3a and 3b. The monodispersity and spherical morphologies of silica nanospheres were maintained when the amount of TEOS was 75 % compared to the reference sample. However, the particles became nonspherical when the volume of TEOS increased to 140 %, implying that serious aggregation of particles proceeded during the particle synthesis due to the excess amount of precursor concentration. Fig. 3. Scanning electron microscope image of monodisperse silica nanospheres synthesized using (a) 75 % and (b) 140 % of TEOS compared to the reference sample. Scale bars indicate 2 µm and 100 nm, respectively. 362

390 The reaction temperature was also adjusted to examine the effect on the particle size. Figure 4a and 4b contain the electron microscope image of silica nanospheres synthesized at 40 and 60 C, respectively. As temperature increases, the diameter of silica particles decreased, as displayed in the SEM images. For instance, the particle size decreased to 200 and 100 nm when the Stober reaction was performed at 40 and 60 C, respectively. Since the number of nuclei increases as increasing temperature, the diameter of particles become smaller under fixed concentration of precursor. Thus, the decreasing size of silica nanospheres was observed with increasing reaction temperature, as contained in the graph of Figure 4c. Fig. 4. Scanning electron microscope image of monodisperse silica nanospheres synthesized at (a) 40 C and (b) 60 C. Scale bar indicates 100 nm. (c) The particle size of silica nanospheres as a function of reaction temperature. Acknowledgment This research was financially supported by a grant from the Ministry of Land, Infrastructure and Transport (MOLIT) of the Korean Government (14CTAP-C ). Referernces 1. T. Ogihara, G. Matsuda, T. Yanagawa, N. Ogata, K. Fujita, and M. Nomura, Journal of Ceramic Society of Japan 103, 151 (1995). 363

391 Poster Session, 20 June 2016, 17:30-18:00 PM Hybrid thin film of Ag nanowire and reduced graphene oxide prepared by H 2-low damage plasma as flexible transparent electrode Yin-Yin Wang, Chi-Hsien Huang Depatement of Mateirals Engineering, Ming Chi University of Technology, New Taipei City, Taiwan, R. O. C. Abstract Graphehe has great potential for the application of transparent conductive electrode (TCE) [1]. Several methods have been demonstrated to produe graphene. Among them, graphene oxide (GO) synthesized in large quantities from inexpensive graphite powder and solubilized in a variety of solvents is a good candidate for bulk production of graphene-based mateirals [2]. Unfortunately, the presence of oxygen functional groups in GO limits its application to TCE. In order reduce GO to graphene to increase its conductivity, many reducing agents have been proposed such as N 2H 4, NaBH 4 [3,4]. However, the reduction of GO with these chemical is time-consuming, unfreiendly to environment, and often requiring addition annealing procedures. Hydrogen plasma treatment is very effective to remove these oxygen functional groups due to the generation of atomic hydrogen [5]. However, high energetic ions and vacuum ultravioletdamage such atomically thin materials easily leading to poor controllability of reduction or even damage. In this study, we propose hydrogen low damage plasma treatment (H 2-LDPT) as shown in Fig. 1. A filter is inserted between incudtively coupled plasma (ICP) and sample efficiently shielding against ions and VUV radiation with high energy, which cause the maximum damage to graphene. This allows only radicals, which have the highest reactivity among plasma-generated species, to diffuse through the filter with extremely low kinetic energy and reach the GO films to gently reuduce them. Fig. 1. Schematic of H 2 low damage plasma treatment (H 2-LDPT). GO was purchased from Graphenea S.A.. GO films were prepared by spin coating the aqueous suspension diluted by methanol on PET or quartz substrates. After coating, the GO films was heated at 100 o C for 2 mins to remove the solvents thoroughly. A MHz radio frequency at a power of 200 W was applied to the coil to generate high-density plasma. The chamber pressure was maintained at 300 mtorr. A gas mixture of Ar and H 2 was introduced during LDPT to reduce GO films at 100 o C. Figure 2 shows the sheet resistance after H 2-LDPT with treatment time of 5, 10, and 30 mins. The results show that the sheet resistance of rgo films drastically decreased to aroud 100kΩ/. The transmittance at 550nm is more than 75%. At present, both sheet resistance and transmittance are not good enough for transparent conductive thin film. Ag nanowire is an alternative transparent electrode with high transparency and low 364

392 resistance. However, its high surface roughness and early failure rate inhibits its application to TCE. In the future, we will embed Ag nanowire into rgo films to obtain flexible transparent electrode through combining the flexibility of rgo and the low resistance of Ag nanowire. Fig. 2. Sheet resistance of GO treated by H 2-LDPT for various treatmet time. Referernces 1. X. Wang, et al., Nano Letters 8, 323 (2008) 2. C. Mattevi, et al., Advanced Functional Materials 19, 2577 (2009) 3. S. Gilje, et al., Nano Letters, 7, 3394 (2007) 4. H. Shin, et al., Advanced Functional Materials 19, 1987 (2009) 5. C. Gomez-Navarro, et al., Nano Letters, 7, 3499 (2007) 365

393 Poster Session, 20 June 2016, 17:30-18:00 PM Functional Iron Oxide/Graphene Oxide Nanocomposites with Magnetically and Photothermally External Trigger for Enhanced Gene Transfection Yi-Zhen Lin 1, Ming-Yu Chiang 2, Huai-En Lu 2 and San-Yuan Chen 3 1 Institute of Biomedical Engineering, National Chiao Tung University, Hsinchu 30010, Taiwan, ROC. 2 Department of Materials Science and Engineering, National Chiao Tung University, Hsinchu 30010, Taiwan, ROC. 3 Bioresource Collection and Research Center, Food Industry Research and Development Institute, Hsinchu, Taiwan, ROC. Abstract Gene delivery has great potential for the treatment of various acquired or congenital diseases. Virus are the most common tools for gene delivery because of their high efficiency of transduction, but usually taking the serious safety risks, such as tumorigenicity and uncontrolled gene expression. To avoid these safety issues, many investigators focus on the delivery of genetic material using non-viral vectors. In contrast to the viral gene delivery systems, the nonviral vectors are expected to be nearly no immune responses, with simplicity in preparation, specificity and no limitation in cargo capacity. However, the low transfection efficiency of non-viral vectors is the main problem and that is difficult to carry genes into cells, not to mentioning multiple genes or large plasmids (i.e., CRISPR/Cas9 or Episomal plasmids) into cells. Although many non-viral vectors, including liposome, calcium phosphate, have been successfully developed for transfection of various adherent cell lines, some types of cells such as primary cells and suspension cells are still hard to transfect. Therefore, the development of efficient non-viral carriers to solve those difficulties in transferring cells becomes important. In this work, we developed a multifunctional non-viral vector integrated nanoscale graphene oxide (ngo) and superparamagnetic iron oxide nanoparticles (Fe 3O 4) for carrying genes into suspension cells. The ngo-fe 3O 4-PEI-pDNA nanocomposites were fabricated by first chemical depositing Fe 3O 4 onto ngo shows to figure 1, and coating branch 25k polyethylenimine (PEI) through electrostatic interaction. The characterizations of transmission electron microscopy images of ngo- Fe 3O 4 hybrids. And, the figure 2 shows the size and zeta potential of measured ngo-fe 3O 4-PEI-pDNA was determined size and surface charge. The figure 3 illustrates the experimental concept by magnetic stirring to enhance the attachment and uptake of functional ngo-fe 3O 4-PEI nanocomposites on the surface of suspension cells. It was found that the cells showed no significant damage after NIR irradiations at 0.25 mw for 30 min by using calcein-am & EthD-1 dual staining. The in-vitro study further demonstrated that ngo-fe 3O 4-PEI-pDNA nanocomposites showed exhibit relatively high gene transfection efficiency and low cytotoxicity on suspension cells (THP-1) in comparison with commercial vector lipofectamine The experimental results showed that the ngo-fe 3O 4-PEI 366

394 nanocomposites can be served as an appropriate non-viral gene vector to treat suspension cells. That means this multifunctional non-viral vector might be probably provided as a transfection tool for stem cell reprogramming. Fig1. Transmission Electron Microscopy (TEM) images of ngo-fe 3O 4 hybrids. (Scar bar =50 nm) Fig2. DLS analysis for mean diameter, and Zeta potential of ngo, ngo-fe 3O 4, ngo-fe 3O 4- PEI and ngo-fe 3O 4-PEI-pDNA. Fig3. Schematic diagram of intracellular trafficking of non-viral gene transfer nanoparticles. 367

395 Referernces 1. Hummers WS, Offeman RE, Preparation of graphitic oxide, J Am Chem Soc., 80 (6), pp (1958). 2. Xiaoying Yang, Xiaoyan Zhang, Yinsong Wang and Yongsheng Chen. Superparamagnetic graphene oxide Fe 3O 4 nanoparticles hybrid for controlled targeted drug carriers, Journal of Materials Chemistry., 19, pp (2009). 3. Xia Cao, Wenwen Deng, Non-Viral Co-Delivery of the Four Yamanaka Factors for Generation of Human Induced Pluripotent Stem Cells via Calcium Phosphate Nanocomposite Particles Adv. Funct. Mater, 23, pp (2013). 368

396 Poster Session, 20 June 2016, 17:30-18:00 PM The Studies of Nano-shaped Hyaluronan on Chondrogenesis of ATDC5 Cells Min Kao, Jyun Wei Chang, Shu Ying Chen, Huoy Rou Chang, Shwu Jen Chang Departmen of Biomedical Engineering t, I-Shou University, Kaohsiung, Taiwan (R.O.C.) Abstract During the past decades, many researchers have investigated various stem cells based cell therapies to treat many diseases. A few studies suggest that progenitor cells in osteoarthritis patients play a role of stimulating progenitor migration and proliferation in degenerating cartilage. In addition, some studies showed that chondrogenic progenitor cells (CPCs) exhibit several stem cell characteristics, such as differetiation activity. CPCs may have a potential to repair damaged cartilage despite the limited self-repairing capacity of cartilage [1]. In this study, we attempt to stimulate ADTC 5, which in vitro initially retained properties of chondroprogenitor cells, by nano-shaped hyaluronan. Hyaluronan is one of the most components of the ECM in articular cartilage tissue. The techniques to prepare hyaluronan nano-scale molecules, including particles and fibrils, have been established in our laboratory using high-voltage electrostatic field stimulation [2]. In this study, we aimed to extend the knowledge that is based on these preliminary results to explore the effects of nano-shaped hyaluronan on chondrogenesis of ATDC5 cells. The study was designed to culture the the cartilage precursor cell lines (ATDC5). Observations from transmission electron microscopy shows that good spherical shape and well dispersed hyaluronan nanoparticles ranging from about 5 nm in diameter could be produced under certain experimental settings (Figure 1). MTT cell activity results showed that it was no significant difference in all groups in 2D culture. Proteoglycans analyses showed that hyaluronan groups are positive in the extracellular matrix of cartilage precursor cells (Figure 2). The applications of the nano-shaped hyaluronan molecules in ATDC5 cells culture have great potential for further development. Fig. 1. TEM observation of hyaluronan nanoparticles. 369

397 Fig. 2. Alcian blue staining result in two-dimensional culture. Referernces 1. H.J. Ahn, H.J. Kim, M.C. Lee, MD, Surface characterization and chondrogenic differentiation of mesenchymal stromal cells derived from synovium, Cytotherapy, Pages (2007). 2. Shyh Ming Kuo, Ming Yu Chiang, Cheng Wen Lan, Gregory Cheng-Chie Niu, Shwu Jen Chang, Evaluation of nanoarchitectured collagen type II molecules on cartilage engineering, Society for Biomaterials (2012). 370

398 Poster Session, 20 June 2016, 17:30-18:00 PM Preparation and Characterization of a Novel Two-layer Cardiac Patch with electrical stimulation Jou-Hsuan Chu 1, Ming-Wen Sue 1, Yu-Hsin Lin 2, Shu-Ying Chen 1, Shwu-Jen Chang 1 1 Department of Biomedical Engineering, I-Shou University, Kaohsiung, Taiwan 2 Cardiovascular Surgery, Department of Surgery, Kaohsiung Veterans General Hospital, Kaohsiung, Taiwan Abstract As known, myocardial tissue has limited self-repair ability due to its loss of differentiation characteristic for most mature cardiomyocytes, which causes the injury on myocardial is difficult to cure even the current treatment methods also have their limitations. Current therapies, including medicine and other mechanical supports, are able to control the severity of heart failure, but not to reverse the function of the damaged heart muscle. Traditional myocardial patch material, such as Dacron patch, can only provide long-term durability and convincing mechanical strength, but no benefit in myocardial regeneration and heart contractility. Recently, many studies have designed funtional substrates to create a bio-mimetic environment for cardiac stem cell differentiation [1,2]. PLGA (Poly (DL-lactide-co-glycolide)) has been widely used in tissue engineering for its well- known characteristics of good biocompatibility, biodegradation with no cytotoxicity and easy to prepare on different substrates [3]. In addition, many researches support that electrical stimulation can successfully induce stem cells to differentiate into cardiomyocyte-like cells in vitro [4]. In this study, a new type of cardiac patch consists with micro-structural features and electrical stimulation system which enhance cardiac-like physiological environment was fabricated to evaluate the festibility on the myocardial tissue engineering. The two-layer PLGA patch with screen-printed carbon electrode was shown in Figure 1. The prelimery results showed that the wettability of scarffold with PLGA/NaCl(1/5) and PLGA/NaCl(1/7) were 49.90±1.62% and 61.52±2.09% respectively (Figure 2). The porosity of PLGA/NaCl(1/5) and PLGA/NaCl(1/7) were 84.71±0.98% and 92.46±1.43% respectively (Figure 3). The scanning electron microscope (SEM) was used to investigate the morphology of electrode on membrane and PLGA scaffold, and energydispersive X-ray spectroscopy (EDX) was used to demonstrate the sodium chloride residual. The SEM images of PLGA sarffold are shown in Figure 4. The sponge samples have a pore size about 100 m. EDX results showed no residual of sodium chloride in the scarffold. The electroactivity (inferred by redox activity) of PLGA membrane with screen-printed carbon electrode was evaluated using cyclic voltammetry (CV). CV result indicated that PLGA membrane with screen-printed carbon electrode can undergo redox chemistry. Given this form of electroactivity, PLGA membrane with screen-printed carbon electrode may have the ability to pass a current. The two-layer functional layers were combined together to make a complex cardiac patch as shown in Figure 7. The preliminary results demonstrated that the two-layer cardical patch with electrical stimulation system could be fabricated by the current process. To estimate the feasibility of this composite cardiac patch, the effects of the related factors from electrical stimulation on the differentiation of stem cell 371

