RAGHAVENDRA, P. PALB 3217

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "RAGHAVENDRA, P. PALB 3217"

Transcription

1 DEVELOPMENT OF PARTIALLY CONVERTED NOVEL MALE STERILE LINES AND MARKER ASSISTED IDENTIFICATION OF MAINTAINER AND RESTORER GENOTYPES IN RICE (Oryza sativa L.) FOR AEROBIC CONDITION RAGHAVENDRA, P. PALB 3217 DEPARTMENT OF GENETICS AND PLANT BREEDING UNIVERSITY OF AGRICUTURAL SCIENCES BENGALURU 2015

2 DEVELOPMENT OF PARTIALLY CONVERTED NOVEL MALE STERILE LINES AND MARKER ASSISTED IDENTIFICATION OF MAINTAINER AND RESTORER GENOTYPES IN RICE (Oryza sativa L.) FOR AEROBIC CONDITION RAGHAVENDRA, P. PALB 3217 Thesis submitted to the University of Agricultural Sciences, Bengaluru in partial fulfilment of the requirements for the award of the degree of Master of Science (Agriculture) in GENETICS AND PLANT BREEDING BENGALURU July, 2015

3 Dedicated to my beloved father late Sri. Malleshappa and mother Smt. Manjula

4 DEPARTMENT OF GENETICS AND PLANT BREEDING UNIVERSITY OF AGRICUTURAL SCIENCES BENGALURU CERTIFICATE This is to certify that the thesis entitled DEVELOPMENT OF PARTIALLY CONVERTED NOVEL MALE STERILE LINES AND MARKER ASSISTED IDENTIFICATION OF MAINTAINER AND RESTORER GENOTYPES IN RICE (Oryza sativa L.) FOR AEROBIC CONDITION submitted by Mr. RAGHAVENDRA, P., ID NO. PALB 3217 in partial fulfillment of the requirements for the degree of MATER OF SCIENCE (AGRICULTURE) in GENETICS AND PLANT BREEDING to the University of Agricultural Sciences. GKVK, Bengaluru is a record of bona-fide research work done by him during the period of his study in this University under my guidance and supervision. The thesis has not previously formed the basis for award of any degree, diploma, associateship, fellowship or other similar titles. July, 2015 Bengaluru ADVISOR) Dr. Shailaja Hittalmani (MAJOR APPROVED BY: CHAIRMAN: (Dr. SHAILAJA HITTALMANI) MEMBERS: 1. (Dr. M. S. UMA) 2. (Dr. H. C. LOHITHASWA) 3. (Dr. V. B. SANATH KUMAR)

5 ACKNOWLEDGEMENT I feel the inadequacy of words to express my deep sense of gratitude and profound indebtedness to Dr. Shailaja Hittalmani, Professor and University head, Department of Genetics and Plant Breeding and Chairperson of my Advisory Committee for valuable guidance, constant supervision, constructive criticism, vivid encouragement and affectionate dealing throughout the period of investigation and during preparation of the manuscript. I confess that it has been a great fortune and proud privilege for me to be associated with her during my Master degree program. I express my whole hearted thanks to members of my Advisory Committee Dr. M.S. Uma, Professor and Head Dept. of GPB, V.C. Farm, Mandya. Dr. H. C. Lohithaswa, Professor, Dept. of GPB, V.C. Farm, Mandya. Dr.V.B.Sanath Kumar, Pathologist, Programme coordinator, KVK V.C. Farm, Mandya for their constant encouragement, suggestions and valuable guidance during the course of my study and investigation. For their kind help, constructive suggestions and encouragement during my investigation. I am very thankful to all my GPB dept. teachers for their valuable teaching and encouragement. I am very thankfull to Shivkumr, Mahadevaiah, Satheesh naik Ph D scholars, UAS, GKVK, Bengaluru who provided valuable suggestions for conducting my research. I take this opportunity to thank my senior friends Shilpa reddy, meera, uday, mohan, chandrakanth, prabhudev, pavan and keerthi for their selfless help, advice, moral support and affection. Pavan, pranesh, Showkath, pramod,shashi,kailash, syed sab, mohamod and junior friends, Beeresh,Sharath,nagarjun, vinay, mohan, sureh, manoj,adarsh,manu for their kind help and encouragement at every stage of my investigation. I feel it is better to remain indebted, than to express my deep sense of gratitude to my parents, guardians and brother for their blessings, encouragement, unquantifiable love and affection. I thank all my labmates, filed labours and non-teaching staff of the Dept. of Genetics and Plant Breeding for their kind co-operation and encouragement during my study and research. I finally thank all those who have helped me directly and indirectly to complete the research study to the best of my satisfaction. Bengaluru July, 2015 (RAGHAVENDRA P) P

6 Development of partially converted novel male sterile lines and marker assisted identification of maintainer and restorer genotypes in rice (Oryza sativa L.) for aerobic condition Raghavendra, P. ABSTRACT In order to expand potential of hybrid rice technology to the aerobic condition, the present investigation was undertaken to develop new CMS lines. In this view BC 2 F 1 and BC 3 F 1 populations derived from IR70369A MAS99 and KCMS31A MAS99 were evaluated for morpho- floral traits. The phenotypic foreground selection revealed that most of the plants were completely male sterile. The trait means of BC 2 F 1 and BC 3 F 1 populations for days to fifty per cent flowering, total tillers plant -1, panicles plant -1, plant height at maturity were comparable with the recurrent parent trait means. This confirmed the recovery of recurrent parent genome. The genetic variability studies indicated that heritability for most of the traits were found high with narrow difference between PCV and GCV except for stigma exertion, panicle exertion, total tillers and spikelet panicle - 1 had moderate heritability. Negatively skewed platykurtic distribution was observed for most of the traits in both populations indicating that these traits were governed by many genes with duplicate epistasis. The plants synchronising with recurrent parent were backcrossed to develop BC 4 F 1 in IR70369A MAS99. This conversion process was accelerated by Marker Assisted Background Selection (MABS) for KCMS31A MAS 99 derived populations. In conclusion nine quasi- CMS lines suitable for aerobic intermittent drought tolerant conditions were developed by converting MAS 99B into MAS 99A line. Simultaneously six new maintainers were identified through test crossing of BC 3 F 1 CMS lines with eight different male parents. The validation of eight SSR markers linked to Rf locus on testers revealed that RM171, RM1108, RM6100 were perfectly co-segregating with phenotype. Department of Genetics and Plant Breeding UAS, GKVK, Bengaluru July, 2015 Dr. Shailaja Hittalmani Major Advisor

7 ಏರ ಬ ಕ ಭತ ತದಲ ಲ ಅರ ಪರ ವತ ತನ ಗ ಡ ಹ ಸ ಗ ಡ ನ ಷ ಕಲತ ಸ ಲ ಗಳ ಅಭ ವ ದ ದ ಮತ ತ ಸ ಕ ತ ಗಳ ಸಹ ಯದ ದ ದ ಫಲಪ ರ ತಕ ಮತ ತ ಬ ಜ ಸ ಕರರ ಗಳ ನ ರ ತರ ಕ ರಕಗಳನ ಗ ರ ತ ಸ ವ ಕ ರ ಘವ ದ ರ ಪ ಪ ರಬ ಧ ಸ ರ ಶ ಹ ಬ ರರಡ ಭತ ತದ ಸ ಮರ ಥ ಯವನ ನ ಏರ ಬ ರಕ ಪ ರ ಸ ಥ ತ ಯಲ ಲ ಪ ರ ಕ ಷ ಸಲನ ಪ ರಸನತತ ಪ ರಯ ಗವನ ನ ಹ ಸ ಗ ಡನ ನ ಷ ಕಲತ ಸ ಲನಗಳನ ನ ಅಭ ವ ದ ಧ ಪ ಡ ಸಲನ ನ ಡ ಸಲ ಯ ತ ನ. ಈ ದ ಸ ಯಲ ಲ ಗ ಡನ ಸ ಕರಣವ ದ ಐರ ೭೦೩೬೯ಎ/ಎಮ ಎ ಎಸ ೯೯ ಮತ ನತ ಕ ಸ ಥ ಎಮ ಎಸ ೩೧ಎ/ಎಮ ಎ ಎಸ ೯೯ ಗಳ ಗ ಎಮ ಎ ಎಸ ೯೯ದ ಧ ದ ಮರನ ಸ ಕರಣ ಮ ಡ ಬ ದ ಬ ರಸ ಥ೨ಫ ೧ ಮತ ನತ ಬ ರಸ ಥ೩ಫ ೧ ವ ಶಸತರನ ನ, ಸಸ ಮತ ನತ ಹ ಗಳ ಗನಣಲಕ ಷಣಗಳ ಅಧ ಯನ ಮ ಡಲ ಗ ದ. ಫ ನ ಪಪ ಕ ಮನನ ಲ ಆಯ ಕಕಯ ಪ ರಕ ರ ಹ ಚ ಚ ನ ವ ಬ ಜ ತ ನ ಗಳ ಗ ದ ದವ. ಅವ ಗಳ ಸವಭ ವಗಳ ದ ಅಧಯಭ ಗದ ತ ಡ ಗಳ ತ ನ ಬ ರಡನವ ದ ಕ ಕ ಬ ಕ ದ ದ ಧನ ಗಳ, ತ ಡ ಗಳ ಸ ಖ, ಗ ಡದ ಎತ ತರ ಅವ ಗಳ ದ ನ ಪ ಷ ಕದ ಸವಭ ವಕ ಕ ಹ ಲ ಲಕ ಕ ಡನ ಬ ದ ಧದ. ಅನ ನವ ಶ ತ ಏರ ಳ ತ ಗಳ ಅಧ ಯನ ದ ಪ ರಕ ರ, ಶಲ ಕ ಗರ ಹ ರಹ ಯನವ ಕ, ತ ನ ಹ ರಹ ಯನವ ಕ,ತ ಡ ಗಳ ಸ ಖ, ತ ನ ಯ ಎಸಳ ಗಳ ಸ ಖ ಗಳನ ನ ಹ ರತ ನಪ ಡ ಸ ಥ ಹ ಚ ಚ ನ ಸವಭ ವಗಳಲ ಲ ದ ಶ ವ ಹ ರ ಪ ಗನಣ ಕಗಳಲ ಲ ವ ಭ ನ ತ ಹ ಗ ವ ಶವ ಹ ರ ಪ ಗನಣ ಕಗಳಲ ಲ ವ ಭ ನ ತ ಗಳ ನ ಡನವ ಕ ರ ದ ದ ವ ತ ಸ ಕ ಡನಬ ದ ದ ದರ ದ ಅವ ಗಳ ಗ ಹ ಚ ಚ ನ ಅನ ನವ ಶ ಕತ ದ ಖಲ ಗ ದ. ವ ಶಮಚಕರ ಮತ ನತ ನ ಡನಬದ ಲ ಲಕ ಯ ಅಧ ಯನ ದ ಪ ರಕ ರ ಹ ಚ ಚ ನ ಲಕ ಷಣಗಳ ಋಣ ತ ಮಕ ಅಧ ರ ಹಣ ಹ ದ ಧದ ನದ, ಅನ ಕ ಧ ತ ನಗಳ ನ ಯ ತ ರಣದ ಲ ಲ ವ. ಐರ ೭೦೩೬೯ಎ/ಎಮ ಎ ಎಸ ೯೯ ವ ಶಸತರಲ ಲ ದ ನ ಪಶಕದ ಜ ತ ಹ ಬ ರಡನವ ಗ ಡಗಳನ ನ ಮತ ನತ ಕ ಸ ಥ ಎಮ ಎಸ ೩೧ಎ/ಎಮ ಎ ಎಸ ೯೯ ವ ಶಸತರಲ ಲ ಬಹನರ ಪ ಎಸ ಎಸ ಆರ ಸ ಕ ತ ಗಳ ಸಹ ಯದ ಧ ದ ಹ ಚನ ದ ನ ಪಷ ಕದ ಜ ವತ ತ ನಗಳ ರನವ ಗ ಡಗಳನ ನ ಎಮ ಎ ಎಸ ೯೯ ಜ ತ ಮರನಸ ಕರಣ ಮ ಡ ಬ ರಸ ಥ೪ಫ ೧ ವ ಶಸತರನ ನ ಅಭ ವ ದ ಧ ಪ ಡ ಸಲ ಗ ದ. ಏಕಕ ಲದ ಲ ಲ ೯ ಅತ ನ ತ ತಮ ಬ ರಸ ಥ೩ಫ ೧ ಗ ಡಗಳನ ನ ೮ ಪ ರ ಕ ಷಕರ ಜ ತ ಸ ಕರಣ ಮ ಡ ಆರನ ಹ ಸ ಬ ಜ ಸ ಕರಣಗಳ ನ ಮ ಯಣಕ ರಕಗಳನ ನ ಗನರನತ ಸಲ ಗ ದ. ಏಳ ಆರ ಎಫ ಲ ಕಸ ಗ ಬ ಸನಗ ಯನಳಳ ಎಸ ಎಸ ಆರ ಸ ಕ ತ ಗಳ ಪ ರ ಷ ಕರಣ ಯ ಪ ರಕ ರ ಆರ ಎಮ ೬೧೦೦,ಆರ ಎಮ ೧೧೦೮ ಮತ ನತ ಆರ ಎಮ ೧೭೧ ಸ ಕ ತ ಗಳ ಪ ರಕಟ ಲಕ ಷಣದ ಜ ತ ಗ ಪ ರ ಪ ಣಯ ಸಹಪ ರತ ಕತ ಯನ ನ ಹ ದ ಧರನವ ದ ನ ಕ ಡನಬ ದ ಧದ. ಅನ ನವ ಶ ಯತ ಮತ ನತ ಸಸ ತ ಳ ಶ ಸರ ವ ಭ ಗ ಕ ಷ ವ ಶವವ ದ ಲಯ ಬ ಗಳ ರನ-೬೫ ಡ. ಶ ಲಜ ಹ ತ ತಲಮನ ಮನಖ ಸಲಹ ಗ ರರನ

8

9 CONTENT Sl. No TITLE PAGE No. 1 INTRODUCTION REVIEW OF LITERATURE MATERIAL AND METHODS EXPERIMENTAL RESULTS DISCUSSION SUMMARY REFERENCES APPENDIX

10 LIST OF TABLES Sl. No. TITLE PAGE NO. 1 Salient features of parents of the backcross populations Observations recorded on individual plants of BC 2 F 1 and BC 3 F 1 populations. List of SSR markers used for validation of fertility restoration (Rf) locus in rice testers List of CMS lines, testers and checks used in the development of rice hybrids List of hybrids developed involving nine CMS lines and eight testers in line x tester mating design Comparison of Parental trait means with BC 2 F 1 and BC 3 F 1 populations derived from IR70369A MAS99 in rice Comparison of Parental trait means with BC 2 F 1 and BC 3 F 1 populations derived from KCMS31A MAS99 crosses in rice Estimates of quantitative trait range and standardized range of BC 2 F 1 and BC 3 F 1 populations derived from IR70369A MAS99 and KCMS31A MAS99 in rice Estimates of quantitative trait PCV, GCV and heritability of BC 2 F 1 and BC 3 F 1 populations derived from IR70369A MAS99 and KCMS31A MAS99 in rice Estimates of quantitative trait Skewness and Kurtosis of BC 2 F 1 and BC 3 F 1 populations derived from IR70369A MAS99 and KCMS31A MAS99 in rice Details of phenotypic foreground selection in BC 2 F 1 and BC 3 F 1 populations derived from IR70369A MAS99 and KCMS31A MAS99 crosses in rice Superior CMS plants identified in BC 2 F 1 populations derived from IR70369A MAS99 and KCMS31A MAS99 crosses in rice

11 Superior CMS plants identified in BC 3 F 1 populations derived from IR70369A MAS99 and KCMS31A MAS99 crosses in rice Details of the polymorphic SSR markers survey on parents of BC 3 F 1 progenies for the cross KCMS31A MAS99 Proportion of recurrent parental genome in BC 3 F 1 progenies of cross KCMS31A MAS99 using rice SSR markers. Scoring data of male parents (testers) using seven SSR markers associated with Fertility restorer (Rf) locus for maintainer and restorer type allele Classification of crosses as maintainers and restorers based on pollen fertility, spikelet fertility and both. Number of restorers, maintainers, partial restorers and partial maintainers for different CMS lines Classification of rice genotypes into Restorer (R), Maintainers (M), Partial restorers (PR), Partial maintainers (PM) based on pollen and spikelet fertility across nine CMS lines

12 LIST OF FIGURES Sl. No TITLE Scheme of backcross followed to develop new CMS lines from two crosses in rice Distribution pattern of plant height at 45 days, days to 50% flowering and style length in BC 2 F 1 and BC 3 F 1 populations derived from IR70369A MAS99 Distribution pattern of stigma length, stigma exertion and days to maturity in BC 2 F 1 and BC 3 F 1 populations derived from IR70369A MAS99 Distribution pattern of total tillers, panicles plant -1 and plan height at maturity in BC 2 F 1 and BC 3 F 1 populations derived from IR70369A MAS99. Distribution pattern of panicle length, panicle exertion and Spikelets panicle -1 in BC 2 F 1 and BC 3 F 1 populations derived from IR70369A MAS99. Distribution pattern of Plant height at 45 days, days to 50% flowering and style length in BC 2 F 1 and BC 3 F 1 populations derived from KCMS31A MAS99. Distribution pattern of stigma length, stigma exertion and days to maturity in BC 2 F 1 and BC 3 F 1 populations derived from KCMS31A MAS99. Distribution pattern of total tillers, panicles palnt -1 and plan height at maturity in BC 2 F 1 and BC 3 F 1 populations derived from KCMS31A MAS99. Distribution pattern of panicle length, panicle exertion and Spikelets panicle -1 in BC 2 F 1 and BC 3 F 1 populations derived from KCMS31A MAS99. BETWEEN PAGES

13 Frequency of male sterile plants in BC 2 F 1 population derived from IR70369A MAS99 and KCMS31A MAS99 Frequency of male sterile plants in BC 3 F 1 population derived from IR70369A MAS99 and KCMS31A MAS99 Correlation between style length and stigma exertion in BC 3 F 1 population derived from IR70369A MAS99. Correlation between stigma length and stigma exertion in BC 3 F 1 population derived from IR70369A MAS 99. Correlation between style length and stigma exertion in BC 3 F 1 population derived from KCMS31A MAS99. Correlation between stigma length and stigma exertion in BC 3 F 1 population derived from KCMS31A MAS

14 LIST OF PLATES SL. NO TITLE Field view of BC 2 F 1 (A) and BC 3 F 1 (B) rice plants derived from IR70369A MAS 99(C 1 ) and KCMS31A MAS 99 (C 2 ) crosses. Schematic representation of crossing program followed to back crosses and generate aerobic rice hybrids Agarose gel profile of RM471 and RM437 SSR markers showing the amplification of 45 BC 3 F 1 s of the cross KCMS31A (Donor) MAS 99(Recurrent). Agarose gel profile of RM11 and 1370 SSR markers showing the amplification of 45 BC 3 F 1 s of the cross KCMS31A (Donor) MAS 99(Recurrent). Graphical genotyping of the 12 linkage groups of 45 BC 3 F 1 s in rice. Screening of polymorphic Rf locus specific SSR markers across the 8 male parents Microscopic view (10x) of pollen grains after staining with 2% Acetocarmine in rice BETWEEN PAGES

15 LIST OF APPENDICES SL. NO TITLE Trait mean values of BC 2 F 1 population derived from IR70369A MAS 99 crosses in rice Trait mean values of BC 2 F 1 population derived from KCMS31A MAS 99 crosses in rice Trait mean values of BC 3 F 1 population derived from IR70369A MAS 99 crosses in rice Trait mean values of BC 3 F 1 population derived from KCMS31A MAS 99 crosses in rice List of SSR markers used for Marker assisted Background Selection (MABS) in BC 3 F 1 for the cross KCMS31A MAS 99

16 I. INTRODUCTION Plants that fail to produce functional pollen grains are referred as male sterile. The role of cytoplasm in causing male sterility in rice was first reported in 1954 (Sampath and Mohantu 1954). Later Katsuo and Mizushima (1958) also observed a similar phenomenon in the progeny of the first backcross of Oryza sativa F. spontanea /Oryza sativa c.eujisakos. The cytoplasmic genetic male sterility (CMS) system is controlled by an interaction of cytoplasmic and nuclear genes. Presence of homozygous recessive nuclear genes for fertility restoration in association with sterility indicating genetic factors in cytoplasm make a plant male sterile. The discovery of a wild-abortive cytoplasmic male sterile (WA-CMS) in rice on Hainan Island in 1973 resulted in the huge success of three-line hybrid rice breeding in China. (Hua et al., 2009).Limited resources of cytoplasmic male sterility and low variation of CMS lines causes genetic vulnerability. Therefore, to diversify CMS lines breeders can transfer this character to the existing B lines through repeated backcrosses. Previous work in our research group showed that genotype MAS99isa maintainer line for cytoplasmic male sterility of WA type (Satheesh, 2015). Thus, it can be potentially converted to a cytoplasmic male sterile line. Backcross breeding method is a known method of transferring a target trait from donor line in to the genetic background of a recipient elite line. The purpose of repeated backcrosses with the recipient parent is to increase the contribution of the recipient parent genome (RPG) in progeny. Although this breeding method is useful for transferring of favourable alleles from donor parent to recipient parent, breeders don t have any direct control over the size of donor parent region or recombination rate (Semgan et al., 2006). However, in the case of CMS trait, breeders don`t need to conduct the MAS for targeting CMS and hence, the foreground selection step is omitted in backcross generations, because CMS is transferred from its donor into recipient parent by first cross based on the fact that this trait has a maternal inheritance (Herzog and Frisch, 2013). Therefore, one of the purpose of this study was to transfer cytoplasmic male sterility from IR70369A and KCMS31A line to MAS99 it is early maturing promising genotype suitable for aerobic condition and intermittent drought stress, with the ultimate goal of application of the resultant final CMS line in hybrid rice seed production. One of the main constraints of rice cultivation and production is water shortage during periods of low rainfall, which affects the vegetative growth rate and grain yield (Tao et al., 2006). It is estimated that more than 50% of the world rice production area is affected by drought (Bouman et al., 2007). Thus, the ultimate goal of improving crop performance for the vast rice cultivation areas of the world where rainfall is unreliable can be achieved by searching for alternative sources of male sterile lines and evaluation Development of partially converted novel male sterile in rice (Oryza sativa L.) for aerobic condition 1