399 into cardiomyocytes will be examined in the future. Fig. 1. Schematic illustration on the overall design of functional cardiac patch Fig. 2. The wettability of PLGA scaffolds Fig. 3. The porosity of PLGA scaffolds Fig. 4. SEM micrographs of the scarffold: (a)plga/nacl 1:5 and (b) PLGA/NaCl 1:7 372

400 cps/ev cps/ev C O Na Cl Cl C O Na Cl kev kev Fig. 5. The EDX of PLGA scarffold: (a) PLGA/NaCl(1/5), (b) PLGA/NaCl(1/7) Fig. 6. The PLGA membrane with screen-printed carbon electrode by cyclic voltammetry Fig. 7. The prototype of the cardical patch with screen-printed carbon electrode Referernces 1. Ming-Chia Yang, Shoei-Shen Wang, Nai-Kuan Chou, Nai-Hsin Chi, Yi-You Huang Yu-Lin Chang, Tze-Wen Chung; Biomaterials 30 (2009) Ming-Chia Yang, Nai-Hsin Chi, Nai-Kuan Chou, Yi-You Huang, Tze-Wen Chung, Yu-Lin Chang, Hwa-Chang Liu, Ming-Jium Shieh, Shoei-Shen Wang; Biomaterial 31 (2010) Xiaoming He, Naoki Kawazoe, and Guoping Chen (2014); Preparation of Cylinder- Shaped Porous Sponges of Poly(L-lactic acid), Poly(DL-lactic-co-glycolic acid), and Poly(ε-caprolactone) 4. Chun-Wen Hsiao, Meng-Yi Bai, Yen Chang, Min-Fan Chung, Ting-Yin Lee, Cheng-Tse Wu, Barnali Maiti, Zi-Xian Liao, Ren-Ke Li, Hsing-Wen Sung; Biomaterials 34 (2013)

401 Poster Session, 20 June 2016, 17:30-18:00 PM Synthesis the humidity sensitive biocompatible electrode implant substrate with Ca-Al- LDH/OPC/PVA material Chun-Sian Yu, Wei-Chin Huang, Po-Hsueh Chang and San-Yuan Chen Department of Materials Science and Engineering, National Chiao Tung University, Hsinchu City 30010, Taiwan (R.O.C) Abstract Common implant substrate usually face the mechanical misfit and biocompatible problem, this problem will cause inflammation and slow the curing process, so we synthesis the substrate which has great mechanical property that is stiffness enough before implant in body and soften after implant in body and also has great biocompatibility We choose layered double hydroxide(ldh), Poly(vinyl alcohol) and Oligomeric proanthocyanidins (OPC) as material. LDH have extreme low bio toxic[1] and OPC as an antiinflammatory drug. We synthesis Ca-Al layered double hydroxides (Ca-Al-LDH)(Fig.1) by using by coprecipitation method[2], and OPC absorb on the Ca-Al-LDH surface (Ca-Al-LDH-OPC) by electrical attraction, than hybrid with PVA solution so that the PVA will form the hydrogen bond and bind on the Ca-Al-LDH-OPC surface, than remove the excess PVA by centrifugal, dispered the Ca-Al-LDH-OPC in solution and dry in 50 oven.(fig.2) When the substrate immerse in water, water molecular will get into Ca-Al-LDH-OPC and PVA interface and weak the hydrogen bonding, so with this property we can make three order s Young s modulus difference.(fig.3) Fig. 1. Ca-Al-LDH SEM 374

402 Fig. 2. Ca-Al-LDH-OPC/PVA film structure Fig. 3. Ca-Al-LDH-OPC/PVA film Stress-strain curves (a)before dip in PBS solution (b)after dip in PBS solution Referernces 1. Kura, Aminu Umar, et al., International journal of molecular sciences 15, (2014) 2. Chang, Po Hsueh, et al., "ChemSusChem 6, (2013) 375

403 Poster Session, 20 June 2016, 17:30-18:00 PM Growth of various size and configuration of Pd nanostructures on Si (111) by the control of Pd deposition amount at various annealing temperature. Puran Pandey, Mao Sui, Quanzhen Zhang, Sundar Kunwar, Ming-Yu Li and Jihoon Lee College of Electronics and Information, Kwangwoon University, Nowon-gu Seoul 01897, South Korea Abstract Owing to the efficient optical properties, metallic nanoparticles (NPs) demonstrate the effective light absorption as well as emission. Thus, the fabrication of metallaic NPs on Si-based optoelectronics devices can significantly improve the performace of the related devices applications such as LEDs, [1] solar cell, [2] photo-catalyst, [3] and sensor. [4] In this article, the fabrication of various size and configuration of Pd nanostructures on Si (111) is studied by the systematic control of Pd deposition amount on Si (111) at various annealing temperatures. Upon the annealing of various Pd deposition between 0.5 and 100 nm, four different configuration of Pd nanostructures have been demonstrated. Initially, small pits and grains were formed with low amount of Pd deposition amount between 0.5 and 1 nm. Furthermore, with the increased Pd deposition amount, the nucleation of and growth of Pd NPs (between 2 and 7 nm), lateral growth of Pd NPs (between 10 and 15 nm) and merged nanostructures (between 2 and 7 nm). The evolution of various configuration of Pd nanostrucutures have been studied based on based on the thermal diffusion, Volmer-weber growth model and surface energy minimization mechanism. [5] The effect of annealing time between 45 and 3600 s demonstrated the evolution of Pd nanostructures based on the based on the Ostwald s ripening. [6] The surface morphology of corresponding Pd nanostrucutres is characterized by atomic force microscope (AFM), optical by Raman spectroscopy and the elemental analysis by energy dispersive X-ray spectroscopy (EDS). Acknowledgements Financial support from the National Research Foundation of Korea (no and 2016R1A1A1A ), and in part by the research grant of Kwangwoon University in 2016 is gratefully acknowledged. Referernces 1. S. Pillai, K. R. Catchpole, T. Trupke, G. Zhang, J. Zhao and M. A. Green, Applied Physics Letters, 88, (2006). 2. T. F. Villesen, C. Uhrenfeldt, B. Johansen and A. N. Larsen, Nanotechnology, 24, (2013). 3. K. H. Leong, H. Y. Chu, S. Ibrahim and P. Saravanan, Beilstein journal of nanotechnology, 6, (2015). 376

404 Poster Session, 20 June 2016, 17:30-18:00 PM Electrically Driven Alignment and Drug Delivery of Conductive Microcapsule in Hydrogel Min-Yu Chiang 1, Yi-Zhen Lin 2, San-Yuan Chen 1 1 Department of Materials Science and Engineering, National Chiao Tung University, Hsinchu, Taiwan minyu28@gmail.com 2 Institute of Biomedical Engineering, National Chiao Tung University, Hsinchu, Taiwan Abstract Hydrogels are often used as scaffolds in the field of tissue engineering due to their high water content, biocompatibility, and biodegradability [1]. For the electroactive tissue engineering application, hydrogels might usually require additional properties, such as electrical conductivity, mechanical, and controllable bioactive properties. To control the mechanical and electrical properties of hydrogels, many investigators utilized nanomaterials, such as carbon nanotubes[2] and nanowires[3], to improve the electrical and mechanical properties of hydrogels [4]. However, these hydrogels usually lack specific bioactive functions for mimicking native electroactive tissues, such as encapsulation and controllable delivery of biological and chemical cues. In this study, we proposed the bioactive and electroactive scaffold fabrication by protein drug encapsulated conductive microcapsule and microcapsule alignment within hydrogel on a multifunctional platform. This scaffold can be served as a good culture platform in electroactive tissue engineering. The biodegradable, biocompatible, and conductive porous PLGA microcapsules with reduced graphene oxide (rgo)/ silk-poly-l-lysine (silk-pll) layer-by-layer (LbL) assembly encapsulating protein drug are aligned within photo-curable hydrogel between two parallel transparent and conductive plates, i.e., indium tin oxide (ITO), with comb electrode to integrate dielectrophoretically aligned microcapsule, electrically triggered drug delivery, and controlled electrical and mechanical properties into a multifunctional platform for electrically active tissue regeneration. Here, we successfully synthesized porous PLGA microcapsule and fabricated conductive PLGA microcapsule by LbL assembly. The conductive PLGA microcapsule was also successfully aligned within photo-curable hydrogel by dielectrophoresis. In this study, the platform integrates multifunction including microcapsule alignment, electric-triggered drug delivery, and electroactive substrate that can be applied on electroactive tissue engineering. The conductive PLGA microcapsule with porous or non-porous structure was synthesized by double emulsion process. Non-porous microcapsule was synthesized without adding porogen agent- PEI (25 kda branched PEI). The morphology of non-porous microcapsule was observed by SEM, as shown in Fig. 1a. Microcapsule with surface porosity were generated using positively charged polymer PEI in the outer aqueous phase during the fabrication process, as shown in Fig. 2b. PEI, an osmotically active polycation, increases the porosity by pulling water from the core of microcapsule to the outside of microcapsule during emulsification. Subsequent removal of this water by lyophilization results in the formation of pores on the microcapsule surface. This assumption agrees with other published studies suggesting that surface porosity results from increased osmotic pressure in the outside aqueous phase [5, 6]. In addition, PEI also modified the surface of microcapsule to be positive charge for further LbL assembly. The (rgo/silk-pll)3.5 LbL assembly was performed by electrostatic interaction, the negatively charged rgo and positively charged silk-pll were layer-by-layer coated on the microcapsule surface. The SEM images in Fig. 2c and Fig. 2d show that the surface of the nonporous and porous microcapsule after assembly with rgo /silk-pll molecules, respectively, displayed a rough texture, implying that the rgo layer was adsorbed on microcapsule. The coating quality was directly dependent on the concentration of silk-pll and rgo, the lateral length of the rgo sheet, and the coating time. The significant roughness enhancement are 377

405 showed in the enlarged SEM images (Fig. 2e and 2f). For visualized observation, the rgo was conjugated with red fluorescent dye- rhodamine 6G (R6G) for microscope observation. From the Fig. 2g and Fig. 2h, rgo-r6g was successfully coated on the surface of non-porous and porous microcapsule after LbL assembly. Fig. 1. Schematic illustration of conductive microcapsule synthesis and the platform for microcapsule electrical alignment. (a) Synthesis of conductive microcapsule with (rgo/ silk- PLL)3.5 LbL assembly. (b) The process of microcapsule alignment by DEP manipulation. Fig. 2. Morphology observation of non-porous and porous microcapsule before and after (rgo/ silk-pll)3.5 LbL assembly. (a)-(f) were captured by SEM and (g)-(h) were captured by fluorescence microscope. (a), (b) are non-porous microcapsule and porous microcapsule before LbL assembly, respectively. (c), (d) are non-porous microcapsule and porous microcapsule after LbL assembly, respectively. (e), (f) are high magnification of porous microcapsule after LbL assembly. (g), (h) are fluorescence images of non-porous microcapsule and porous microcapsule after LbL assembly, respectively. The red color indicates rgo-rhodamine and the green color indicates protein drug FITC-BSA. The DEP approach was used to pattern conductive microcapsule within the GelMA hydrogels, as shown in Fig.3d and Fig. 3f. AC electric fields appeared to induce dipole moments within conductive microcapsule and forced them to align in the direction of the electric field. Note that the microcapsule were attached together and aligned alone the electric field direction. By adjusting voltages and frequencies, conductive microcapsule could be successfully aligned within GelMA hydrogels (using 1 MHz and 10 Vpp, respectively) by applying current through an interdigitated array of ITO electrodes. Fig.3. Conductive microcapsule encapsulated within hydrogel before and after DEP alignment. (a) and (c) Random conductive microcapsule suspended within hydrogel before DEP alignment. (b) and (d) conductive microcapsule alignment within hydrogel after DEP manipulation. (a)-(b) bright images. (c)-(d) fluorescent images. 378

406 In this study, we successfully synthesized conductive porous microcapsule encapsulating protein drug by double emulsion and LbL assembly by electrostatic interaction. By adding PEI in the process of double emulsion, the porous structure of microcapsule can be obtained by osmotic pressure, and result in the positive charge of the microcapsule surface. The conductive microcapsule can be aligned to form particle chain within hydrogel by applied an AC signal (1 MHz, 10 Vpp). The formed hydrogel substrate can be used for electroactive cell culture. Referernces 1. B. V. Slaughter, S. S. Khurshid, O. Z. Fisher, A. Khademhosseini, N. A. Peppas, Hydrogels in Regenerative Medicine, Adv. Mater. 21, 3307 (2009). 2. F. J. Rawson, C. L. Yeung, S. K. Jackson, P. M. Mendes, Tailoring 3D Single-Walled Carbon Nanotubes Anchored to Indium Tin Oxide for Natural Cellular Uptake and Intracellular Sensing, Nano Lett., 13, 1 (2012). 3. A. K. Shalek, J. T. Gaublomme, L. Wang, N. Yosef, N. Chevrier, M. S. Andersen, J. T. Robinson, N. Pochet, D. Neuberg, R. S. Gertner, I. Amit, J. R. Brown, N. Hacohen, A. Regev, C. J. Wu, H. Park, Nanowire-mediated delivery enables functional interrogation of primary immune cells: application to the analysis of chronic lymphocytic leukemia, Nano Lett., 12, 6498 (2012). 4. T. Dvir, B. P. Timko, D. S. Kohane, R. Langer, Nanotechnological strategies for engineering complex tissues, Nat. Nanotechnol., vol. 6, pp , K.F. Pistel, T. Kissel, Effects of salt addition on the microencapsulation of proteins using W/O/W double emulsion technique, J. Microencapsul., 17, 467 (2000). 6. H.B. Ravivarapu, H. Lee, P.P. DeLuca, Enhancing Initial Release of Peptide from Poly(d,llactide-co-glycolide) (PLGA) Microspheres by Addition of a Porosigen and Increasing Drug Load, Pharm. Dev. Technol., 5, 287 (2000). 379

407 Poster Session, 20 June 2016, 17:30-18:00 PM Preparation and Evaluation of Gellan Gum/Mebeverine microspheres on the treatment of irritable bowel syndrome Chin-Yi Yang, Ming-Liang Tseng, Shu-Ying Chen, Shwu-Jen Chang Department of Biomedical Engineering, I-SHOU University, Kaohsiung, Taiwan Abstract Irritable Bowel Syndrome (IBS) is common gastrointestinal disorder with symptoms and signs of cramping, abdominal pain, increased gas, altered bowel habits, food intolerance, and bloating. Diet modifications and lifestyle changes are the first treatment for IBS. If these do not adequately treat IBS symptoms, medicine may be used to manage symptoms of IBS. However, before arrival at the intestine, the effectiveness of the medicine decreases because of digestive of gastric acid. To provide more effectiveness of the medicine, microencapsulation has the potential to protect the medicine from the digestive of gastric acid. Microspheres could provide larger surface area for possess easy estimation of diffusion and mass transfer behaviors. Therefore, microspheres could be more favorably used as drug delivery encapsulating material in biomedical field. Gellan gum is produced by a non-pathogenic strain of Sphingomonas elodea. Its main chain consists of four repeating carbohydrates, including two D-glucose, one L-rhamnose, and one D-glucuronic acid. Recently, gellan gum has been investigated as a candidate biomaterial for tissue engineering, guided bone regeneration, drug-carrier matrices, gene delivery agents and cell-carrier materials. Gellan gum is characterized by its unique gelling behavior that involves temperature-dependent hydrogen bonding and cation-induced electrical incorporation. In addition, gellan gel showed the compatibility with the human body in the long-term fate. In this study, gellan gum/mebeverine microshperes were fabricated by w/o emulsion technique. The preliminary results showed that microspheres had particle size distribution between μm in diameter and exhibited roundness. The relative swelling of microspheres was determined by different ph medium. The results demonstrated that the swelling ratio of gellan gum microspheres in alkaline medium was higher than in acidic medium. The drug release results showed that the drug release from microsphere in the stomach condition (ph1.2 media) and in the intestine condition (ph6.4 and 7.2) was about 4.88 ± 0.38% and ± 0.26%, respectively. It indicated that gellan gum microshperes could protect the drug from digestive of gastric acid and release the medicine in the intestine. The study demonstrated that gellan gum/mebeverine microspheres have the development potential as intestinal-specific drug delivery system in the treatment of IBS. 380

408 Fig. 1. The swelling behavior of the microspheres in the different ph medium. (A) ph 1.2, (B) ph 6.4, (C) ph 7.2 Referernces 1. P. L. Lam, R. Gambari. Advanced progress of microencapsulation technologies: In vivo and in vitro models for studying oral and transdermal drug deliveries. Journal of Controlled Release; Volume 178, 28 March 2014, Pages Vipul D. Prajapati, Girish K. Jani, Bhumi S. Zala, Tohra A. Khutliwala.An insight into the emerging exopolysaccharide gellan gum as a novel polymer. Carbohydrate Polymers; Volume 93, Issue 2, 2 April 2013, Pages

409 Poster Session, 20 June 2016, 17:30-18:00 PM Controllable Fabrication of Nanoholes on c-plane GaN by Tuning the Configuration Au Nanostructures as Catalysts Mao Sui, Puran Pandey, Ming-Yu Li, Quanzhen Zhang, Sundar Kunwar and Jihoon Lee College of Electronics and Information, Kwangwoon University, Nowon-gu Seoul , South Korea Abstract As one of the most important third-generation semiconductor material that can operate at high temperatures and voltages, GaN has been extensively studied since the GaN-based efficient blue light emitting diode was firstly introduced in Nowadays, GaN based materials are widely used in various optoelectric applications, for example short-wavelength light emitting diodes (LEDs), field-effect transistors (FETs), high-electron-mobility transistor (HEMTs), and other microwave devices. [1-4] Recently, porous GaN has attracted considerable research attentions owing to the protential to be designed for specific applications with unique optical and electronic properties. [5] In this work, we demonstrate a method of manufacturing nanoholes on GaN using thermal annealing in which the controllablly fabricated Au nanoparticles are employed as catalyst. Figure 1 shows the Au nanostructures and nanoholes fabricated on c-plane GaN. At relatively low temperature, Au nanoparticles are formed by solid state dewetting via surface diffusion. And at higher temperature, the Au can lead to an enhanced decomposition of the GaN at the located sites. The density and size can be well controlled by the Au nanoparticles as catalysts. Fig1. Au nanoparticles and nanoholes fabricated on the c-plane GaN at 650 and 900 C. 382

410 Acknowledgements Financial support from the National Research Foundation of Korea (no and 2016R1A1A1A ), and in part by the research grant of Kwangwoon University in 2016 is gratefully acknowledged. Referernces 1. Strite, S. & Morkoç, H. J. Vac. Sci. Technol. B 10, (1992). 2. Nakamura, S. et al. Jpn. J. Appl. Phys. 35, L74-L76 (1996). 3. Pearton, S. J. & Ren, F. Adv. Mater. 12, (2000). 4. Monroy, E. et al. Semicond. Sci. Technol. 17, L47-L54 (2002). 5. Omar, K., Hassan, Z., Goh, K., Teh, H. & Hassan, H. A. Modern Applied Science 3, (2009). 383

411 Poster Session, 20 June 2016, 17:30-18:00 PM Studies on oxidation of adrenaline using CuPc encaged in MCM-41 zeolite as catalyst Mingtian Li, Hong Wang, Min Gong College of Materials and Chemical Engineering, Sichuan University of Science and Engineering, Zigong, China Abstract The CuPc-MCM composite formed by copper phthalocyanine (CuPc) encaged in MCM-41 mesoporous molecular sieves was prepared by impregnation method in acetone solution. And the catalytic efficiency of adrenaline (AD) oxidation using CuPc-MCM as catalyst was evaluated by UV-Vis spectroscopic analysis. The influence factors of catalytic efficiency, such as reaction time and temperature, the ph value of solution and the amount of catalyst, have been investigated. In 0.1 M PBS at ph 8.0, AD shows two bands in the UV range at 217 and 279 nm in figure 1, while the curves of (b-g) show the spectra obtained during the oxidation of AD catalyzed by CuPc-MCM. During the oxidation two bands appear progressively at about 298 and 266 nm until they completely overlap the band at 280 nm, which are assigned by Heacock to the characteristic absorption of adrenochrome, [1] which is similar to the phenomena of the free MPc as the catalyst. [2] Fig. 1. UV/Vis spectra of AD using CuPc-MCM as catalyst (a g: 0, 20, 40, 60, 80, 100, 120 min), ph = 8.0, T = 55 o C, [AD] = M, m CuPc-MCM = 3.0 mg. The rate of oxidation was evaluated by η = It/Ic, where It and Ic were the absorbances of the mixture solution at 298 nm after t minutes reaction and after complete oxidation of AD. The results of evaluation on incubation time, ph value of solution, temperature and the catalyst were shown in figures 2 to 5, respectively. 384

412 It can be seen from figure 1 that η first increased remarkably in 120 min, then decreased. The decline might be that adrenochrome proceeded with the structural transformation.[3] While η increased gradually from ph 3.0 to 8.0, and then declined when ph was over 8.0. So, the optimal ph value was 8.0. The reason for the poor catalyzing ability in low ph environment is probably that the acid environment is not advantageous to the coordination of AD and O2 to metal center and the formation of AD 2+.[4] Fig2. Effect of time on the catalytic efficiency. ph = 8.0, T = 55 o C, [AD] = M, m CuPc-MCM = 3.0 mg Fig3. Effect of ph on the catalytic efficiency. T = 50 o C, [AD] = M, t = 60 min, m CuPc-MCM = 3.0 mg Fig4. Effect of temperature on the catalytic efficiency. ph = 8.0, [AD] = M, t = 60 min, m CuPc-MCM = 3.0 mg Fig5. Effect of CuPc-MCM amount on the catalytic efficiency. T = 55 o C, ph = 8.0, [AD] = M, t = 60 min The temperature dependence of catalytic activity was shown in figure 4. As temperature increased, η increased rapidly from 40 to 50 oc, then decreased, which is in accordance with the enzyme feature. Thus, the optimal temperature was 50 oc. The effect of catalyst amount on the catalytic activity was shown in figure 5. It indicated that η increased with the addition of CuPc-MCM. The activity was above 75 % at 3.0 mg, which is coincident with the reported results. [2] Hence, 3.0 mg was used throughout the other parts of experiment. 385

413 In conclusion, CuPc-MCM can effectively catalyze the oxidation of adrenaline. The optimal reaction conditions were as follows: ph = 8.0, m CuPc-MCM = 1.5 mg/ml, T = 50 o C. Referernces 1. R.A. Heacock, C. Nerenberg and A. N. Payza, Can. J. Chem. 36, 853(1958). 2. M.T. Li, J. Huang, R.S. Yang, L.Y. Yu and X. Zhou, Chin. J. Inorg. Chem., 26, 2069 ( 2010). 3. B.A. Heacock, Advan. Heterocycl. Chem., 5, 205 (1965). 4. D.G. Graham, Mol. Pharmacol., 14: 633 (1978). 386

414 Poster Session, 20 June 2016, 17:30-18:00 PM Evolution of the Self-Assembled Au Nanoparticles by controlling Annealing Temperature and Dwelling Time on Sapphire (0001) Substrate Quanzhen Zhang 1, Puran Pandey 1, Mao Sui 1, Ming-Yu Li 1, Sundar Kunwar 1, and Jihoon Lee 1,2 1 College of Electronics and Information, Kwangwoon University, Nowon-gu Seoul , South Korea 2 Institute of Nanoscale Science and Engineering, University of Arkansas, Fayetteville AR 72701, USA Abstract Fig. 1. Illustration of the self-assembled Au nanostructures and NPs evolution by controlling the annealing temperature (AT) and the dwelling time (DT) on sapphire (0001). (a) (c) Three dimensional (3-D) side-views of atomic force microscope (AFM) images (1 1 μm 2 ) of the pre-annealed sample surface (a) and the Au nanostructures with 3 nm deposition annealed at 300 and 800 o C with the DT of 450 s. (d) and (e) AFM 3-D side views of sample surface with the deposition amount (DA) of 2.5 nm annealed at 950 ºC with diverse DT of 900 and 1800 s. (a-1) (e-1) Cross sectional line-profiles of the corresponding samples indicated with the green lines in (a) (e). Au nanoparticles (NPs) with characteristic localized surface plasmon resnonce (LSPR) have been widely used in the electrochemical and biological sensors [1,2] as well as the optoelectronic devices, [3,4] in which the performance of these devices strongly depend on the size, density and shape of the Au NPs. On the other hand, the Au NPs have exhibited great potentials in the fabrications of various nanostructures, such as the nanopores, by desorbing the underlying substrate, and the size, density and even the shape of the nanopores can strongly depend on the size, density and shape of the Au NPs. [5-8] In this paper, the evolution of the self-assembled Au nanostructures and NPs is systematically investigated by varying the annealing temperature (AT) and dwelling time (DT) on sapphire (0001) as shown in Figure 1. At the low temperature range between 300 and 600 o C, the irregular Au nanostructures are observed including the vermiform Au piles, irregular Au nano-mounds and isolated Au islands. 387