17 of new CMS lines and their maintainer lines for adaptability to aerobic condition, stability of pollen and spikelet fertility and other agronomic characteristics which is vital step in hybrid rice development. In India, rice is cultivated on an area of m. ha with production of m. t. with the productivity of 3.1 tons/ha (INDIASTAT, 2013), wherein hybrid rice is cultivated on an area of 1.71 m. ha (3.9 % of total area) with the average productivity of 6.6 tons/ha. (IRRI, , Hybrid rice R&D). Karnataka state contributes 3.55 m. t. of rice production grown over an area of 1.31 m. ha with an average yield of 2.7 t/ha (Anon., 2012).In order to keep pace with the growing population, the estimated rice requirement by 2025 is about 130 M. tonnes. Plateauing trend in the yield of HYV s, declining and degrading natural resources like land and water and acute shortage of labour make the task of increasing rice production quite challenging. Among several options besides crop management, an innovative genetic option of hybrid rice technology is practically feasible and readily adoptable (Viraktamath et al., 2010). The success of hybrid rice breeding depends on the extent of natural outcrossing on CMS lines (Hittalmani and Shivshanker, 1987). Rice, being an autogamous plant, does not encourage outcrossing. Floral morphology and flowering behaviour of A lines and the male parents decides the extent of outcrossing (Oka and Norishima, 1967).The outcrossing depends on a number of floral characters, viz., percentage of panicle exertion, style length, stigma length, stigma breadth, stigma area and stigma exertion etc. Hence assessing and understanding the genetic variability and the inheritance pattern of floral traits is essential for proper choice of CMS lines in hybrid breeding programme (Sheeba et al., 2006). Identification of maintainers and restorers is prerequisite for commercial exploitation of heterosis. Conventionally, maintainers and restorers are identified by testcrossing a large number of genotypes with CMS lines and then evaluating their progeny for pollen and spikelet fertility. This method is laborious, time-consuming, and less accurate. Therefore there is a need to identify molecular markers that are tightly linked to Rf genes so that marker-aided selection (MAS) can be used as a tool to identify restorers more quickly and more efficiently. Hence the present investigation was under taken to develop and evaluate male sterility introgressed populations in BC 2 F 1 and BC 3 F 1 for the development of new CMS lines suitable under water scarce situation i.e. for aerobic condition and simultaneously test cross to eight different genotypes to develop hybrids and evaluated them for restorability or maintainability. 2 Raghavendra, P

18 The objectives envisaged in the study are as follows: 1. Evaluation of male sterility introgressed BC 2 F 1 populations derived from IR70369A MAS99 and KCMS31A MAS99 crosses for morpho-floral traits and developbc 3 F 1 populations. 2. Evaluation of male sterility introgressed BC 3 F 1 populations derived from IR70369A MAS99 and KCMS31A MAS99 crosses for morpho-floral traits and forward to BC 4 F 1 populations. 3. Identification of maintainer and restorers to new BC 3 F 1 CMS lines via spikelet fertility and pollen fertility. 4. Validation of SSR markers linked to Rf locus on tester genotypes. Development of partially converted novel male sterile in rice (Oryza sativa L.) for aerobic condition 3

19 II. REVIEW OF LITERATURE Rice is the most important cereal food crop of India. Plateauing of rice yields, coupled with restriction on area expansion and water scarcity made urgent need to increase paddy yields by at least 3 million tonnes each year to maintain self-sufficiency in rice production is the major challenges for Indian rice breeders. Hybrid rice technology may be one of the approaches for breaking the yield plateau (Siddiq, 1997). Nowadays hybrid rice breeding is one of the widely recognized and readily available technologies for increasing rice production including aerobic rice. A pollination mechanism (such as male sterility) is needed to encourage cross pollination for economic production of hybrid seed. But production of promising aerobic rice hybrids by three lines system primarily depends upon the superiority of parental lines. Therefore there is need for development of potential component lines of three line hybrid system suitable under water scare situation. The literature relevant to the present study is presented under following headings. 2.1 Rice ecosystems and water scarcity. 2.2 Development of new CMS lines in rice for aerobic condition. 2.3 Evaluation of CMS lines for Morpho-floral traits. 2.4 Variability, heritability, correlation studies in rice CMS lines. 2.5 Identification of Restorer and maintainers through pollen and spikelet fertility. 2.6 Validation of Rf locus specific SSR markers on tester genotypes. 2.1 Rice ecosystems and water scarcity Rice is unique in its ability among all the cereal crops to grow in a wide range of environments. These environments vary with respect to elevation, rainfall pattern, depth of flooding and drainage, hydrological status, soil type and by the adaptation of rice to agro ecological factors ( Huke and Huke, 1997). Depending on the hydrology, the rice environment can be classified into 4 types: irrigated, rainfed lowland, deep-water and rain fed upland (Poehlman and Sleper, 1995). Irrigated rice is the most common ecosystem, where standing water of 5-10 cm is maintained in the field (Bouman et al., 2007). Worldwide, there are about 79 million hectors of irrigated lowland rice out of the total 150 million hectares grown, which provide 75 per cent of the world s rice production. Irrigated rice on an average yields 5 t ha -1 (Maclean et al., 2002). This system has been the main focus of the Green Revolution (O'Toole, 2004). High levels of investment in fertilizers by farmers in irrigated systems are profitable, because the risk of crop loss due to drought or flooding is low. Lowland rice is the second most important rice ecosystem, representing about 25 per cent of total rice production area. Fields do not receive irrigation, relying entirely on rainfall or drainage from higher lands in a watershed. Worldwide there are about 54 Development of partially converted novel male sterile in rice (Oryza sativa L.) for aerobic condition 4

20 million ha of rainfed lowlands, which contribute 19 per cent of the world s total rice production, with an average yield of 2.3 t ha -1 (Maclean et al., 2002). In the irrigated and deep-water rice ecosystems, water shortage does not usually occur, but in both the rainfed upland and lowland cultivation systems, drought stress is often the most important abiotic stress factor limiting yields (Atlin et al., 2006). Roughly 27 million ha of rainfed rice are recurrently affected by drought, the largest, most frequently and severely affected areas being eastern India (about 20 million ha) ( Huke and Huke, 1997). Recently, improved upland rice varieties with higher harvest index, improved input responsiveness and consequently higher yield potential have been developed at IRRI, in Brazil and several Asian countries. Such aerobic rice varieties, combine aerobic adaptations of traditional upland varieties with input-responsiveness, lodging tolerance and yield potential of irrigated varieties (Atlin, 2006). Aerobic rice may replace irrigated rice and rainfed lowland rice in some parts of the world facing decreasing water supplies for agriculture, as is already taking place in Northeast China (Bouman, 2009). Recently in India several high yielding aerobic rice varieties have been developed. MAS946-1 and MAS26 developed by UAS, Bengaluru recently are high yielding, nonlodging, semi tall, early maturing with quick early vigor, well exerted long and heavy panicles, more number of productive tillers and desired grain quality (Gandhi et al., 2011). Drought is the most important source of climate-related risk for rice production in rainfed areas (Pandey et al., 2007). The 2002 drought in India reduced its rice production by 17 million tonnes, 20 per cent of annual production. The recent drought (23% deficit in rainfall) during Kharif 2009 affecting 50 per cent of the districts in India has been estimated to cause a loss of 11 m t in rice production (Anon., 2010). In the Eastern states of India Jharkhand, Orissa and Chhattisgarh alone, rice production losses in severe droughts which occur about once in five years is estimated to be about 40% of total production (Pandey and Bhandari, 2007). Rainfed rice fields experience different types of drought. Types of drought can be identified by the nature of the drought, such as the severity and timing of the drought in relation to the stage of crop development. There are three basic drought patterns affecting rice production viz., vegetative stage, intermittent and terminal drought stresses (Kamoshita et al., 2008) and they affect yield differently. So defining the type of drought stress is important for targeted breeding strategy. Terminal drought mainly develops towards the end of the growing season, but it sometimes begins well before flowering. In this case reduced spikelet fertility becomes a major factor contributing to yield loss (Liu et al., 2006). Intermittent or continuous droughts (occurring between the tillering and flowering stages), may greatly reduce yields despite no apparent drought symptoms (eg: leaf 5 Raghavendra, P

21 rolling), mainly as a result of reduced leaf expansion and photosynthesis (Fukai et al., 1995). In this view our present investigation was under taken to develop new CMS lines for aerobic and intermittent drought condition there by we can develop rice hybrids suitable for aerobic condition. 2.2 Development of new CMS lines in rice for aerobic condition. Cytoplasmic male sterility (CMS) is a cornerstone of hybrid production in many crops. In three line hybrid system, utilization of cytoplasmic male sterile (CMS), maintainer and fertility restorer lines is necessary for production of hybrid seeds. Limited resources of CMS and low variation of CMS lines cause genetic vulnerability to pathogens. Therefore, diversifying the cytoplasmic male sterility sources is indispensable for a sustainable production system of hybrid seed in aerobic condition. Pradhan et al. (1990a) reported four indica cultivars viz. Kalinga-I, PTB10, IR and Co.41 with male sterile cytoplasm and fertility restoring genes, while the cultivar Krishna was found to maintain the male sterility in all the cases. All the plants in the F 1 of Kalinga-I Krishna were observed to be completely male sterile and continued to show complete pollen sterility in subsequent backcross generations when backcrossed with recurring pollen parent, Krishna. Thus, it was possible to develop a new cytoplasmic-genetic male sterile line in indica rice (Krishna A) with Kalinga-I male sterile cytoplasm and this male sterile cytoplasm was found to be genetically different from others. Pradhan et al. (1990b) studied 28 Indica-Japonica crosses, two Indica cultivars V20B and Sattari were identified to possess male sterile cytoplasm with fertility restoring genes. It was possible to develop a new Japonica cytoplasmic genetic male sterile line (Zhunghua-1) on Indica male sterile cytoplasm (V20B) by repeated backcrossing the complete pollen sterile plants of V20B x Zhunghua-1 to the recurring male parent, Zhunghua-1. The study indicated that it would be possible to develop male sterile lines from indica-japonica crosses only when there is sufficient amount of reciprocal differences with respect to pollen sterility. Dalmacio et al. (1995) made crosses by using 46 accessions of O. perennis and two accessions of O. rufipogon as female parents with two restorers (IR54, IR64) of WA cytosterility. Sterile hybrids were backcrossed with the respective recurrent parents. Of all the backcross derivatives, one line having the cytoplasm of O. perennis Acc and the nuclear background of IR64 was found to be stable for male sterility. The newly developed CMS line has been designated as IR66707A. This line is completely sterile (0% seed set) under selfed conditions. Nematzadeh et al. (2006), identified five suitable maintainer varieties through testcrosses with IR58025A and the transfer of wild abortive cytoplasm was carried out by seven successive backcrosses. Five new CMS lines were developed by this approach in Development of partially converted novel male sterile in rice (Oryza sativa L.) for aerobic condition 6