415 Subsequently, at the relatively high temperature range, the Au NPs are successfully fabricated, and the size of the Au NPs is gradually increased with the decreased density as the compensation. On the other hand, with the increased DT, the uniformity of the Au NPs is significantly improved accompanied with the increased size and decreased density, which can be explained by the Ostwald ripening. Acknowledgements Financial support from the National Research Foundation of Korea (no and 2016R1A1A1A ), and in part by the research grant of Kwangwoon University in 2016 is gratefully acknowledged. References 1. A. B. Tesler, L. Chuntonov, T. Karakouz, T. A. Bendikov, G. Haran, A. Vaskevich, and I. Rubinstein, The Journal of Physical Chemistry C 115, (2011). 2. D. Sil, K. D. Gilroy, A. Niaux, A. Boulesbaa, S. Neretina, and E. Borguet, ACS nano 8, (2014). 3. F. Ruffino, A. Pugliara, E. Carria, L. Romano, C. Bongiorno, C. Spinella, and M. G. Grimaldi, Nanotechnology 23, (2012). 4. K. Saha, S. S. Agasti, Ch. Kim, X. N. Li, and V. M. Rotello, Chemical Reviews 112, (2012). 5. T, James, Y. V. Kalinin, Ch. Ch. Chan, J. S. Randhawa, M. Gaevski, and D. H. Gracias, Nano letters 12, (2012). 6. S. P. Scheeler, S. Ullrich, S. Kudera, and C. Pacholski, Nanoscale research letters 7, 1-7 (2012). 7. L. J. Vreede, L. Jacobus, Nano letters 15, (2015). 8. G. L. Liu, K. L. Young, X. Liao, M. L. Personick, and C. A. Mirkin, Journal of the American Chemical Society 135, (2013). 388

416 Poster Session, 20 June 2016, 17:30-18:00 PM N, S-doped hydrothermal carbons derived from L-cysteine and glucose for biosensor applications B.T. HU 1, C.S. YEN 1, J.T. LIU 1, C.J. CHEN 2 1 College of Materials Science and Opti-Electronic Technology, University of Chinese Academy of Sciences, Beijing, China 2 School of Electronic, Electrical and Communication Engineering, University of Chinese Academy of Sciences, Beijing, China Abstract Carbon materials especially in their nanoforms have attracted extensive attentions because of their large surface-to-volume ratio, excellent conductivity [1, 2]. Carbon nanotubes (CNTs) and graphene apply to biosensor have been extensively studied [3]. They act as functional material for immobilizing biomolecules and facilitating the electron transfer of redox-active sites. But these materials require some special and complex synthesis processes, expensive, relatively less hydrophilic and active sites. The literature reports suggest that the introduction of heteroatoms atoms (N, P, B, S, etc.) into carbon materials is a useful method of altering their physical and chemical properties, such as electrocatalytic performances and conductivity [3-5]. Thus, developing facile synthesis methods to prepare heteroatoms-doped carbon materials by using low-cost precursors holds great promise in practical applications. In this study, nitrogen and sulfur dual-doped carbon (NS-CS) synthesized using one-pot hydrothermal treatment of amino aids and carbohydrate. Heteroatoms-doped carbons have an excellent conductivity. On the other hand, chemical doping of carbon with heteroatoms are favorable for the adsorption and activation of analytes and accelerating the charge transfer between electrode and analytes/electrolyte [2]. So NS-CSs could be the good candidate material to fabricating biosensors. N and S dual-doped carbon are prepared through one-step hydrothermal method by using glucose, L-cysteine and sulfuric acid. L-Cysteine acts as a functionalization agent to provide the source for N and S doping [6, 7]. Concentrated sulfuric acid plays a key role in controlling the amorphous carbon to well crystallized graphitic structure [8].The morphologies and functional groups of NS-CSs were characterized by scanning electron microscopy (SEM) and Fourier transform infrared spectroscopy (FTIR) respectively. The electrochemical behaviors of the modified electrodes were further investigated by cyclic voltammograms (CV). The FTIR results show the hydroxyl groups, pyridinic, pyrrolic, graphitic nitrogen and thiophenic present in the carbon, respectively. The peak currents at NS-CSs modified glassy carbon electrode (GCE) as 4 times larger than those of graphite modified GCE (Fig.1), suggesting the NS-CSs exhibit high conductivity. The introduced heteroatoms replaced C within the aromatic ring structure in the form of pyridinic, pyrrolic and graphitic nitrogen and lead to an additional electron in the delocalized π -system, which contributes toward higher conductivity [9]. The NS-CSs solution is hydrophilicity, which contributed to the multiple defects from heteroatoms doping and more hydrophilic groups produced by acidic treatment. The NS-CSs would accelerate the electron transfer between the electrode and analytes/electrolyte. 389

417 This work provides an attractive hydrothermal method of heteroatom-doped carbon with high conductive and hydrophilic from renewable biomass. NS-CSs would exhibit a good prospect for application to biosensor. Current ( A) GCE/NS-CSs GCE/Graphite GCE Potential(V) vs. Ag/AgCl Fig. 1. Cyclic voltammograms of NS-CSs, graphite modified GCEs and bare GCE in 0.2 M KCl solution containing 1 mm K 3 [Fe(CN) 6]. Scan rate: 50 mv s 1. Referernces 1. C. Zhang, W. Lv, W. Zhang, X. Zheng, M.-B. Wu, W. Wei, Y. Tao, Z. Li and Q.-H. Yang, Adv. Energy Mater., 2014, 4, L. Wang, Y. Zhao, M. L. Thomas and H. R. Byon, Adv. Funct. Mater.,2014, 24, S.Y. Deng, G.Q. Jian, et al. Biosensors and Bioelectronics, 25 (2009) G.Q. Chen, Y.X. Liu, et al. Journal of Electroanalytical Chemistry, 738 (2015) T. Lin, I.W. Chen, F. Liu, et al. Science, 2015, 350(6267). 6. S.Z. Niu, W. Lv, Chemical Communications, (2015)51, S. A. Wohlgemuth, R. J. White, et al. Green Chemistry. 2012, 14(5): P. Yang, L. Zhou, S. Zhang, et al. Journal of Applied Physics, 2014, 116 (24): Wu. Q, Li W., Chemical Engineering Journal, 266 (2015)

418 Poster Session, 20 June 2016, 17:30-18:00 PM Preparation and Characterization of ZnO nanorods and their dye-sensitized properties Yern Chee Ching 1, Boon Khoon Tan 2, Shaifulazuar Razali, Nur Awanis 1 Mechanical Engineering, Faculty of Engineering, University of Malaya Lembah Pantai, Kuala Lumpur, Malaysia 2 Mechanical Engineering, Faculty of Engineering, University of Malaya Lembah Pantai, Kuala Lumpur, Malaysia Abstract The ZnO nanorods were fabricated on fluorine doped tin oxide coated glass (FTO) substrate via a solvothermal method for dye-sensitized solar cells (DSSCs). The surface morphology and structures were analyzed using field emission scanning electron microscopy (FESEM), x-ray diffraction (XRD), and high resolution transmission electron microscopy (HRTEM). The optical absorption was done by UV-visible absorption spectroscopy. From these results the ZnO nanorods are well aligned with a high density and uniformity. Moreover, it can be grown with an orientation along the c-axis of the substrate and reveal a wurtzite structure with a leading (002) peak and possessed a high crystal quality. Different dimensions of rods and N719 dye CuSCN provide different dye adsorption for optimal cell performance. ZnO nanorods to improve the short-circuit photocurrent (J sc) and open-circuit voltage (V oc), respectively. However, the efficiency value of DSSC with ZnO nanorods and N719 dye (0.47%) is smaller than those of DSSC with N719 dye and CuSCN (0.54%). Figure 1 shows the structural and morphology of the ZnO nanorods grown on ZnO seed layer covered FTO using a 0.01 M precursor concentration at 85 C for 7 h. These nanorods are analyzed by FESEM, EDX and TEM. The FESEM image (45 tilted view) of the ZnO nanorods is shown in Figure 1(a). The FESEM image exhibits that the diameter and length of nanorods are in the range nm, and nm respectively. These nanorods grow along the normal to substrates in a well aligned mode with high density. The chemical configuration of the ZnO nanorods are determined an energy-dispersive X-ray (EDX) spectroscopy. The six peaks are clearly observed from the spectrum in Figure 1(b), which are identified as zinc, oxygen, tin and carbon. The existence of the tin peak in the spectrum is due to the FTO substrate. It is revealed that the nanorods are composed of zinc and oxygen only. The molecular ratio between Zn and O of the nanorods are evaluated from EDX and assessable analysis data is well matches to that of bulk ZnO. Further structural characterizations of the synthesized nanorods are carried out using the transmission electron microscopy. For this, the nanorods was dispersed in de-ionized water by sonication for 15 min. solution was dropped into carbon-coated copper grid and dried at room temperature. Figure 1(c) shows the HRTEM images for ZnO nanorod arrays. The image obviously reveals the well-resolved lattice fringes with spacing between two fringes about 0.26 nm, with minimal dislocations corresponding to the (002) fringe, which is consistent with that of a bulk wurtzite ZnO crystal. Further observations confirmed that the grown nanorods are single crystalline with the wurtzite hexagonal phase and grown along the c- axis direction. The similar results reported by wang et al. and Liu et al [1,2]. Figure 1(d) shows the FESEM micrograph of N719 dye covered on ZnO nanorods films grown substrate. From the image illustrates a very thin coverage of dye on the nanorods surface. These dye coated nanorods exhibited an improved light absorption [3]. The phase composition of ZnO nanorods, N719 dye covered nanorods, CuSCN, N719 dye coated nanorods were determined using XRD with Bruker X-ray diffractometery at room temperature with monochromatic CuKα (λ = nm) in range of 2θ from 10 o to 80 and a scan rate of 0.03 deg/s. Figure 3(a) illustrates the XRD spectra of deposited ZnO nanorods on FTO substrate. For the nanorods, (100), (101), (002), (102), (110), (103) and (112) diffraction 391

419 peaks are observed in the XRD pattern. These diffraction peaks position and intensities quantities were well match with the Joint Committee on Powder Diffraction Standards (JCPDS) card no The patterns detected from XRD measurements reveal that the films are hexagonal wurzite structure with space group P6 3mc. The nanorods showed a strong superior growth along (002) plane, which shows that nanorods are oriented along c-axis with cell parameters a= nm and c= nm. These results are consistent with HRTEM. However, many ZnO nanorods prepared by other methods were polycrystalline or random orientations [4,5]. Figure 2(b) shows, the important features of XRD peaks of N719 dye absorber. The results indicated the nanorods absorbed dye for favorable to light absorption. Figure 2(c) illustrates the XRD spectra of the grown CuSCN films on ZnO nanorods covered N 719 dye substrate. Analyses of XRD data reveal peaks of β-cuscn corresponding to planes (003), (101), (006), (104), (015), (110), (113) and (021), are identified as wurtzite structure of high degree of crystallinity. The preferential orientation of the β-cuscn grains is also detected along the (003) axis. The presence of a number of peaks in XRD pattern is the indication of polycrystalline nature of the CuSCN [33]. The (003) planes of β-cuscn has a polarity of Cu+ and SCN- separate the planes as SCN- ion is bound strongly to Cu+ through its S atom while N atom on the other end weakly bind to another Cu+ to alternately interconnect the Cu+ and SCN- layers [6]. Therefore, one end of the (003) planes is terminated with Cu atoms and another with N atoms. Fig. 1. ZnO nanorods grown at deposition time for 7 h (a) FESEM, (b) EDS, and (c) HRTEM (d) dye covered nanorods 392

420 Fig. 2. XRD analysis of (a) ZnO nanorods, (b) N 719 dye covered ZnO nanorods and (c) N 719 dye with CuSCN covered ZnO nanorods. Referernces 1. J. Doe and R. U. Hu, Journal title 1, 246 (2014). 2. A.B. Green, C.D. Black, Book title (Publisher), 135 (2007). 3. J. X Wang, X. W Sun, Y. Yang, H. Huang, Y. C. Lee, O. K. Tan, and L. Vayssieres, Nanotechnology, , S. C. Liu and J. J. Wu, Journal of Material Chemistry, 12, , J. Zhu, Z. Yu, G. F. Burkhard, C. M. Hsu, S. T. Connor, Y. Xu, Q. Wang, M. MCGehee, and Y. Cui, Nano Letters, 9, (1), , Y. C. Kong, D. P. Yu, B. Zhang, W. Fang, and S. Q. Feng, Applied Physics Letters, 78, 407, Y. Li, G. W. Meng, L. D. Zhang, and F. Applied Physics Letters, 76, 2011, X. Chao, C. Lei and Y. Hongchun, The Open Materials Science Journal, 7, 29-32, X. Chao, C. Lei and Y. Hongchun, The Open Materials Science Journal, 7, 29-32, 2013,. 393