22 well adapted high yielding improved varietal background such as Nemat, Neda, Dasht26, Amol3 and Champa. Manonmani et al. (2006) develops new hybrid combinations of IR69616A/ADT43 and IR58025A/CO47. These were then evaluated in a test-cross nursery during the 2000 kharif season. The hybrids IR58025A/CO47 and IR69616A/ADT43 showed a maintainer reaction with 100% pollen sterility at the flowering stage. The two male parents, CO47 and ADT43, were used as recurrent parents in the backcrossing program. Pradhan S. B. And Jachuck P. J., (2008), developed two male-sterile lines, KalashreeA and PadminiA, with a Miz.21 cytoplasm source through indica/indica hybridization followed by repeated backcrossing with their respective recurrent male parents (Kalashree and Padmini) up to the BC 6 generation. These two cytoplasmic malesterile lines are suitable for use in the development of hybrids for lowland situations owing to their intermediate to semi-tall stature, late flowering duration, good grain quality and easy fertility restoration ability. New CMS lines developed through substitution backcrossing have been reported by Ingale et al. (2008), After repeated backcrossing of six generations (Rabi 2003), two new CMS lines COMS14 A (IR69616 A/ADT43) and COMS15 A (IR58025 A/CO 47) were developed with better floral characteristics. These new lines can be exploited to develop medium slender rice hybrids with good grain quality. Xian-hua et al. (2013), conducted study to develop and characterize a novel cytoplasmic male sterile (CMS) source which was identified from Dongxiang wild rice (Oryza rufipogon) by crossing Dongxiang wild rice as female with Zhongzao 35, an indica inbred variety, as male and continuous backcrossing with Zhongzao 35. Ahmadikhah et al. (2015), conducted study for first time to transfer CMS into maintainer line Yosen B in restricted generations using MABC method. The resultant F 1 hybrid of IR68897 A/Yosen B cross was backcrossed to Yosen B, and CMS plants in each backcross generation (from BC 1 F 1 tobc 3 F 1 ) were selected based on phenotyping test and marker-assisted backcrossing. Molecular assessment of backcross progenies was conducted using a mitochondrial CMS-specific marker and 34 polymorphic nuclear SSR markers in early generations (from BC 1 F 1 to BC 2 F 1 ) and was continued using 9 additional SSRs and 82 ISSR markers in BC 3 F 1. MABC strategy could successfully recover the recurrent parent genome (RPG) in BC 3 F 1 generation, and decreased heterozygosity of final CMS plants. On the basis of background selection using SSR and ISSR markers, single BC 3 F 1 CMS plants were identified having higher similarity to Yosen B parent with >98.0% of RPG. Restorability test with known WA restorer lines (viz. IR36 and IR24) showed that combination of Yosen A x IR24 could produce highly fertile F 1 hybrid. Evaluation of some important agronomic traits of the final CMS line (BC 4 F 1 ) at field condition showed that it was comparable to the original maintainer fertile counterpart. Phenotypic and marker-assisted selections could considerably decrease the time needed 7 Raghavendra, P

23 for full recovery of recurrent parent genome, so that final CMS line showed a high similarity to original fertile counterpart Marker assisted background selection Parental polymorphism and marker assisted selection Chen et al. (2001) attempted molecular marker-assisted introgression of Xa21 from `IRBB21' to `6078'. The entire process took one generation of crossing followed by three generations of backcrossing and one generation of selfing. Background selection was conducted in BC 1 F 1 and BC 2 F 1 using AFLP markers detecting a total of 129 polymorphic bands between `6078' and `IRBB21'. 98.8% of the genetic background from the recurrent parent was recorded. Gopalakrishnan et al. (2008) made background analysis using mapped microsatellite markers with foreground selection to identify superior lines that combine useful genes from a non-basmati donor line IRBB55. Background analysis enabled selection of recombinants with recurrent parent genome to the extent of 86.3% along with the quality traits. The backcross-pedigree breeding strategy facilitated recovery of additional desirable characteristics from the donor in some of the selections. Siva Kumar et al. (2013) revealed that 36 primers showed distinct polymorphism among the donor and recurrent parents studied, indicating the robust nature of microsatellites in revealing polymorphism. Using microsatellites we can select the donor genome type individuals with greater confidence during marker assisted backcross breeding. Ahmadikhah et al. (2015) developed the F 1 hybrid of IR68897 A/ Yosen B and it was backcrossed to Yosen B, and CMS plants in each backcross generation (from BC 1 F 1 to BC 3 F 1 ) were selected based on phenotyping test and marker-assisted backcrossing. Molecular assessment of BC progenies was conducted using a mitochondrial CMSspecific marker and 34 polymorphic nuclear SSR markers in early generations (from BC 1 F 1 to BC 2 F 1 ) and was continued using 9 additional SSRs and 82 ISSR markers in BC 3 F 1. MABC strategy could successfully recover the recurrent parent genome (RPG) in BC 3 F 1 generation, Studies on Graphical genotyping Conceptual introduction to graphical genotypes was given by Young and Tanksley (1989), which is the graphical representation of parental origin and allelic composition of the entire genome. The primary objective of this exercise is to transform numerical RFLP data into easily interpretable and accurate graphic images. Graphical representations of linkage maps have many advantages over numerical genotypes or linkage maps. Since graphical genotypes derived from marker data indicate genomic constitution and parental derivation for all points in the genome, whole genome selection in breeding for phylogenic characteristics in plants and animals was considered plausible. Development of partially converted novel male sterile in rice (Oryza sativa L.) for aerobic condition 8

24 Graphical genotypes of backcross and F 2 populations in tomato were developed to demonstrate this procedure. A software package to generate graphical genotypes was also developed. Some comparisons between molecular maps in DH and RIL populations have been made in Maize ( Mrigneux et al., 1993), wheat (Henry et al., 1988) and rice (Courtois, 1993; Antonio et al., 1996). He et al. (2001) studied comparison of DH and RIL populations and reported the difference in genetic distances between the populations, which may arise due to different genetic backgrounds. Fahr et al. (1993) investigated the origin of chromosomal segments of maize inbred B86 from its parental inbreds using RFLPs generated by 3 restriction enzymes and 178 DNA probes spread over the genome. 119 polymorphic DNA probes were used to graphically genotype the inbred and arrive at the allele contributions of the parents. Genetic analysis of cybrids produced by asymmetric fusion between O. rufipogan and O. sativa was attempted by Kinoshita et al. (1993) through graphical genotyping at 2 homozygous RFLP loci identical to W124 (O. rufipogan). Eathington et al. (1997) opined that the practical utility of the function of marker genotype data in selection of particular lines or plants or families was envisaged with reference to backcrossing small genomic segments from a donor parent into an elite line through graphical genotyping of backcross progeny. They stated that in addition to genotypic value, complementation of parental genotypes as well as phenotypes was crucial for selection of parents in any cross. Introgressed cotton germplasm were graphically genotyped by Cantrell et al., (1998). The chromosomal location of rice stripe resistance gene stv-b was determined by Saito et al. (1998), using graphical genotyping and linkage analysis with molecular markers. The stripe resistance gene from the indica rice cv. Modan was introgressed into several Japanese rice varieties. They found four RFLP markers in Modan the resistant donor. Graphical genotyping of the resistant progeny revealed a chromosomal segment ascribable to Modan and associated with stripe resistance. Tamura et al. (1999) used RFLP markers to graphically genotype resistance to Nephotettix cincticeps of the parental rice lines Norin PL 2, Kanto PL 6, Norin PL 5, Norin P 16 and Aichi 42, with resistance genes derived from indica varieties Pe-bi-hun, Tadukan, C203-1, Lepedumai and Rantajemas 2, respectively. Several chromosome domains originating from each indica donor parent were detected in all lines. There were 4, 6, 7, 2 and 1 domains in Norin PL 2, Kanto PL 6, Norin PL 5, Norin P 16 and Aichi 42, respectively. Vaishali (2003) used SSR markers to graphically genotype twenty nine NILs developed by introgressing Azucena root QTL into IR64. The NILs carried the introgressions on chromosomes 1, 2, 7 and 9. 9 Raghavendra, P

25 Graphical genotyping was performed by Li et al. (2012) in a set of BC 5 F 2 :F 6 families in wheat variety Laizhou 953 with introgression from Am3. SSR markers were used to genotype the progeny. Results indicated that around 96.1% of the recipient genome was retained, while 59% of the donor genome was recovered across the various introgression lines developed. 2.3 Evaluation of CMS lines for Morpho-floral traits. The success of a breeding program depends largely upon the amount of genetic variability present in the population and the extent to which the desirable traits are heritable. A survey of genetic variability with the help of suitable parameters such as genotypic co-efficient of variation, heritability and genetic advance are absolutely necessary for an efficient breeding program (Mishra et al., 1999). Therefore, this experiment was undertaken to estimate variability present in quasi CMS lines and to evaluate their phenotypic acceptability. Ramesha et al. (1998) evaluated three new and diversified CMS sources viz., Oryza nivara and O. rufipogon. Oryza nivara observed high frequency of abortive pollen, very high panicle exsertion (92-96%), good stigma exsertion (48-65%) and high outcrossing ability (38-52%) in those CMS lines. Three CMS lines were evaluated for morpho-floral traits they found that CMS lines were stable in spikelet and pollen sterility. They were shorter and earlier than the male parents. On an average they had 65.6% panicle exertion and 53.7% stigma exertion. These CMS should be improved on these two characters, because, panicle and stigma exertion rate directly influenced the out crossing in rice. (Joshi et al., 2003). Abeysekera et al. (2003) evaluated fifty-three CMS lines for their morphological and floral traits that influence outcrossing rate based on the results they concluded that variation in plant height, panicle length, stigma exertion rate and panicle exertion rate appeared to have an influence on outcrossing rate. Nematzadeh et al. (2006) studied agronomical characters and allogamy-associated traits of the five newly developed CMS lines were studied for their interrelationship. Anther length had a significant positive correlation with the duration of glume opening (0.759) and high correlation of (0.698) with the angle between lemma and palea. The results indicated that Nemat A, Neda A, Dasht A were more suitable as parents for hybrid seed production due to their favourable and superior floral characteristics in comparison to IR58025A. Salgothra et al. (2007) undertaken the investigation to study the influence of various floral traits on seed setting in different cytoplasmic genetic male sterile (CMS) lines. High to medium range of coefficients of heritability were observed in different character in the CMS lines as well as maintainer lines. Panicle exsertion, angle of opened lemma and palea, and stigma size are mainly responsible for inf1uencing seed setting percentage in CMS lines of rice. Development of partially converted novel male sterile in rice (Oryza sativa L.) for aerobic condition 10