421 Poster Session, 20 June 2016, 17:30-18:00 PM Ultrafast Excited-State Dynamics of Diketopyrrolopyrrole (DPP)- Based Materials: Static versus Diffusion-Controlled Electron Transfer Process Qana A. Alsulami, Shawkat M. Aly, Subhadip Goswami, Erkki Alarousu, Anwar Usman, Kirk S. Schanze, and Omar F. Mohammed Solar and Photovoltaics Engineering Research Center, Division of Physical Sciences and Engineering, King Abdullah University of Science and Technology, Thuwal , Kingdom of Saudi Arabia Abstract Singlet-to-triplet intersystem crossing (ISC) and photoinduced electron transfer (PET) of platinum(ii) containing diketopyrrolopyrrole (DPP) oligomers in the presence and absence of tetracyanoethylene (TCNE), a strong electron acceptor, were investigated using femtosecond and nanosecond transient absorption spectroscopy with broadband capabilities. The effect of incorporating platinum(ii) in the photophysical properties of DPP molecule was evaluated by comparing the excited-state dynamics of DPP with and without Pt metal centers. Steady-state measurements reveal that platinum(ii) incorporation greatly facilitates interactions between DPP-Pt(acac) and TCNE (as shown in fig,1), resulting in the formation of charge transfer (CT) complexes. 1 In the absence of TCNE, the transient absorption spectra revealed ultrafast ISC of DPP- Pt(acac) followed by a long-lived triplet state; however, in the presence of TCNE, PET from the excited DPP-Pt(acac) and from DPP to TCNE formed radical ion pairs. We measured an ultrafast PET from DPP-Pt(acac) to TCNE (i.e., a picosecond regime) that was much faster than that from DPP to TCNE (i.e., nanosecond time scale), which is a diffusion-controlled process. Our results provide clear evidence that the PET rate is eventually controlled by the platinum(ii) incorporation. Fig. 1. Steady-state emission (left) after excitation at 600 nm of the DPP-Pt(II)(acac) complex. Steady-state emission (right) after excitation at 490 nm of DPP with TCNE Referernces 1. Q. A. Alsulami, S. M. Aly, S. Goswami, E. Alarousu, A. Usman, K. S. Schanze, O. F. Mohammed, J. Phys. Chem. C 2015, 119,

422 Poster Session, 20 June 2016, 17:30-18:00 PM Preparation and characterization of temperature and ph-sensitive rod-coil diblock copolymers Yang-Yen Yu, Chia-Liang Tsai, Ting-Wei Guo Department of Materials Engineering, Ming Chi University of Technology, 84 Gunjuan Rd., Taishan Dist., New Taipei City 24301, Taiwan. Abstract The synthesis, structures and multifunctional sensory properties of amphiphilic poly[2,7-(9,9- dihexylfluorene)]-block-poly[2-(diethylamino)ethyl methacrylate] (PF-b- PEMAEMA) rodcoil diblock copolymers are reported. The new copolymers, with PEMAEMA coil lengths of 90 and 197 repeating units, were synthesized by atom transfer radical polymerization. However, the long-range order structure of spiral-shaped loops was not observed at a long coil length. The micellar aggregates of PF 10-b- PEMAEMA 90 in water showed a reversible surface structure transformation from cylinder-bundles to spheres on heating temperature from 25 to 75 C. The variation of the micelle size with temperature was judged to be similar from both atomic force microscopy (AFM) and Transmission Electron Microscopy (TEM) measurements. The intermolecular PF aggregations led to fluorescence quenching and a blue-shift in the absorption spectra of the block copolymer as the water content increased. The photoluminescence (PL) intensity of PF 10-b- PEMAEMA 90 in methanol was thermoreversible based on its lower critical solution temperature. The PL characteristics suggested the new copolymers behave as an on/off fluorescence indicator of temperature or ph, with a reversible on off profile at an elevated temperature in water and the ph fluorescence intensity profile switched from off on to on off as the temperature increased. The present study suggests that PF-b- PEMAEMA copolymers have potential applications as multifunctional sensory materials toward solvent, temperature, and ph. Referernces 1. G. Ali, C. Rihouey, V. Larreta-Garde, D. Le Cerf, L. Picton, Biomacromolecules 14,2234 (2013). 2. Y. Tian, T. A. Hatton, K. C. Tam, Polymer 55, 3886 (2014). 3. B. H. Lessard, M. Maric, Can. J. Chem. Eng. 91, 618 (2013). 4. S. Belbekhouche, J. Desbrie` res, V. Dulong, L. Picton, D. Le Cerf, S. Alexandre, J. Colloid Interface Sci. 398, 134 (2013). 5. S. Belbekhouche, J. Desbrie` res, T. Hamaide, D. Le Cerf, L. Picton, Carbohydr. Polym. 95, 41 (2013). 6. I. S. Park, Y. R. Yoon, M. Jung, K. Kim, S. B. Park, S. Shin, Y. B. Lim and M. Lee, Chem. Asian J., 6, 452 (2011). 7. C. L. Liu, C. H. Lin, C. C. Kuo, S. T. Lin and W. C. Chen, Prog. Polym. Sci., 36, 603 (2011) 395

423 Poster Session, 20 June 2016, 17:30-18:00 PM Fabrication of Pd nanostructures on silicon (111) by the control of annealing temperature and dewelling time Sundar Kunwar, Mao Sui, Puran Pandey, Quanzhen Zhang, Ming-Yu Li and Jihoon Lee College of Electronics and Information, Kwangwoon University, Nowon-gu Seoul 01897, South Korea Abstract The fabrication of the metallic nanoparticles (NPs) as well as the porous nanostructures on the silicon has shown the efficient light absorption capacity to improve the devices performances of solar cells, light emitting devices and fuel cells [1-3]. In this work, we studied the systematic evolution of various palladium (Pd) nanostructures on the Si (111) based on the control of annealing temperature and dwelling time. Various structural and spatial configurations of Pd nanostructures are demonstrated during the annealing between 300 and 850 o C, such as: tiny pits and hillocks, large hillocks, isolated various sized dome shaped NPs and Pd NPs assisted holes formation in Si. A sequence of diffusion controlled process such as solid-state dwetting, Volmer-weber growth model and surface energy minimization was employed to attribute the evolution of the Pd nanostructures and holes [4]. Furthermore, the dwelling time effect has been studied by the systematic control of annealing duration between 0 to 3600 s, where Pd nanostructures showed the saturated growth with critical size and discussed based on the Ostwald s ripening. Acknowledgements Financial support from the National Research Foundation of Korea (no and 2016R1A1A1A ), and in part by the research grant of Kwangwoon University in 2016 is gratefully acknowledged. References 1. P. Spinelli, V. E. Ferry, J. Van de Groep, M. Van Lare, M. A. Verschuuren, R. E. I. Schropp,... & A Polman, Plasmonic light trapping in thin-film Si solar cells. Journal of Optics, 14, (2012). 2. V. Kveder, M. Badylevich, E. Steinman, A. Izotov, M. Seibt, & W Schröter, Roomtemperature silicon light-emitting diodes based on dislocation luminescence. Applied Physics Letters, 84, (2004). 3. R. S. Jayashree, J. S. Spendelow, J. Yeom, C. Rastogi, M. A. Shannon, & P. J. A. Kenis, Characterization and application of electrodeposited Pt, Pt/Pd, and Pd catalyst structures for direct formic acid micro fuel cells. Electrochimica Acta, 50, (2005). 4. M. Zinke-Allmang, L. C. Feldman, & M. H. Grabow, Clustering on surfaces. Surface Science Reports, 16, (1992). 396

424 Poster Session, 20 June 2016, 17:30-18:00 PM Synergistic Combination Therapy Using a Core-Shell Lipid-Based Nanocapsule with Tunable Shell Thickness Chin-Hao Hsu, Chia-Wei Su, Chin-Sheng Chiang and San-Yuan Chen Department of Materials Science and Engineering, National Chiao Tung University, Hsinchu City 30010, Taiwan (R.O.C) Abstract Combination therapy has great potential to demonstrate synergistic therapeutic effect toward diseased cells, and even can overcome the multi-drug resistance (MDR) through various mechanisms of action. However, encapsulating drugs with different physicochemical properties into a common vehicle is challenging, especially when it comes to hydrophobic and hydrophilic compounds. On the basis of double emulsion approach, a core-shell lipid-based nanocapsule (CSLNs) was developed to simultaneously encapsulate a hydrophobic anticancer drug, paclitaxel (PTX), in the shell and a hydrophilic anticancer drug, doxorubicin (DOX), in the core. Moreover, the combination of drugs in different ratios has been evaluated for searching the optimal synergistic effect in MCF-7/ADR breast cancer cells with MDR. In addition, manipulation of the shell thickness of CSLNs was found to adjust drug release rate and the further thickness- and time-dependent cytotoxicity is under investigation. The CSLNs have potential as being a feasible nano-platform for combination anticancer therapy. Introduction Combination therapy for the treatment of cancer is becoming more popular because it generates synergistic anticancer effects, reduces individual drug-related toxicity and suppresses multidrug resistance through different mechanisms of action. In recent years, nanotechnology-based combination drug delivery to tumor tissues has emerged as an effective strategy by overcoming many biological, biophysical and biomedical barriers that the body stages against successful delivery of anticancer drugs [1]. Although many efforts have been made on the combination therapy, several challenges are still limiting the design of an optimal delivery system, including encapsulating drugs with different physical chemistry, specifically binding to targeting cancer cells, precisely controlling the loading amount and controlled drug release [2] [3]. On the basis of double emulsion approach, we have developed a new class of core-shell lipidbased nanocapsules (CSLNs) that can simultaneously encapsulate hydrophobic and hydrophilic drugs in a common vehicle. The core-shell structure enables CSLNs to load hydrophilic drugs in inner aqueous core and hydrophobic drugs embedded in lipid-based shell. Moreover, variable ratios of both loaded drugs can be achieved. Besides, by modulating osmotic pressure via salt concentration gradient between inner aqueous core and external aqueous solution of CSLNs, we can adjust the shell thickness for controlling drug release rate. The controllable properties of drug encapsulation and release are conferred on CSLNs to serve as a versatile platform for combination anticancer therapy. 397

425 Fig. 1. (a) Illustration of CSLNs loaded with a hydrophobic drug in the shell and a hydrophilic drug in the core. Variation of shell thickness is represented. (b) Scheme of the CSLNs fabrication process. Referernces 1. Parhi, Priyambada, Chandana Mohanty, and Sanjeeb Kumar Sahoo, Drug discovery today 17, (2012). 2. Su, Chia-Wei, et al., Chemical Communications 50, (2014). 3. Ahmed, Fariyal, et al., Molecular pharmaceutics 3, (2006). 398

426 Author Index (A - Z) Name Institution Country Page Akira Ishibashi Hokkaido University Japan 129 Akira Yamakata Toyota Technological Institute Japan 209 Alejandro Universitat Autònoma de Gomez Roca Barcelona Spain 155 Alexander Brown University of Alberta Canada 305 Aliaksandr S. Bandarenka Technical University Munich Germany 300 Alok Shukla Indian Institute of Technology Bombay India 260 Andreas Fissel University Hannover Germany 314 Andrew Grimsdale Nanyang Technological University Singapore 43 Anthony V. Powell University of Reading UK 79 Asif Mahmood King Saud University Saudi Arabia 123 B. T. Hu University of Chinese Academy of Sciences China 389 Beat Braem ETH Zurich Switzerland 148 Bing Yan Shandong University China 296 Bingwu Wang Peking University China 101 Byung-Soo Kim Seoul National University Korea 353 Chang-Dong Yeo Texas Tech University USA 7 Changjun Han Huazhong University of Science and Technology China 341 Charles H. Patterson Trinity College Dublin Ireland 204 Charles Jaffe West Virginia University USA 306 Chen Ning Harbin Institute of Technology China 282 Chia-Wei Chang National Cheng Kung University Taiwan 304 Chih-Hao Wang Ming Chi University of Technology Taiwan

427 Chin-Fung Su National Cheng Kung University Taiwan 303 Ching-Ling Hsu Chung Yuan Christian University Taiwan 140 Chin-Hao Hsu National Chiao Tung University Taiwan 397 Chin-Yi Yang I-SHOU University Taiwan 380 Choon Young Lee Central Michigan University USA 278 Chun-Sian Yu National Chiao Tung University Taiwan 374 Dao Hua Zhang Nanyang technological University Singapore 265 E Rusli Nanyang Technological University Singapore 128 Eddie Cussen University of Strathclyde UK 72 Edgar Knobloch University of California at Berkeley USA 214 Fan Weijun Nanyang Technological University Singapore 262 Fatang Liu Harbin Institute of Technology China 280 Fei Zeng Tsinghua University China 227 Fredrik Karlsson Linkoping University Sweden 138 Gabriel Luiz Universidade Federal de Mato Cruz de Souza Grosso Brazil 26 Gerhard Eder Johannes Kepler University Austria 229 Ghazanfar COMSATS Institute of Information Abbas Technology Pakistan 214 Giwan Yoon Korea Advanced Institute of Science & Technology Korea 212 Gladius Lewis University of Memphis USA 119 Guy Makov Ben-Gurion University of the Negev Israel 22 Gyungsu Byun Southern Methodist University USA 238 H. Aygul Yeprem Yildiz Technical University Turkey 358 Hagay Shpaisman Bar-Ilan University Israel 105 Hani E. Elsayed- Ali Old Dominion University USA 108 Helmut Baumgart Old Dominion University USA 82 Hemadi Miryana University Paris Diderot France