26 Syed et al. (2007) studied 21 CMS lines from five different male sterility source for better panicle exsertion ratio (PER), stigma exsertion ratio (SER), outcrossing ratio (OCR) and good phenotypic acceptability, the CMS lines IR62829A, IR58025A, IR68897A, IR68896A, IR68885A (WA), IR69617A (Basmati type), IR66707A (Oryza perennis type) and 913A (Dian type) were identified as good CMS lines for hybrid rice production. Sidharthan et al. (2007) studied a total of thirty five CMS lines and twenty four maintainer lines of divergent origin. About 16 lines were found to be completely pollen sterile while others showed spikelet fertility ranging from 0.50 percent to 6.50 percent. The CMS lines DRR 6A, DRR 7A, PMS 17A, COMS 14A, COMS 15A, RTN 2A, RTN 3A, RTN 6A, RTN 18A, IR68888A were found promising for the character of pollen sterility, panicle exertion, stigma exertion Jayaramaiah et al. (2007) evaluated nine CMS lines among nine CMS lines IR62829A, IR58025A and IR70369A were most ideal as they showed complete male sterility. IR62829A and IR58025A are already used in large scale seed production. Therefore the new promising CMS line IR70369A was identified in the present study, as it possessed most of the desirable characters for enhancement of outcrossing potential. Fourteen genetically diverse CMS lines and their maintainers were studied by Nurunnabai et al. (2008) of which, the CMS lines viz., IR58025A, IR 68886A, IR 68888A, IR 68897A, IR 68899A, IR 69622A and IR 69626A were found to be usable female parents for hybrid rice breeding due to their appreciable phenotypic acceptability, stable pollen sterility, panicle exsertion rate and good outcrossing rate. Shivkumar et al. (2010) evaluated 7 new CMS lines for their morphological and floral traits. All the CMS lines evaluated exhibited complete pollen sterility and spikelet sterility. KCMS 29A recorded the higher stigma exsertion (30.31%).KCMS 31A had the longest style (1.26 mm) and stigma (1.20 mm) which also had the best panicle exsertion (79.28%). Gireesh et al. (2010) evaluated eighteen CMS lines and their isogonic maintainers were evaluated for agronomical traits Generally A lines took more number of days to 50 per cent flowering than the corresponding B lines. All the CMS lines were shorter than their corresponding maintainers. Number of panicles were more in B line than in A lines. More number of spikelet s per panicle was observed in KCMS 17A, KCMS 16A and KCMS 21A. Maximum out crossing rate was noticed in KCMS 11A, KCMS 16A, CRMS 31A and KCMS 12A. Most of the CMS lines showed 100 per cent pollen sterility and less than 3.4 per cent spikelet fertility Two CMS lines viz., KCMS 11A, KCMS 16A and CRMS 31A were identified as promising ones as they showed high stigma exertion, low pollen fertility and low spikelet fertility and are suitable for hybrids development. Umadevi et al. (2010) evaluated a total of 74 CMS lines in rice and their maintainers for morphological and floral characters. Out of 74 CMS lines, forty two CMS lines were completely pollen sterile. For all other CMS lines spikelet fertility ranged from 11 Raghavendra, P

27 0.51 to 4.55 per cent. The medium duration CMS lines viz., COMS 13, COMS 15, IR 68281, IR 69626, DRR 7, RTN 6, RTN 13 and PMS 17 were found promising for the characters viz., pollen sterility (%), panicle exsertion (%), stigma exsertion (%). Pandey et al. (2010) evaluated 24 CMS lines of rice derived from wild abortive male sterility source for various agronomical and floral traits. Out of 24 CMS lines IR68897A, IR68628A, IR68886A, IR68896A, IR68280A, APMS6A, DRR6A were completely pollen sterile. CMS lines IR58025A, IR62829A, IR68897A, IR68886A, IR68896A, IR69617A (Basmati type), and IR75601A were found promising CMS lines for good phenotypic acceptability characters viz., pollen sterility, panicle exertion, stigma exertion. Vasoukolaei et al. (2010) showed that glume opening time had significant positive correlation with filament length (0.720) and stigma length (0.889). Hasan et al. (2011) assessed the desirable characteristics of fourteen genetically diverse CMS lines for their phenotypic acceptability, plant height (cm), days to 50% flowering. Panicles per plant, stability for pollen sterility, panicle exertion rate and out crossing rate. The CMS lines viz. BRRI1A. IR 58025A. BRRI10A. BRRI9A. BRRI3A, IR 75608A, and 1132A have been found to be usable female parents for hybrid rice breeding due to their appreciable phenotypic acceptability, stable pollen sterility, panicle exertion rate. Mahalingam et al. (2013) studied the genetic parameters and association among the floral traits of CMS lines and identification of parental lines having potential outcrossing ability for hybrid seed production. Among the five CMS lines and fifty one tester lines studied for eleven floral traits, CMS line COMS 23A registered higher mean value for style length, breadth and panicle exsertion. The genotype COMS 24A had greater stigma breadth, while COMS 25A had long style with good stigma length and breadth. All the CMS lines had above 99.50% pollen sterility. Ghadi et al. (2013) evaluated 33 male sterile lines derived from backcross for Anther length, panicle exertion, pollen sterility, stamen filaments length, stigma length, glum length, floret length, floret width, pollen fertility, panicle length, panicle exsertion rate, Days to flowering were evaluated. The results of pollens sterility indicated that the 4 CMS lines, Neda A, Nemat A, Shastak Mohammadi A and Gerde A were completely sterile. Induction of sterile cytoplasm has led to partial exsertion of panicles. Mean comparison of traits showed that male sterile line of Hasani AR has the longest length of stigma (2.93 mm) and shortest length of anther (1.87 mm), respectively.. Ali et al. (2013) made an attempt to study variability and genetic parameter analysis in ten quasi CMS (cytoplasmic male sterile) lines of aromatic rice in BC 3 generation was evaluated for different agronomic and floral characters with grading on their phenotypic acceptability. Significant variations were observed for all the characters under the study. The higher phenotypic variances than the corresponding genotypic variances of number of total spikelet per panicle, number of filled grain per panicle and Development of partially converted novel male sterile in rice (Oryza sativa L.) for aerobic condition 12

28 out crossing rate indicated greater influence of environment for the expression of these characters. On the other hand anther length and stigma length showed least environmental influence. 2.4 Variability, heritability, correlation studies in rice CMS lines To formulate any crop improvement programme in plant breeding, a thorough knowledge on the nature and magnitude of variability present in the population is required. The phenotypic expression of a character is the result of the interaction between genotype and environment. Hence, the total variation needs to be partitioned into variance due to genotype (heritable) and variance due to environment (non-heritable) for assessing the true breeding behavior of the phenotype. The efficiency of selection in plant breeding largely depends upon the amount of heritable variation present in the material. Maurya (1976), reported high heritability for days to flowering, plant height, number of grains per panicle and test weight in segregating populations of rice. Yang et al. (1986) reported that stigma length, stigma exertion, spikelet length/width ratio and spikelet length had higher heritability values and genotypic and phenotypic correlations between them were close. Geeta et al. (1992) reported the existence of considerable variation in 11 CMS lines for female floral traits like pistil length, stigma length, stigma exertion, panicle exertion and number of spikelets per panicle. Mruthunjaya and Mahadevappa (1995) reported that heritability was high for plant height, total tillers and productive tillers. Xio et al. (1996) reported considerable variability in parents and segregating generations for days to 50% flowering, plant height, panicle length, in inter specific crosses of rice where O.rufipogon (IRGC105491) was used as the male in a cross with CMS line V20A. Rao and Yuan (1998) studied eight male sterile lines belonging to wild abortive types (V20A, Zhengshan 97A, BO A, Jin 23 A and Zhi A), IDR or Indonesian paddy rice type (U1A), dwarf abortive type (Xieqinzio A), and BT or japonica type (80-4A) during the winter season of From five seedlings per replication observations were recorded on length, total tillers, panicle bearing tillers and plant height at the vegetative (60d) and flowering stages were also recorded for each tester line. Pollen reaction was studied using an I-KI 1% solution. The exertion of stigmas outside the floret was well excpresed in BO A, Jin 23 A, U1A and Zhi A lines, Jin 23 A, V20A and Zhengshan 97A. Honarnejad (1999) reported considerable variability in parents and segregating generations produced via a half diallel for days to flowering, days to grain maturity, plant 13 Raghavendra, P

29 height, panicle length, number of tillers per plant, 100 grain weight, number of filled grains per panicle and sterility per cent in seven Iranian and foreign rice cultivars and their F 2 progenies. Ali et al. (2000) reported high heritability for plant height, 100 seed weight and number of tillers per plant and panicle length in F 2 population of rice. Banumathy et al. (2002) noticed high heritability for panicle exertion, stigma exertion, style length and stigma length. Satish et al. (2003), reported high GCV and PCV values for panicle number, number spikelets per panicle, number of grains per panicle and grain yield per panicle. Satyanarayana et al. (2005) found high heritability for plant height, days to 50% flowering, total tillers, productive tillers and panicle length. Singh et al. (2005) found high heritability for plant height, days to 50% flowering, total tillers, productive tiller and panicle length. Sheeba et al. (2006) reported low heritability for days to 50% flowering where as high for panicle length, spikelet number panicle, panicle exertion, stigma exertion, style length and stigma length. Sheeba et al. (2006) evaluated ten CMS lines with the objective of studying variability for twelve floral characters. Reported that all characters exhibited high heritability except days to 50 per cent flowering. Maximum GCV was recorded for number of spikelets per panicle followed by percentage of stigma exsertion. Syed et al. (2007) reported the presence of considerable variation among CMS lines for various morphological, floral and agronomic traits, studied The complete pollen sterility was observed in all CMS lines, on the basis of better panicle exertion ratio (PER), stigma exertion ratio (SER) and good phenotypic acceptability, CMS lines can be used for their exploitation in commercial hybrid rice seed production in Pakistan. Hasan et al. (2011) observed moderate heritability (38.34%) for Panicle exertion rate of CMS lines. The genotypic and phenotypic coefficient of variation was not remarkably varied from each other for most of the characters studied. Mahalingam et al. (2013) evaluated five CMS lines and observed moderate GCV and PCV estimates were observed for stigma length, style length and stigma exsertion rate. High heritability was recorded for five traits viz., stigma length, style length, and stigma exsertion rate. Development of partially converted novel male sterile in rice (Oryza sativa L.) for aerobic condition 14