428 Hendrik Heinz University of Colorado-Boulder USA 164 Hideo Kaiju Hokkaido University Japan 122 Hiroshi Fukuoka Hiroshima University Japan 22 Hiroshi Okamoto Hirosaki University Japan 311 Hiroshi Watanabe National Chiao Tung Univercity Taiwan 53 Hiroyuki Takagi Toyohashi University of Technology Japan 184 Hisashi Kitami Sumitomo Heavy Industries, Ltd. Japan 73 Hong Li Northwestern Polytechnical University China 338 Hong Wang Nanyang Technological University Singapore 134 Hong Wang Sichuan University of Science and Engineering China 352 Huaming Li Taiyuan University of Technology China 273 HuiChi Chen Fu Jen Catholic University Taiwan 186 Huizhen Wu Zhejiang University China 127 Iddo Amit University of Exeter UK 257 Ifat Kaplan- Ashiri Weizmann Institute of Scienc Israel 62 Imane Khalil University of San Diego USA 267 Jae Woong Yoon Hanyang University Korea 3 Jenn-Kai Tsai National Formosa University Taiwan 354 Jeongsik Yun Technical University of Munich Germany 168 Jhinhwan Lee Korea Advanced Institute of Science and Technology Korea 182 Johann Faccelo Osma Cruz Universidad de los Andes Colombia 71 Jong-in Hahm Georgetown University USA 217 Jou-Hsuan Chu I-Shou University Taiwan 371 Juan Wu Mcmaster University Canada 233 Judy Wu University of Kansas USA 12 Junichi Kurawaki Kagoshima University Japan 56 Jwohuei Jou National Tsing Hua University Taiwan

429 Katharine Moore Tibbetts Virginia Commonwealth University USA 335 Katsuhiko Higuchi Hiroshima University Japan 143 Kazuaki Akaiwa Tottori University Japan 318 Kenneth K.W. Kwan University of Hong Kong China 301 Kensuke Naka Kyoto Institute of Technology Japan 275 Kenta Arima Osaka University Japan 223 Kibog Park Ulsan National Institute of Science and Technology Korea 252 Klaus Muller- Buschbaum University of Würzburg Germany 96 Kohei SOGA Tokyo University of Science Japan 193 Koichi University of Electro- Yamaguchi Communications Japan 322 Kuan-Syun Wang Ming Chi University of Technology Taiwan 167 Kuei-Fang Hsu National Cheng Kung University Taiwan 261 Kyeong-Sik Min Kookmin University Korea 239 Lambertus Hesselink Stanford University USA 189 Lan-Chang Liang National Sun Yat-sen University Taiwan 70 Leon L. Shaw Illinois Institute of Technology USA 201 Li-Hsin Chan National Chi Nan University Taiwan 236 Liqiang Wang Shanghai Jiao Tong University China 218 Louisa Meshi Ben Gurion University of the Negev Israel 243 Makoto Sakurai Kobe University Japan 150 Manohar Kumar Aalto University Finland 147 Mao Sui Kwangwoon University Korea 159 Mao Sui Kwangwoon University Korea 382 Masaharu Oshima University of Tokyo Japan 287 Masahiko Higuchi Shinshu University Japan

430 Masahiko Kondow Osaka University Japan 90 Masaki Nakano Nagasaki University Japan 123 Masao Nagase Tokushima University Japan 249 Masaru Aniya Kumamoto University Japan 52 Masashi Hasegawa Nagoya University Japan 206 Masato Sone Tokyo Institute of Technology Japan 328 Masatomo Yashima Tokyo Institute of Technology Japan 307 Masatomo Yashima Tokyo Institute of Technology Japan 321 Masayoshi National Institute for Materials Higuchi Science Japan 170 Masayuki Hashisaka Tokyo Institute of Technology Japan 145 Michael F. Herman Tulane University USA 106 Min Kao I-Shou University Taiwan 369 Mingtian Li Sichuan University of Science and Engineering China 384 Ming-Yu Li Kwangwoon University Korea 207 Ming-Yu Li Kwangwoon University Korea 346 Minoru Sasaki Toyota Technological Institute Japan 230 Min-Yu Chiang National Chiao Tung University Taiwan 377 Monica Craciun University of Exeter UK 254 Niklas Hedin Stockholm University Sweden 308 Nikolai Perov Lomonosov Moscow State University Russia 100 Nobuhiko Nakano Keio University Japan 152 Norio Kawakami Kyoto University Japan 326 Norio Tagawa Tokyo Metropolitan University Japan 197 Omar F. King Abdullah University of Mohammed Science & Technology Saudi Arabia

431 Osman Bakr King Abdullah University of Science & Technology Saudi Arabia 181 Paz Vaqueiro University of Reading UK 77 Pei Wenli Northeastern University China 291 Philip Pong University of Hong Kong China 327 Phillip Choi University of Alberta Canada 166 Po Chen Wu Ming Chi University of Technology Taiwan 258 Pooi See Lee Nanyang Technological University singapore 300 Pornsawan Sikam Khon Kaen University Thailand 349 Puran Pandey Kwangwoon University Korea 294 Puran Pandey Kwangwoon University Korea 376 Q. Jane Wang Northwestern University USA 141 Qana A. King Abdullah University of Alsulami Science and Technology Saudi Arabia 394 Qi-Huo Wei Kent State University USA 269 Qin Yan Wuhan University of Technology China 309 Qing-Hua Xu National University of Singapore Singapore 271 Quanzhen Zhang Kwangwoon University Korea 68 Quanzhen Zhang Kwangwoon University Korea 387 Rebecca Cheung University of Edinburgh UK 263 Reshef Tenne Weizmann Institute of Science Israel 85 Rolf Lortz Hong Kong University of Science and Technology China 51 Rongshan Qin Imperial College London UK 60 Salvador Pane i Swiss Federal Institute of Vidal Technology (ETH) Zurich Switzerland 63 Samuel Choi Niigata University Japan 191 Sang-Yup Lee Yonsei University Korea 5 Saniye Ozgur Yildiz Technical University Turkey 357 Satoshi Okuma Tokyo Institute of Technology Japan 47 Say Chye Joachim LOO Nanyang Technological University Singapore 1 Seong Jin Koh University of Texas at Arlington USA

432 Serena A. Corr University of Glasgow UK 24 Shao-Chieh Weng National Cheng Kung University Taiwan 289 Sharif Iqbal King Fahd University of Petroleum Mitu Sheikh and Minerals Saudi Arabia 333 Shih-Shuo Tung Academia Sinica Taiwan 15 Shlomo Berger Technion Israel Institute of Technology Israel 41 Shohei Watabe Tokyo University of Science Japan 59 Shoko Kume Hiroshima University Japan 88 Song-You Hong Korea Institute of Atmospheric Prediction Systems Korea 274 Stuart H. Taylor Cardiff University UK 27 Sundar Kunwar Kwangwoon University Korea 339 Sundar Kunwar Kwangwoon University Korea 396 Takefumi Kamioka Toyota Technological Institute Japan 132 Takeharu Haino Hiroshima University Japan 174 Takeo Hyodo Nagasaki University Japan 113 Tetsuo Tsuchiya National Institute of Advanced Industrial Science and Technology Japan 30 Tetsuya Yamamoto Kochi University of Technology Japan 44 Thuat T. Trinh Norwegian University of Science and Technology Norway 58 Timur Sh. Atabaev Pusan National University Korea 348 Timur Shegai Chalmers University of Technology Sweden 9 Tomoyasu Hirai Kyushu University Japan 178 Tooru Tanaka Saga University Japan 35 Toshihiro Osaka Electro-Communication Nakamura University Japan 317 Toshihiro Okamoto Tokushima University Japan 266 Tsofar Maniv Israel Institute of Technology (Technion) Israel

433 W.G. van der Wiel University of Twente Netherlands 161 Wenzhi Li Florida International University USA 297 Werner Karl Schomburg RWTH Aachen University Germany 219 Xiangyu Quan Kobe University Japan 284 Xucai Yu University of electronic Science and Technology of China China 17 Xue Jiang Dalian University of Technology China 40 Yan Jun Li Osaka University Japan 65 Yang-Yen Yu Ming Chi University of Technology Taiwan 359 Yang-Yen Yu Ming Chi University of Technology Taiwan 395 Yang-Yen Yu Ming Chi University of Technology Taiwan 360 Yasufumi Enami Kochi University of Technology Japan 171 Yasufumi Fujiwara Osaka University Japan 92 Yasuhiro Sugawara Osaka University Japan 154 Yasushi Morita Aichi Institute of Technology Japan 199 Yasuya Nakayama Kyushu University Japan 125 University of Malaya Lembah Yern Chee Ching Pantai Malaysia 391 Yiliang Liao University of Nevada USA 124 Yilong HAN Hong Kong University of Science and Technology China 4 Yingwei Zhang Beijing University of Chemical Technology China 118 Yingying Zong Harbin Institute of Technology China 246 Yin-Yin Wang Ming Chi University of Technology Taiwan 364 Yi-Qun TSENG Ming Chi University of Technology Taiwan 342 Yi-Zhen Lin National Chiao Tung University Taiwan 366 Yo Sung Ho Gwangju Institute of Science and Technology Korea 194 Yoichi Okimoto Tokyo institute of technology Japan 19 Yoke Leng Sim Universiti Tunku Abdul Rahman Malaysia

434 Korea Advanced Institute of Yong Hyub Won Science and Technology Korea 183 Yong Soo Cho Yonsei University Korea 42 Yongchang Han Dalian University of Technology China 279 Yonglai Lu Beijing University of Chemical Technology China 109 Yongli Gao University of Rochester USA 18 Yoonchan Jeong Seoul National University Korea 286 Young L. Kim Purdue University USA 38 Young-Sang Cho Korea Polytechnic University Korea 361 Yousuke Ooyama Hiroshima University Japan 33 Yu Yang East Carolina University USA 142 Yuanfei Han Shanghai Jiaotong University China 244 Yuan-Liang Zhong Chung Yuan Christian University Taiwan 325 Yu-Chiang Chao Chung Yuan Christian University Taiwan 32 Yujun Shi University of Calgary Canada 152 Yu-Min Yang National Cheng Kung University Taiwan 344 Yun Yan Peking University China 277 Yu-Shan Su National Chang Kuang University Taiwan 324 Yusheng Shi Huazhong University of Science & Technology China 112 Yu-Yun Pan National Cheng Kung University Taiwan 21 Zerihun Assefa North Carolina A&T State University USA 176 ZhiJun Liu University of Electronic Science and Technology of China China 331 Zong Han Lu Ming Chi University of Technology Taiwan 255 Zonghoon Lee Ulsan National Institute of Science and Technology Korea

435 Title Index (A - Z) Abstract Title Name Pages 3D devices realized by photolithography using spray coating of photoresist Minoru Sasaki 230 3D Tomographic Measurement of Interior Surface Vibrations in Thick Biological Tissuese Using Samuel Choi 191 Multifrequency Sweepable Optical Comb 3D Visual Analyse of Materials Processing Rongshan Qin 60 4d Imaging of Polymer Electrolyte Membrane Fuel Cell Cathodes by Scanning Transmission X-Ray Juan Wu 233 Microscopy A new atmospheric model with a cubed-sphere grid for numerical weather prediction Song-You Hong 274 A Systematic Exploration of Nano-Bio Interactions: the Story of Carbon Nanotubes Bing Yan 296 Additive Manufacturing and Investigation of Novel Grooved Micro Heat Pipes Q. Jane Wang 141 Advances in Thermoelectric Materials with Helmut Improved Figure of Merit Baumgart 82 All-in-Focus and Depth from A Defocus Image Shih-Shuo Tung 15 An Approximate Semiclassical Method that Uses Michael F. Real Valued Trajectories for Time Dependent Herman Tunneling Calculations 106 Analysis of 3D Reconstruction System Using Handheld RGB-D Camera Yo Sung Ho 194 Analysis of Interface Thermal Stability of High-k ZrO2 on GaN and AlGaN Hong Wang 134 Application of a dual-excitation multi-modal digital holographic microscope to biological imaging Xiangyu Quan 284 Application of Rare-Earth Doped Ceramics for Transparent Imaging Devices Kohei SOGA 193 Applications of Biomimetic Bolaamphiphile Molecules in Catalysis and Energy Harvesting Sang-Yup Lee 5 408