30 2.4.2 Correlation between style length, stigma length and stigma exertion rate. Virmani and Athwal, (1973) reported that there was positive correlation among style length, stigma length, stigma exertion and spikelet length. Li and Yang (1986) worked out correlation between stigma length, per cent stigma exertion and found that the correlation between pair of characters were significant. Kato and Namai (1987) reported that percentage of spikelets with protruding stigma was positively associated with pistil size and stigma size. Elsy et al. (1998) studied the floral characteristics of 8 CMS lines Genotypes with high rate of stigma exertion recorded higher style length. Banumathy et al. (2002) reported that the floral traits viz., stigma size and percentage of stigma exertion had significant and positive correlation with percentage of out crossing. Mahalingam et al. (2013) reported that Stigma length had positive non significant association with stigma exsertion rate. 2.5 Identification of Restorer and maintainers through pollen and spikelet fertility. The dire need of increasing rice productivity and production encouraged rice scientists to develop and disseminate hybrid rice technology in the tropics. The use of cytoplasmic male sterility system in developing hybrids in crops is possible only when effective maintainers and restorers are identified. Therefore, it is imperative to identify maintainers and restorers from the germplasm for development of component lines in a hybrid programme. Pollen or spikelet fertility or both have been used as an index to fix the restoration ability of the lines (Sutaryo 1989). Raj and Virmani (1989) identified Suweon lines 222, 303, 304 and 305, Cheolweon lines 21 and 29, Bokgwangbyeo, Jibu 2, Jinheung and Nongbong are maintainers almost all the sources of CMS (wild rice abortive pollen, CMS-bo or BT, CMS-TN, Gambiaca, Oryza rufipogon and Oryza sativa var. spontanea) used. However, restorers were only identified for the wild abortive pollen and Gambiaca systems. Bijral et al. (1989) crossed 35 indica rice cultivars of short, medium and long growth periods with cytoplasmically male sterile (CMS) lines Zhen Shan 97A, IR48483A and IR46830A. IR and RR8585 restored fertility and China 988, China 1007 and Sattari maintained sterility in all 3 CMS lines. Sutaryo (1989) identified Bahbolon, Cimanuk, Batang Pane, Citanduy, Ciliwung and Bogowonto as restorers and Bahbutong, Adil, Cisokan and S397b40-2 as putative maintainers for V20A male sterile line. 15 Raghavendra, P

31 Pham et al. (1990) test crossed Twenty-two early and midseason rice cultivars with 4 CMS lines and F 1 hybrids were assessed for Spikelet fertility. OM576, OM80, IR66 and IR were effective restorers for the CMS lines IR46830A and IR54752A. OM86-9, OM90 and IR were effective restorers for IR48483A. Pradhan et al. (1992) test crossed Twenty-one locally adapted, high yielding, elite breeding lines of rice as pollen parents were crossing with 5 CMS lines( 4 with wild abortive (WA) and one with Kalinga-I cytoplasm). Most cultivars were partial restorers (25-79% spikelet fertility) for all 5 CMS lines and there were at least 2 effective restorers (>80% spikelet fertility) for each CMS line, except for Krishna A (Kalinga-I), which had only one, namely Kalinga-I. Results indicated that the cytoplasm of Krishna A from Kalinga-I source may be different from Krishna A and other CMS lines having a WA source. The behaviour of some lines towards the CMS lines of the same WA source was sometimes variable, possibly because of nucleocytoplasmic interaction. Chandra et al. (1993) test crossed eighty nine locally released varieties with V20A and produced eighty nine F 1 s. Fourteen cultivars were classed as maintainers, 37 as restorers and 38 as partial restorers. The frequency of maintainers was greater in Indian than in IRRI cultivars. Bobby and Nadarajan (1994) assessed the fertility restoration ability of five restorer lines with ten CMS lines. spikelet fertility(per cent) was taken as criterion for the restoration ability of R lines, based on this the line ARC 11353R is considered as the best restorer followed by IR 36R for WA source of cytoplasm. These people also observed the variation in the restoration ability of R lines for same CMS source. Jayamani et al. (1994) evaluated eighty four hybrids, their pollen parents and isogenic maintainers (B lines) to identify maintainer and restorers for CMS lines. Pollen fertility was used to classify cultivars with less than 5 per cent pollen fertility as potential maintainers, those with 6-20 per cent as partial maintainers, per cent as partial restorer and more than 96 per cent as potential restorers. Kumari et al. (1997) used three exotic cytoplasmically male sterile (CMS) lines of wild abortive (WA) origin and 43 male parents including 26 locally released varieties and 17 elite varieties for crossing and hybrids and parents were evaluated for fertility. They identified 18 as effective maintainers, 7 as effective restorers and 16 as partial restorers among 43 male parents used. Ganesan et al. (1998) reported that, the cultivars IR R, AS781/3, C37, CBT04001 and PMK2 were effective restorers for the WA (wild abortive) source of CMS lines and also identified nine genotypes as potential maintainers, but no restorers were identified for the CMS line IR66707A, with Oryza perennis as its source of cytoplasm. Development of partially converted novel male sterile in rice (Oryza sativa L.) for aerobic condition 16

32 Borkakati and Chetia (2000) identified Guni, ARC 10372, Kapilee, Aditya, Krishna and Kushal as Maintainer for PMS 2A, Banglami, Guni, ARC 10372, Monoharsali, Kapilee, Chilarai, Annada, Krishna and Aghoni for PMS 3A, Heera, Mahsuri and Aghuni for IR 58025A and Satya for IR 62829A. Potential restorers identified were Luit and IR 50 for PMS 3A and PMS 10A, Luit for IR 58025A. Identified the male sterile, maintainer and restorer lines can be used as parental lines for hybrid rice breeding suited to rainfed situations. Anand et al. (2002) identified Gautam, Dhanlaxmi and Prabhat as restorers and Pusa 1040 as maintainer for the CMS line IR 58025A. Dhanlaxmi, Saroj, Pusa 1107, PSRM and RAU as restorers and Gautam as maintainer for the CMS line IR 68897A. Prabhat, Pusa 1040, PSRM and RAU as restorers and RAU as maintainer for the CMS line IR 68886A. Shiv Datt and Mani (2002) testcrossed Sixty Basmati rice cultivars with good agronomic or grain quality traits with established Basmati CMS line IR 68281A. The cultivars UPRI , UPRI , UPRI , UPRI , UPRI , PK , and Khao Dawk Mali were identified as effective Basmati restorers. The cultivars IET 14709, VL Basmati 2, and Basmati Aman, were identified as Basmati maintainers of cytoplasmic male sterility. Sabar and Akhter, (2003) evaluated for identification of restorer and maintainer lines using three hundred uniform lines including sixteen (16) cytoplasmic male sterile (CMS) lines from International Rice Research Institute (IRRI), Philippines based on results 26 restorers and 34 maintainers had been identified. Joshi et al. (2003) crossed three cytoplasmic male sterile (CMS) lines with 14 tester genotypes F 1 were tested for pollen and spikelet fertility based on results five restorers, three partial restorers, two partial maintainers and four maintainers were identified. Bisne and Motiramani, (2005) crossed four CMS lines having WA cytoplasm background with eight testers and obtained thirty two hybrids. The identification of maintainers and restorer lines was conducted by observing spikelet and pollen fertility. The variation in the behaviour of fertility restoration indicated that either the fertility restoring genes are different or that their penetrance and expressivity varied with the genotypes of the parents or modifiers of female background. Seven cytoplasmic-genic male sterile (CMS) lines of rice having wild abortive (WA) cytoplasmic male sterility source and one having Oryza perennis CMS source were crossed with 34 entries to assess their maintainer/restorer behaviour Among the genotypes tested, Annapoorna, Kanchana, IR 36, Mattatriveni and Aiswarya are recognized as effective restorers for WA cytoplasmic male sterile lines. Jyothy produced completely sterile hybrids with all CMS lines. Aruna, Pavizham and Ptb 10 were maintainers for five CMS lines (Rosamma et al., 2005). 17 Raghavendra, P

33 Raju et al. (2006) screened 11 genotypes for the fertility restoration ability using 5 CMS lines, 5 effective restorer and one maintainer were identified. The number of restorers for WA cytosterility was found higher. Duraj and Nadarajan (2007) identified seven male parents, i.e. BR , IR 31406, IR , IR , MDU 3, MDU 4 and Ponni, as effective restorers for all the five male sterile lines, i.e. PMS 9A, PMS 10A, V 20A, IR 58025A and IR 62829A. The other three pollen parents, i.e. BR B-2, IR 20 and IR , were either partial restorers or partial maintainers of the CMS lines. They concluded that differential reaction of same genotype in restoring fertility of different lines of the same CMS source might be due to interaction between nuclear and cytoplasmic genomes. Sabar et al. (2007) studied pollen fertility and spikelet fertility in hybrids derived from 109 rice genotypes and 4 CMS lines. Twenty restorer and twenty six maintainers have been identified for use in hybrid rice research program. Akhter et al. (2008) evaluated Two hundred thirty nine rice genotypes for their status in hybrid rice gene pool during 2005 and 2006.results revealed that of these 239 test crosses twelve restorers and 16 maintainers (8 Basmati and 8 non-basmati lines) were identified for use in hybrid rice breeding programs. Four basmati and eight coarse lines were identified as restorers from the tested genotypes. Most of the genotypes were found partial restorer and partial maintainer. Sarial and Singh, (2008) used twenty-seven improved aromatic and 18 nonaromatic genotypes of rice were test-crossed with four cytoplasmic male-sterile lines (IR 58025A, IR 62829A, PMS 3A and PMS 10A). They identified Basmati 385, Chandan, P , HKR 241-IET-12020, SAF Khalsa 7 and Karnal Local as effective restorers. Basmati 370, Pusa basmati 1, P615-K and P were effective maintainers. Eight CMS lines were crossed as lines with 31 genotypes as testers to get 248 hybrids. Based on the results of pollen and spikelet fertility analysis they found that. Among the 248 hybrids 168 hybrids were expressed as restorers 52 as Partial restorers, 28 as maintainers. (Umadevi et al., 2010). Shivkumar et al. (2010) conducted an experiment to identify usable maintainers and restorers for 9 CMS lines were crossed with eleven testers in a line x tester fashion. Based on the percent spikelet fertility in hybrids Among the testers MSN-20-13, MSN- 62, MSN-63, MSN-64 and MSN 68 were identified as good maintainers whilekmr-3, KMR-4, MSN-67 and MSN-69 as good restorers. Based on pollen fertility (%) and spikelet fertility (%) Jayasudha and Deepak, (2010) identified 10 genotypes as potential restorers. Among them RDHR203-3 and R were identified as potential restorers for three lines viz., CRMS31A, CRMS32A and IR58025A. Among others WAR B-B-3, CR and Chinikapoor Development of partially converted novel male sterile in rice (Oryza sativa L.) for aerobic condition 18