436 Atmospheric plasma modified nanoarrays of MoS2 nanosheets with Au nanoparticals for elevating Yi-Qun TSENG 342 SERS biodetection Atomic scale visualization of topological dynamics of plaquette antiferromagnetic order and interfacial phonons in tetragonal FeAs layer Jhinhwan Lee 182 encapsulated in perovskite layers using spinpolarized STM Atomic-scale Dynamics of Defect Formation in 2D Materials Zonghoon Lee 14 Atomic-scale Imaging of Electronic Properties of Yasuhiro the Surface by Electrostatic Force Microscopy Sugawara 154 Au at the Si(111) surface: silicene and Au Charles H. nanowires probed by optical spectroscopy Patterson 204 Behavior of Photogenerated Electrons and Holes on Anatase and Rutile TiO2 Powders Akira Yamakata 209 Biogenic light trapping in natural fibers toward scalable photocatalysis Young L. Kim 38 Bottom-up design of 2D organic photocatalysts for visible-light driven hydrogen evolution Xue Jiang 40 Breakdown of quantum Hall effect in graphene: Noise studies Manohar Kumar 147 Carbon Nanotubes Reinforced Rubber Composites and Their Promising Application in High Yonglai Lu 109 Performance Tires Catalyst discovery using preparation by supercritical antisolvent precipitation: Georgite as a precursor for highly active copper zinc oxide Stuart H. Taylor 27 catalysts CdTe/PbTe heterostructure: A new 2DEG system Huizhen Wu 127 Cold-Electron Transport at Room Temperature: Toward Ultralow Energy Consumption Electronics Seong Jin Koh 126 Comparison of YPO4: Tb3+, Yb3+ and YVO4: Tb3+, Yb3+ Phosphors as Quantum Cutting by Cooperative Energy Transfer from Visible Light to Near Infrared emission Yu-Shan Su

437 Composite Right/Left-Handed Transmission-line Metamaterials in the Mid-IR Region Conductivity Control of Sn-Doped Coruncum- Structured Ga2O3 Films on Sapphire Configuration, size and density evolution of Pd nanostructures on sapphire (0001) by the control of deposition amount at various annealing temperature Continuos stereolithographic bottom-up 3D printing by means of a liquid-liquid interface for manufacturing functionalized polymeric films Control of the ratio of incident flux of ions to neutral species onto substrates to achieve highcarrier-mobility transparent conductive oxide films deposited by a high-growth-rate Reactive Plasma Deposition Controllable construction of mesoscopic DNA pattern by combining precise magnetic manipulation and DNA-driven assembly Controllable Fabrication of Nanoholes on c-plane GaN by Tuning the Configuration Au Nanostructures as Catalysts Controlling and Probing the Band-Gap of Graphene and Graphene-Related Materials Controlling Interfaces in Photonic and Plasmonic Carbon Nanostructure Optoelectronics: Towards High Performance and Low Cost Controlling the size and shape of uncapped Au nanostructures with femtosecond laser-assisted synthesis Dendritic macromolecular antioxidants Design of improved electrocatalysts for energy provision Development of gas sensors by utilizing welldeveloped porous materials ZhiJun Liu 331 Kazuaki Akaiwa 318 Sundar Kunwar 339 Johann Faccelo Osma Cruz 71 Hisashi Kitami 73 Yingwei Zhang 118 Mao Sui 382 Iddo Amit 257 Judy Wu 12 Katharine Moore Tibbetts 335 Choon Young Lee 278 Aliaksandr S. Bandarenka 300 Takeo Hyodo

438 Development of Novel Synthetic Method of Glucose-Binding Silver Nanoparticles and Junichi Kurawaki 56 Biosensing Applications Development of Slippery Liquid-Infused Porous Surface (SLIPS) through Biomimicking Yu-Min Yang 344 Development of Supramolecular Polymers based on Unique Molecular Recognition Motifs Takeharu Haino 174 Directed Formation By Optical And Acoustic Forces Hagay Shpaisman 105 Durable and Efficient Packing Materials for Green Subcritical Water Chromatography Yu Yang 142 Edges of Graphene Nanoribbons Healed by Low Damage Plasma Treatment for Future Po Chen Wu 258 Nanoelectronic Devices Effect of Side Chains on Photovoltaic Performance of Two-Dimensional Conjugated Copolymers Li-Hsin Chan 236 Electrical and optical properties of GaAsNBi/GaAs quantum wells Fan Weijun 262 Electrically Driven Alignment and Drug Delivery of Conductive Microcapsule in Hydrogel Min-Yu Chiang 377 Electrochemical Lithiation of Individual Cobalt Sulfide Nanowire-filled Carbon Nanotube Wenzhi Li 297 Electrochemical Study of Nano-composite Anode for Energy Conversion Applications (Solid Oxide Ghazanfar Abbas 214 Fuel Cell) Electrochemical Surface-Enhanced Raman Spectroscopy of detecting Endocrine disruptor chemicals Chin-Fung Su 303 Electrochromic Devices with Metallo- Masayoshi Supramolecular Polymers Higuchi 170 Electrostatic self-assembly: Possibilities to retain the porphyrin monomer properties in aggregates Yun Yan 277 Element-Block Polymers Based on T8-caged Silsesquioxanes Kensuke Naka 275 Energy band structures of the crystalline silicon Masahiko immersed in the magnetic field Higuchi

439 Energy-efficient I/O Interface and Clock Distribution for 3D-stacked Mobile Devices Enhanced red emission from Eu ions embedded in a GaN resonant optical microcavity Enhancing the Capacitive Energy Storage of Activated Carbon through Novel Mechanical Activation Epitaxial Graphene Grown on Hexagonal SiC at Reduced Temperature with Mo-Plate Capping: Crystallinity and Carrier Transport Evaluation of Grüneisen Parameters of Ionic Conductors Evolution of a designless nanoparticle network into reconfigurable Boolean Logic Evolution of Configuration and Size of Selfassembled Pt Nanoparticles on Sapphire (0001) Controled with a Systematic Varation of thermal treatment Evolution of Pd Nanostructures on c-plane Sapphire by the Control of Annealing Temperature and Duration Evolution of the Self-Assembled Au Nanoparticles by controlling Annealing Temperature and Dwelling Time on Sapphire (0001) Substrate Exfoliation of MoS2 via Sonication and Examination of MoS2 Nanosheets Fabrication and characterization of laminated titanium matrix composite Fabrication and evolution of various configuration and size of Pt nanostrucutres on GaN (0001): Voids, Hillocks, Nanoparticles, Nanoclusters, Porous Pt Network and Porous GaN Fabrication of Pd nanostructures on silicon (111) by the control of annealing temperature and dewelling time Gyungsu Byun 238 Yasufumi Fujiwara 92 Leon L. Shaw 201 Kibog Park 252 Masaru Aniya 52 W.G. van der Wiel 161 Ming-Yu Li 207 Mao Sui 159 Quanzhen Zhang 387 Chia-Wei Chang 304 Yuanfei Han 244 Puran Pandey 294 Sundar Kunwar

440 Fabrication of the Flexible Oxide Films by Photo- Induced Chemical Solution Process Tetsuo Tsuchiya 30 Fabrication of Ultrahigh-Density GaAsSb/InAsSb Koichi Quantum Dots and Their Photovoltaic Applications Yamaguchi 322 Facile Fabrication of ultralight foams Chen Ning 282 Ferromagnetic nanoparticles in topochemical transformations Nikolai Perov 100 First-Principles Study on Electronic Structures of FAPbX3 (X = Cl, Br, I) Hybrid Perovskites Yu-Yun Pan 21 Flexible and Stretchable Conductors for Electrochemical Energy Conversion Devices Pooi See Lee 300 Formation and Characterization of Dielectric nano- Crystals for Highly Sensitive Pyroelectric Thermal Detectors Shlomo Berger 41 Fractional Quasiparticles in a Local Quantum Hall Masayuki System Hashisaka 145 Functional Iron Oxide/Graphene Oxide Nanocomposites with Magnetically and Photothermally External Trigger for Enhanced Yi-Zhen Lin 366 Gene Transfection Fundamental Study of Nanoscale Protein-Polymer Interactions and Potential Contributions to Solidstate Jong-in Hahm 217 Protein Nanoarrays Good light based on candlelight OLED Jwohuei Jou 99 Graphene as a cell transplantation vehicle Byung-Soo Kim 353 Graphene oxidation fabricated by low damage atmospheric pressure plasma treatments Zong Han Lu 255 Growth of Crystalline Metal Carbides on the Catalyst Surface in Hot Wire Chemical Vapor Yujun Shi 152 Deposition Growth of various size and configuration of Pd nanostructures on Si (111) by the control of Pd deposition amount at various annealing Puran Pandey 376 temperature. Guided-mode resonance nanophotonics: Review and applications Jae Woong Yoon 3 413

441 High quality graphene for advanced applications Monica Craciun 254 High Speed Electro-Optic Polymer/TiO2 Vertical Slot Waveguide Modulators High-Hall-mobility transparent conductive oxide films: Key factors limiting carrier transport for wide applications How simple are the models of Na intercalation in aqueous media? Hybrid Perovskite Single Crystals: Properties, Growth Design, and Device Applications Hybrid thin film of Ag nanowire and reduced graphene oxide prepared by H2-low damage plasma as flexible transparent electrode Impedance spectroscopic study on metalmanganite interfaces exhibiting resistance switching InGaN quantum dots on GaN micropyramids for polarized photon emission Inorganic nanotubes and fullerene-like nanoparticles at the crossroad between materials science and nanotechnology and their applications Interface Formation and Surface Degradation of Trihalide Perovskite Materials Investigation of Pd nanoparticles on Al2O3/NiAl(110) under CO gas by AFM/ KPFM Ion dependent frequency filtering and learning of semiconducting polymer/electrolyte composite Ion Segregation in Deliquesced Droplets of Alkali Halide Nanocrystals on SiO2 Approached by both Surface Science Techniques and Electrical Characteristics Large gap, a pseudogap and proximity effect in the Bi2Te3/Fe1+yTe interfacial superconductor Large magnetocapacitance effect in magnetic tunnel junctions at room temperature Layered oxychalcogenides as promising thermoelectric materials Yasufumi Enami 171 Tetsuya Yamamoto 44 Jeongsik Yun 168 Osman Bakr 181 Yin-Yin Wang 364 Toshihiro Nakamura 317 Fredrik Karlsson 138 Reshef Tenne 85 Yongli Gao 18 Yan Jun Li 65 Fei Zeng 227 Kenta Arima 223 Rolf Lortz 51 Hideo Kaiju 122 Paz Vaqueiro

442 Local Investigations in the Fractional Quantum Hall Beat Braem 148 Regime using Scanning Gate Microscopy Luminescent N-functionalized MOFs and Coordination Networks for Novel Sensing Applications and Lighting Magnetic and photocatalytic response of Agdoped ZnFeO nano-composites for photocatalytic degradation of reactive dyes in aqueous solution Magnetic nanoparticles for drug internalization by the iron-acquisition pathway Magnetic Two-Dimensional Nanosheets for Rapid Separation of Water Pollutants Magnetically Guided Micro- and Nanomachines Magneto-Plasmonic Nanostructures for Theranostic Applications Many-body proximity effects in f-electron superlattices Many-body theory of an interacting Bose Einstein condensate at finite temperatures Mapping Carrier Dynamics on Material Surfaces in Space and Time using 4D Electron Microscopy Klaus Muller- Buschbaum 96 Asif Mahmood 123 Hemadi Miryana 157 Kuan-Syun Wang 167 Salvador Pane i Vidal 63 Alejandro Gomez Roca 155 Norio Kawakami 326 Shohei Watabe 59 Omar F. 107 Mohammed Melting and Premelting of Colloidal Crystals Yilong HAN 4 Memristor crossbars for pattern recognition Kyeong-Sik Min 239 Methodical Controls on Configuration, Size, and Density of the Au Nanostructures on 4H-SiC (0001) via Deposition Thickness, Annealing Ming-Yu Li 346 Temperature, and Annealing Duration Microporous polymers for CO2 capture and heterogeneous catalysis Niklas Hedin 308 Micro-resonator devices and systems Rebecca Cheung 263 Microstructural characteristics and mechanical properties of biomedical titanium alloy during Liqiang Wang 218 friction stir processing Molecular Dynamics (MD) Modeling and Simulation to Investigate Bonding Preference of Chang-Dong Yeo 7 415

443 Outgassed Hydrocarbon Molecules to Lubricated and Bare Carbon Surfaces Molecular Dynamics Study of Diffusion in Polymers Phillip Choi 166 Molecular photoassociation and photodissociation dynamics by femtosecond lasers Yongchang Han 279 Molecular Spin Battery Composed of Air-stable Neutral Radicals and Graphite Yasushi Morita 199 Multicolor nanoprobes based on silica-coated gadolinium oxide nanoparticles with highly reduced toxicity Multi-striped Orthogonal Photon-Photocarrier- Propagation Solar Cells (MOP3SC) with Redirection Waveguide Multiview 3D Display Using Varifocal Lenticular Liquid Lens Array N, S-doped hydrothermal carbons derived from L- cysteine and glucose for biosensor applications Nanoporous Biomaterials in Uremic Toxin Adsorption Nanoscale Wiring by Cu Electrodeposition in Supercritical Carbon Dioxide Emulsified Electrolyte toward 3D Integrated Circuits Nanotheranostics and Nanotoxicology The Nexus of Nano & Bio New Materials for charge storage applications New Nonlinear Optical Materials of Metal Chalcogenides with Promising SHG Signals New Phosphorescent Materials: Insights from Computational Chemistry Next generation of high-efficient heterojunction crystalline silicon solar cells Non-equilibrium Transitions in Driven Vortex Matter of Amorphous Superconducting Films Novel 3D Differential Phase Contrast Imaging System Timur Sh. Atabaev 348 Akira Ishibashi 129 Yong Hyub Won 183 B. T. Hu 389 Yoke Leng Sim 117 Masato Sone 328 Say Chye Joachim LOO 1 Andrew Grimsdale 43 Kuei-Fang Hsu 261 Alexander Brown 305 Takefumi Kamioka 132 Satoshi Okuma 47 Lambertus 189 Hesselink 416