34 were identified as potential restorers for CRMS31A and IR58025A. IR68830-NDR-1-1 for CRMS31A and R , OR RAU and WAR89-4-A9-1- B-B-B-2 were considered as good restorers for CRMS32A. Naresh Babu (2010) developed sixty nine F 1 hybrid by crossing four CMS lines IR68888A, IR68897A, IR 58025Aand IR 79156A with eighteen male parents and based on both pollen fertility and spikelet fertility ten genotype found to be effective restorer, four effective maintainer and remaining fifty five were partial in fertility restoration reaction. Arif et al. (2012) conducted an experiment, comprised of hundred rice hybrids derived from two CMS lines (IR 58025A and Pusa 6A) and fifty tester (male) following L x T mating design, Out of 50 male lines 19 lines behaved like restorer and 3 lines behaved like maintainer with both of CMS line. Bhuiya (2012) conducted a study to identify potential restorers and maintainers from indica/japonica derivative lines and conversion of selected maintainers possessing desirable plant type into CMS lines. 65 test cross combinations including one wild abortive cytoplasmic male sterile (CMS) lines and 46 pollen parents 14 were restorers (21.54%), 27 were partial restorer (41.54%), 14 were partial maintainers (21.54%) and 10 were maintainers (15.38%). Khera et al. (2012) carried out observations on spikelet fertility for the identification of restorers and maintainer lines. Out of the 121 genotypes analyzed, majority of the lines were either partial maintainers or partial restorers and 18 genotypes behaved as restorers while 16 as maintainers. Hussain and Sanghera (2012) conducted Study to evaluate 36 cross combinations developed by crossing 2 CMS lines with 18 testers in line x tester mating design to identify effective restores and maintainers based on results they categorized 3 lines as effective restores viz. K , K and SR-2 and 5 lines were categorized as maintainers viz. SKAU-405, Jhelum, SKAU-407, China-1007 and SKAU-391. The average proportion of restorers, partial restorers, partial maintainers and maintainers were 16:22:33:27, respectively. Sharma et al. (2012) used three cytoplasmic-genic male sterile (CMS) lines of rice having wild abortive (WA) cytoplasmic male sterility source and were crossed with 60 genotypes to identify their restorer/maintainer nature. Among the genotypes tested, 16 were found to be common as effective restorers for all the three CMS lines. These genotypes may be tested for heterosis for development of rice hybrids. Three genotypes viz; Narendra Usar-3, CR and Maleshiya produced completely sterile hybrids with all the three CMS lines which may be used in developing new male sterile lines. Krishnalatha et al. (2012) studied restorability of CMS lines using three CMS lines viz., APMS 6A, CRMS 32A and PUSA 6A and six testers viz., SR-6-SW-8-1, R , R , Super rice-7, Super rice-8 and Jitpiti. Based on 19 Raghavendra, P

35 the pollen fertility (%) and spikelet fertility (%) two genotypes i.e. Super rice-8 for APMS 6A and R for CRMS 32A were identified as potential restorers and two genotypes i.e. SR-6-SW-8-1 for APMS 6A and R for CRMS 32A were identified as maintainers. Soni et al. (2012) used three cytoplasmic male sterile (CMS) lines of rice having wild abortive (WA) cytoplasmic male sterility source were crossed with 9 entries to assess their maintainer/restorer behaviour the result stated based on the pollen fertility and spikelet fertility percentage 3 partial maintainer, 6 partial restorers and 6 potential restorers were identified and frequency of potential restorers was much higher and no effective maintainer could be identified in the material understudy. Veeresha et al. (2013) test crossed fifty three (53) rice genotypes with two CMS lines viz., IR58025A and IR68888A during kharif These F 1 s were evaluated for their restorability/ maintainability during summer From these 53 test crosses, fifteen restorers and only one maintainer were identified for use in hybrid rice breeding programs. Mallikarjuna et al. (2013) conducted study on fertility restoration of 90 rice hybrids derived from eight cytoplasmic male sterile lines and ten testers based on pollen and fertility tests they found that among the male parents tested, Thanu, KMR-3, KMR-4, KMR-12, MSN-36, MSN-91, MSN-93, MSN-98 and MSN-99 were recognized as effective restorers for all the nine cytoplasmic male sterile lines. MSN-75 produced completely sterile hybrids. Das et al. (2013) studied ten cytoplasmic male sterile (CMS) lines and twenty five elite rice genotypes of diverse source of origin to evaluate the genotypes in order to identify potential restorers and maintainers from test crosses. The F 1 s (crossed between genotypes and CMS lines) showed different fertility reactions as twelve genotypes expressed restorer (R) reaction and two exhibited maintainer (M) reaction. Shama et al. (2013) conducted experiment with 4 CMS lines of rice (WA), IR A, IR-79156A, IR-80555A and Pusa-6A, and 35 testers A total of 140 hybrids were analysed over two seasons for pollen and spikelet fertility to identify the maintainers and restorers Some mutants that behaved as restorer for one CMS line acted as maintainer for another CMS line, i.e. BM-5, BM-16, BM-28 and BM-32. Five cytoplasmic male sterile lines with Wild Abortive (WA) CMS source and one CMS line having Oryza perennis cytoplasm were crossed with 20 rice genotypes to assess their restorer/maintainer behaviour. They found that the genotypes, IR R, IR , TNAU and TNAU were identified as effective restorers while ADT 43, ASD 19, CB and CO(R) 47 produced completely sterile hybrids with CMS lines carrying WA cytoplasm.( Banumathy et al., 2013) Dar et al. (2014) reviewed previous studies and inferred that the ratio of restorers was lower than partial restorers, maintainers and partial maintainers. The presence of Development of partially converted novel male sterile in rice (Oryza sativa L.) for aerobic condition 20

36 restorers and maintainers among elite genotypes reveals the possibility of developing rice hybrids. Satyapal et al. (2014) generated 60 hybrids using three CMS lines IR58025A, CRMS31A and CRMS32A and 20 diverse testers were crossed in line tester fashion. Pollen and spikelet fertility test Out of 60 test crosses they identified 9 restorers, 37 partial restorer, 11 partial maintainer and one maintainer. Ali et al. (2014) conducted an experiment to identify stable maintainers and restorers for three CMS lines having wild abortive type sterility inducing genes in local rice germplasm. One hundred and twenty nine test crosses were made by using 43 aromatic rice genotypes and three CMS lines. Finally they identified 6 effective restorers, 3 effective maintainers, 5 partial sterile and 29 partial fertile ones. Sahu et al. (2014) conducted experiment with three cytoplasmic male sterile (CMS) lines of rice having wild abortive (WA) and Kalinga cytoplasmic male sterility source these were crossed with seven testers to identify their restorer/maintainer nature. Total of 21 hybrids were subjected to pollen and spikelet fertility analysis revealed that 8 perfect restorers, 5 partial maintainers and 8 partial restorer. Jakkrit et al. (2014) identified the restorer s and maintainers, to estimate heterosis of hybrid rice, and to identify fertility-restorer genes of F 2 populations. The analysis of 31 test crosses revealed 6 restorers and 9 maintainers based on pollen fertility. Jamil et al. (2015) studied pollen and spikelet fertility of 150 hybrids derived from crossing five CMS lines with 30 genotypes. Among the 150 test hybrids, pollen parents of 25 hybrids were expressed as restorers 78 as partial restorer, 22 as maintainers and 25 as partial maintainers. Satheesh Naik (2015) developed one hundred F 1 hybrids were by crossing four CMS lines viz., IR62829A, IR68888A, IR70369A and KCMS31A with twenty-five male parents. Out of twenty-five genotypes used as male parents, based on both pollen and spikelet fertility eight genotypes viz., OYC13, OYC21, OYC22, OYC24, OYC36, OYC80, OYC89 and OYC 142 were found to be effective restorers for all the CMS under study. MAS99 was effective maintainer for all the CMS and MAS26 was effective maintainer for all except IR62829A. The remaining fifteen genotypes were partial in fertility restoration or maintenance behavior. 2.6 Validation of Rf locus specific SSR markers. Test cross nursery is the important step in three line hybrid rice breeding to identify effective maintainer and restorer lines. Identification of maintainer and restorer by crossing and evaluation is costly, time consuming, and laborious step. Therefore there is need to identify marker linked to Rf locus which will differentiate restorers and maintainers. 21 Raghavendra, P

37 Young et al. (1983) determined cyto-genic relationship among six of the cytoplasmic-genetic male sterility (CMS) rice lines: Zhen Shan 97A, V20A (wild rice Oryza sativa f. spontanea), Yar Ai Zhao A (Gambiaca cytoplasm). Pankhari 203A (Taichung Native 1 cytoplasm), Wu 10A (Chinsurah Boro II or BT cytoplasm), and MS 577A (O. sativa f. spontanea cytoplasm). They classified six CMS lines into four different cyto-sterility systems as follows: Wu 10A and Pankhari 203A (S1), Zhen Shan 97A/V20A (S2), Yar Ai Azhao A (S3) and MS577A (S4). The corresponding nuclear genes interacting with a specific cytoplasm to induce sterility in these lines were designated as S1-rf (for S1), S2-rf (for S2), S3-rf (for S3) and S4-rf (for S4). Yang et al. (2002) investigated the pollen fertility of F 2 individuals of crosses Zhenshan 97A/ZSP-1 and Xing A/ZSP-1 of rice. Results showed that fertility restoration of the cytoplasmic male sterility (CMS) in these crosses was controlled by 2 independent restorer genes. The results of linkage analysis indicated that the restorer genes in ZSP-1 were located in the same regions of Rf-3 and Rf-4. Zhu et al. (2003) studied the inheritance and mapping of fertility restoration of HL-CMS line, Congguang 41A. They found that, fertility of HL-CMS was restored by a single dominant nuclear gene. They used Microsatellite markers and a restorer gene was mapped on chromosome 10 located at a genetic distance of 7.8 and 3.6 cm apart from microsatellite markers RM258 and OSR33, respectively. Evidence showed that restorer genes clustered on chromosome 10 in the rice genome. Tan et al. (2004) detected major gene conferring fertility restoration for the CMS- D1 system by microsatellite markers in advanced inbred lines consisting of 196 maintainers and 62 restorers developed in breeding programmes of hybrid rice involving the CMS-D1 system. The gene was mapped between two simple sequence repeat markers, OSR33 and RM228, on chromosome 10, and was temporarily designated as Rf- D1 (t). The genetic distances of the gene to the two microsatellite markers were 3.4 and 5.0 cm, respectively. Li et al. (2005) constructed SSR marker based linkage map covering chromosome 10 and the short arms of chromosomes 1 and 11 of rice and applied for mapping fertilityrestoring genes in Zhenshan 97A/(Zhenshan 97B/Milyang 46) F 6 population consisting of 704 lines. Four QTLs were detected, among which Rf4 on the long arm of chromosome 10 displayed a major effect, Rf3 on the short arm of chromosome 1 had a considerable effect, and qrf10 and qrf11 in the pericentromeric regions of chromosomes 10 and 11, respectively, had minor effects. It was also found that Rf3, qrf10 and qrf11 contributed to higher spikelet fertility in the presence of the major gene Rf4, whereas qrf10 and qrf11 showed little effect in the presence of both Rf3 and Rf4. Wang et al. (2005) used a set near isogenic lines of rice carrying a gene for fertility restoration from cv. Minghui 63 and a genetic background from D297A to determine the major restorer gene of D-type hybrid rice restorer line. A near isogenic line, NIL 818, which contained a major restorer gene and a genetic background that is very similar to that of D297A was chosen. Hybrids derived from crossing NIL 818 with Development of partially converted novel male sterile in rice (Oryza sativa L.) for aerobic condition 22