444 Novel Magnetically Tunable Microstrip Antenna Novel Oxide-Ion Conductors based on a New Structure Family NdBaInO4 On the Coherence Characteristics of Fiber-Based Noise-Like Pulsed Laser Sources On the Existence of Stable Clusters in Polymer Melts: Consequences for Nucleation under Processing Conditions On-Chip Nonvolatile Memory for Standalone System using 0.18 um Standard CMOS Technology On-metal Framing of Organic-contact Cathode with High Proton Reduction Activity Optical industry profile measurement based on laser lock-in imaging Organic/inorganic nano-hybrids with high dielectric constant for organic thin film transistor applications Pair-Density Functional Theory for Superconductors Sharif Iqbal Mitu Sheikh 333 Masatomo Yashima 321 Yoonchan Jeong 286 Gerhard Eder 229 Nobuhiko Nakano 152 Shoko Kume 88 Xucai Yu 17 Yang-Yen Yu 359 Katsuhiko Higuchi 143 Photonic phase control in cobalt perovskite Yoichi Okimoto 19 Photovoltaic Performance of Dye-Sensitized Solar Cells Based on Diphenylamino-Carbazole Yousuke Ooyama 33 Substituted BODIPY Dyes Piezoelectric Energy Harvesting Performance of Nanofiber Composites Yong Soo Cho 42 Piezoelectric ZnO Thin Films & Their Application for Micro Energy Harvesting Devices Giwan Yoon 212 Plasmon Enhanced Two-photon Photoluminescence of Metal nanoparticles Qing-Hua Xu 271 Plasmonic nanoantennas for manipulating optics at nanoscale Timur Shegai 9 Plasmonic Photopatterning of Topological Defects in Liquid Crystals as Templates for Directed Colloidal Assembly Qi-Huo Wei

445 PLD-fabricated Nd-Fe-B thick-film magnets deposited on Si substrates Polymer Antireflection Film on Dye-Sensitized Solar Cells Polymer based composites for selective laser sintering additive manufacturing Practical Modeling of floating nanodot with no fitting parameter in Device Simulation Precise Structure Analysis of Materials for Energy and Environment Preparation and Characterization of a Novel Twolayer Cardiac Patch with electrical stimulation Preparation and characterization of pure titanium/hydroxyapatite nanocomposties manufactured via selective laser melting Preparation and characterization of temperature and ph-sensitive rod-coil diblock copolymers Preparation and Characterization of ZnO nanorods and their dye-sensitized properties Preparation and Evaluation of Gellan Gum/Mebeverine microspheres on the treatment of irritable bowel syndrome Preparation of Polymer with Perylenediimide Side Chain and Characterization of Its Nanotsructure Preparation of UV cured long fiber reinforced polymer films and Study on its laminate properties Probing electron scattering cross sections for molecules of technological importance Probing the structure and dynamics of nanomaterials for battery applications Research on the Elastic-Plastic Deformation Mechanism of Ti-H System Robust Superhydrophobic Sponge with Excellent Anti-Icing Properties Selection of Consecutive Two Frames for Shape from Random Camera Motions Masaki Nakano 123 Jenn-Kai Tsai 354 Yusheng Shi 112 Hiroshi Watanabe 53 Masatomo Yashima 307 Jou-Hsuan Chu 371 Changjun Han 341 Yang-Yen Yu 395 Yern Chee Ching 391 Chin-Yi Yang 380 Tomoyasu Hirai 178 Qin Yan 309 Gabriel Luiz Cruz de Souza 26 Serena A. Corr 24 Yingying Zong 246 Fatang Liu 280 Norio Tagawa

446 Self-consistent Bogoliubov-de Gennes theory of strong type-ii superconductivity in 2D electron Tsofar Maniv 49 systems at high magnetic fields. Self-organized nanostructure formation of III-V and grope IV semiconductors by using bismuth Hiroshi Okamoto 311 SEM beyond imaging in situ SEM experiments Ifat Kaplan- Ashiri 62 Si twinning superlattices on atomically flat mesas: Epitaxial growth and electrical characterization Andreas Fissel 314 Single-crystal graphene growth on SiC by infrared rapid thermal annealing Masao Nagase 249 Soft Matter Quasicrystals in Two and Three Dimensions Edgar Knobloch 214 Soft X-ray Resonant, Nano and Operando Masaharu Spectroscopy for Lithium Ion Batteries Oshima 287 Solid State Lithium Conduction and Disorder in Complex Oxides Eddie Cussen 72 Spintronic Sensors, Internet of Things, and Smart Living Philip Pong 327 Split ring resonators from Infrared to UV range Dao Hua Zhang 265 Split-ring resonator metamaterial fabricated by Toshihiro nanosphere lithograph Okamoto 266 Stimulated emission from photonic crystal cavity Masahiko with AlOx cladding layer Kondow 90 Strain Mode of General Flow: Characterization and Yasuya Implications for Flow Pattern Structures Nakayama 125 Structure and Electrical Properties of Gesubstituted Rhodium and Cobalt Antimony Hiroshi Fukuoka 22 Skutterudites Structure determination of aluminides applying state of the art electron crystallography methods Louisa Meshi 243 Structure, optical, electronic and magnetic properties of Fe-doped ZnO nanoparticles Pornsawan synthesized by solution combustion method and Sikam 349 first principle calculation 419

447 Studies on oxidation of adrenaline using CuPc encaged in MCM-41 zeolite as catalyst SURFACE TREATMENTS ON THE PURE TITANIUM IMPLANTS G4 (GRADE 4) USED IN DENTAL IMPLANTOLOGY Synergistic Combination Therapy Using a Core- Shell Lipid-Based Nanocapsule with Tunable Shell Thickness Synthesis of flower-like NiO/Fe3O4 composites and Its Sensing Performance Synthesis of MnOx/reduced graphene oxide nanocomposite as a negative electrode for lithium-ion battery Synthesis of Monodisperse Silica Particles Using Rotating Cylinder System Synthesis of one dimentional FePt nanomaterials under high magnetic field Synthesis of well-defined 3D printing and biocompatible polymers by living ring-opening polymerization Synthesis the humidity sensitive biocompatible electrode implant substrate with Ca-Al- LDH/OPC/PVA material Systematic Control of the Size, Density and Configuration of Pt Nanostructures on Sapphire (0001) by the Variation of Deposition Amount and Dwelling Time Temperature-dependent morphology of annealed gold films on silicon surfaces The control of crystallinity in polymer and perovskite solar cells The designing of coordination polymers consisting of late-transition metals and lanthanide ions for luminescence enhancement The Electrochemical Actuation of Nanoporous Nickel Mingtian Li 384 Saniye Ozgur 357 Chin-Hao Hsu 397 Hong Wang 352 Shao-Chieh Weng 289 Young-Sang Cho 361 Pei Wenli 291 Lan-Chang Liang 70 Chun-Sian Yu 374 Quanzhen Zhang 68 Ching-Ling Hsu 140 Yu-Chiang Chao 32 Zerihun Assefa 176 Kenneth K.W. Kwan

448 The mechanisms of thermal engineered laser shock peening for enhanced fatigue performance Yiliang Liao 124 The Small System Method To Compute Thermodynamic Data For 3D And 2D System Thuat T. Trinh 58 The Studies of Nano-shaped Hyaluronan on Chondrogenesis of ATDC5 Cells Min Kao 369 Themoelectric Materials for Energy Harvesting Anthony V. from Waste Heat Powell 79 Theoretical Studies on the Slow Magnetic Relaxation of Single-Molecule Magnets Bingwu Wang 101 Theory of Electronic, Optical, and Magnetic Properties of Graphene Nanodisks Alok Shukla 260 Thermodynamic properties by Equation of state of liquid sodium under pressure Huaming Li 273 Thermodynamic properties from ab-initio calculations Ti and other case studies Guy Makov 22 Thin film Silicon Nanowire/PEDOT:PSS Hybrid Solar Cells with Surface Treatment E Rusli 128 Three-dimensional Magneto-optic Spatial Light Modulator Composed of Artificial Magnetic Lattice Hiroyuki Takagi 184 Three-dimesional holographic optical tweezers HuiChi Chen 186 TiO2-based hybrid thin films as gate dielectrics for organic thin film transistor applications Yang-Yen Yu 360 Toward quantum bit generation using single highly charged ion implantation Makoto Sakurai 150 Transition States: The Geometry of Reaction Dynamics Charles Jaffe 306 Triangular MoS2 Transistor Yuan-Liang Zhong 325 Two-dimensional nanoparticle arrays as flexible SERS substrats by decorated gold nanoparticles on nanoclay Chih-Hao Wang 351 Ultrafast electron diffraction studies of lattice Hani E. Elsayeddynamics of femtosecond laser-excited bismuth Ali and antimony nanoparticles and thin films

449 Ultrafast Excited-State Dynamics of Diketopyrrolopyrrole (DPP)- Based Materials: Static versus Diffusion-Controlled Electron Transfer Process ULTRAFINE GRAINED PURE TITANIUM GRADE4 SURFACE MORPHOLOGIES AS DENTAL IMPLANT MATERIALS Ultra-High Pressure Synthesis, Stability, Physical Properties and Electronic Structure of Nitrogenrich Transition Metal Nitrides Ultrasonic fabrication of microfluidic systems from thermoplastic polymers Uncertainty Quantification using Polynomial Chaos Expansion in Numerical Simulations of Spent Nuclear Fuel Assemblies Understanding Molecular Recognition and Assembly at Biological-Inorganic Interfaces to Engineer New Functional Materials: Catalysts, Sensors, and Biominerals Use of magnesium-based alloys for stents: current status and future research directions Void shrinking and interfacial grain boundary migration in the diffusion bonding of 1Cr11Ni2W2MoV steel ZnTeO-based multiple band gap semiconductors for intermediate band solar cells Qana A. Alsulami 394 H. Aygul Yeprem 358 Masashi Hasegawa 206 Werner Karl Schomburg 219 Imane Khalil 267 Hendrik Heinz 164 Gladius Lewis 119 Hong Li 338 Tooru Tanaka

450 CC3DMR June 2017 Jeju island, South Korea Collaborative Conference on 3D and Materials Research (CC3DMR) June 2017, Jeju island, South Korea Collaborative Conference on 3D and Materials Research 2017 : This collaborative conference series is established to enable technological developments in the various fields of materials and to further the goal of unifying materials research in engineering, physics, biology, materials science, as well as chemistry and neuroscience. CC3DMR 2017, as the seventh conference in this series, offers materials researchers the opportunity to discuss and exchange information with the frontiers in their fields and network with scientists from various other fields for potential interdisciplinary collaborations. Conference Chair: Prof. Gregory J. Salamo, University of Arkansas, USA Conference Co-Chair of the CC3DMR 2016 Prof. Milko van der Boom, Weizmann Institute of Science, Israel

451 CC3DMR June 2017 Jeju island, South Korea CC3DMR 2017 Conference Schedule (tentative) 25 June Sunday 26 June Monday 27 June Tuesday On-site Registration in the Venue, 2:00-5:00PM (Carried on during the conference) Full day oral presentations, :00PM Poster Session from 5:30PM Conference Reception from 6:00PM - (Buffet & wine with live music) Full day oral presentations, :00PM Evening Activity, from 7:00PM PM (Transportation and tickets covered) 28 June Wednesday 29 June Thursday 30 June Friday Full day oral presentations, :00PM Conference Banquet from 6:00PM Welcoming & congratulatory addresses Live music show, etc. Full day oral presentations, :00PM Evening Activity, from 7:00PM PM (Transportation and tickets covered) All Day Tour, :00PM (Transportation, tickets & lunch covered)

452 CC3DMR June 2017 Jeju island, South Korea Jeju island Korea Jeju island: Located southwest of the Korean Peninsula, Jejudo Island ( 제주도 ) is a volcanic island in the shape of an oval that measures 73km from west to east, and 31km from north to south. As Korea s most southern region, the weather on Jejudo Island remains significantly warmer than the mainland even during the cold winter months. Jejudo Island is sometimes referred to as Samdado Island ( 삼다도, meaning the three many ) because of its abundance of rocks, women, and wind. Wind from the ocean blows steadily throughout the year and past volcanic activity has littered the island with an assortment of beautiful and unusually-shaped black rocks. The island s reputation of having an abundance of women points back to the time when fishing was the primary means of income and many men were lost at sea. Among all of Jeju s natural wonders, three sites have been recognized as World Heritage Sites by UNESCO (2007): Hallasan Mountain, Seongsan Ilchulbong Peak, and the Geomunoreum Lava Tube System. Hallasan Mountain is perhaps Jeju s most prominent geographical feature, rising out of the very center of the island. Seongsan Ilchulbong Peak has been recognized for its sedimentological characteristics and is one of the best places in the world to study Surtseyan-type volcanic eruptions. The third and final World Heritage Site is Geomunoreum Lava Tube System, one of the most extensive series of lava tube caves in the world.