38 D297A, D62A and Zhenshan 97 A showed a fertility segregation ratio of 3:1. The results indicate that NIL 818 carries a major fertility restorer gene. Zhu et al. (2005) used bulked segregant analysis (BSA) of a F 2 population derived from rice D62A/Ruby B to map the nuclear fertility restorer gene for wild abortive (WA) cytoplasmic male sterility. They screened 397 microsatellite primer pairs, distributed on 12 chromosomes for polymorphism between the parents and between two bulks representing fertile and sterile plants. One microsatellite marker RM182, located on chromosome 7 produced polymorphic products. The nuclear fertility restorer gene for WA cytoplasmic male sterility was mapped on chromosome 7.High-resolution mapping of Rf4 locus was carried out using simple sequence repeat (SSR) markers and newly designed markers in a F 2 population to establish more precisely the genetical and physical maps of the Rf4 gene. The genetic linkage analysis indicated that five SSR markers namely RM6737, RM304, RM171, RM5841 and RM228 located on the long arm of chromosome 10 were linked with the Rf4 gene. Rf4 was flanked by two SSR markers RM171 and RM6737 at distances of 3.2 and 1.6 cm, respectively (Ahmadikhah and Karlov, 2006). Majid et al. (2007) established marker-aided selection strategies for the two major Rf genes (Rf3 and Rf4) governing fertility restoration of cytoplasmic-genetic male sterility (CMS) in rice. They observed Polymorphisms between restorer and non-restorer lines using RG140/PvuII for Rf3 located on chromosome 1 and S10019/ BstUI for Rf4 located on chromosome 10. Result indicated that close linkage to Rf genes and distinct banding patterns, STS markers RG140/PvuII and S10019/ BstUI are well suited for marker-aided selection, enhanced backcross procedures, and pyramiding of Rf genes in agronomically superior non-restorer lines. The combined use of markers associated with these two loci improved the efficiency of screening for putative restorer lines from a set of elite lines. Li et al. (2007) used F 2 population derived from the cross of Zhong 9A/R68 to map the fertility-restoring (Rf) gene for Yinshui cytoplasmic male sterility (CMS). A fertile bulk was constructed by pooling equal amount of 10 highly fertile lines and a sterile bulk was obtained by pooling equal amount of 10 highly sterile lines. Four hundred and thirteen pairs of SSR primers which distributed on 12 chromosomes were screened for polymorphism between the parents and between the two bulks. RM 283 on chromosome 1 and RM5756, RM258. RM6100, RM171 on chromosome 10 were found to be polymorphic between the parents and between the two gene bulks. A total of eighty two-excessive sterile lines were selected from Zhong 9A/R68 F 2 population to estimate the genetic distance between the five SSR markers and fertility-restoring genes, respectively. A Rf gene was located on chromosome 1 with a distance of 6. 7 cm to RM283, and the other RF gene was mapped on the long arm of chromosome 10 flanked by RM5756, RM258, RM6100 and RM171 at distances of 10.4, 8.0, 2.4 and 4.2 cm, respectively. 23 Raghavendra, P

39 Bazrkar et al. (2008) tagged restorer genes for wild abortive (WA) CMS source by studying 222 individual plants from a F 2 population of a cross between IR58025A x IR42686R. Four Rf genes were tagged to simple sequence repeats (SSR) markers on chromosomes 1, 7, 10, 12 by recessive class analysis. The recombination frequency between the marker and the restorer trait were converted to genetic distances using Kosambi function. A new Rf locus designated as Rf 7 on chromosome 12 was found to be linked to RM7003 at a genetic distance of 13.3 cm (LOD6.12). RM443 and RM315 were flanking the Rf3 gene at a genetic distance of 4.4 (LOD 10.29) and 20.7 cm (LOD 3.98) on chromosome 1, respectively. The Rf6 was flanked on both side with SSR markers RM258 and RM591 at a genetic distance of 4.4 (LOD 10.29) and 23.3 cm (LOD 3.39) located on chromosome 10. Majid et al. (2008) studied the genetic relationship among three cytoplasmic male sterility (CMS) systems, consisting of WA, Dissi, and Gambiaca. The results from this study showed that the pollen fertility restoration in all three CMS systems was governed by two independent and dominant genes with classical duplicate gene action. They used Three F 2 populations, generated from the crosses between the parents of good-performing rice hybrids that possess WA, Dissi, and Gambiaca CMS cytoplasm, to map the Rf genes. For the WA-CMS system, Rf3 was located at a distance of 2.8 cm from RM490 on chromosome 1 and Rf4 was located at 1.6 cm from RM1108 on chromosome 10. For the Dissi-CMS system, Rf3 was located on chromosome 1 at 1.9 cm from RM7466 and Rf4 on chromosome 10 was located at 2.3 cm from RM6100. The evect of Rf3 on pollen fertility appeared to be stronger than the evect of Rf4. In the Gambiaca-CMS system, only one major locus was mapped on chromosome 1 at 2.1 cm from RM576. Sheeba et al. (2009) analysed nine SSR and three CAPS markers reported to be linked to Rf genes along with two previously unreported SSR marker on two mapping population namely an F 2 population derived from the cross IR 62829A/ KMR 3 and a BC 1 F 1 population from the cross IR 62829A/ IR 10198A/ IR A.. Result indicated RM6100 was observed to be closely segregating with fertility restoration in both the mapping populations and was located at a distance of similar to 1.2 cm. The largest phenotypic variation was accounted for the region located between RM311 and RM6100. Development of partially converted novel male sterile in rice (Oryza sativa L.) for aerobic condition 24

40 III. MATERIAL AND METHODS The present study involved two different experiments viz., 1) Development of new CMS lines for aerobic condition includes two parts i.e. study of two BC 2 F 1 male sterile introgressed back cross populations for their morpho- floral traits under aerobic condition conducted during summer 2014 and evaluation of two BC 3 F 1 male sterile population for their morpho- floral traits under aerobic conditions conducted during kharif ) Identification of maintainers and restorers to the new quasi-cms lines conducted during summer 2015 at experimental plots of Department of Genetics and Plant Breeding, UAS, GKVK, Bengaluru located at an altitude of 930 meters above mean sea level (MSL), 12 58' North latitude and longitude East, which falls in Agro-climatic Zone No.5 of Karnataka. Most of these soils are red sandy loam soil and are characterized by low water and nutrient holding capacities and thus are low in productivity ( The soil fertility gradually rises from upper terraces to lower terraces. In general the soil texture is grouped under silty-clay-loam to clayey with ph around 6.5. The annual rainfall of experimental site (UAS, Bengaluru) ranges from mm to mm. The details of the plant material used and methods followed in the experiments conducted are presented below separately. Information on protocols and statistical tools used for analysis is also presented in the respective experiments. 3.1 Experimental material Evaluation of male sterility introgressed BC 2 F 1 populations for morpho- floral traits and develop BC 3 F 1 populations. The experimental material for the present study comprised of two BC 2 F 1 populations derived from a cross IR70369A MAS99 consists of 35 plants and KCMS31A MAS99 consists of 32 plants. The salient features of parents used in backcross are given in Table 1. IR70369A and KCMS31A are already established CMS lines; MAS99 is drought tolerant, early maturing promising rice genotype suitable for aerobic condition developed from MAS LAB, UAS, GKVK, Bengaluru. The scheme followed to develop these populations are presented in Figure Evaluation of male sterility introgressed BC 3 F 1 populations and development of BC 4 F 1 populations It includes 15 BC 3 F 1 progeny rows 10 of them derived from IR70369A MAS99 BC 2 F 1 plants and five of them were derived from KCMS31A MAS99 BC 2 F 1 plants. Development of partially converted novel male sterile in rice (Oryza sativa L.) for aerobic condition 25

41 Table 1: Salient features of parents of the backcross populations SL. No. TRAITS MAS99(Recurre nt parent) IR70369A(Donor parent of cross I ) KCMS31A(Donor parent of cross II ) 1) Cultivar type Indica Indica Indica 2) Plant stature Tall Short Short 3) Tillering ability Medium High High 4) Root length Relatively deep rooted Shallow rooted Shallow rooted 5) Pollen fertility Fertile Sterile Sterile 6) Stigma exertion Absent Present Present 7) Panicle exertion Less More More 8) Drought response Moderately tolerant Susceptible Susceptible 9) Spikelet fertility Fertile Sterile Sterile 10) Duration Short Medium Medium Generation and evaluation of new experimental hybrids Individual plants of BC 3 F 1 population were considered as CMS lines, five lines derived from IR70369A MAS99 and four lines derived from KCMS31A MAS99 totally nine lines and eight testers (Table.2) are crossed in line X tester mating design. Clipping method of crossing was followed to produce 72F 1 hybrids. These 72 hybrids developed were evaluated along with three standard checks viz., high yielding medium duration hybrid (KRH-4), long duration and high yielding private hybrid PHB 71 from pioneer international company and MAS99 promising genotype, high yielding, short duration suitable for aerobic condition. 3.2 Experimental design and layout Evaluation of BC 2 F 1 and BC 3 F 1 male sterility introgressed populations formorpho- floral traits For the morpho-floral evaluation of BC 2 F 1 populations, two BC 2 F 1 populations along with the parents were sown on 4 th January 2014 in single block with spacing of 0.3X0.1 M at the experimental plots of Department of Genetics and Plant Breeding, 26 Raghavendra, P

42 Figure 1.Scheme of backcross followed to develop new CMS line from two crosses in rice Development of partially converted novel male sterile in rice (Oryza sativa L.) for aerobic condition 25

43 UAS, GKVK, Bengaluru. The plants of the each population were maintained in 5 rows and parents of 3 rows with 6-7 plants in each row were established. Observations were recorded on individual plants. Plants which were synchronised with recurrent parent MAS 99 were back crossed to develop BC 3 F 1 populations (Plate 1 and 2). For the morpho-floral evaluation of BC 3 F 1 populations, 15 BC 3 F 1 lines along with their parents were sown in progeny rows on Kharif2014.The seedlings were transplanted after 21 days, with a spacing of 25 cm 25 cm in a single row of plants were established. All the recommended package of practices were followed timely to ensure good crop establishment. Observations were recorded on 10 plants from middle of the each line. In IR70369A MAS 99 derived population Plants which were synchronised with recurrent parent MAS 99 were back crossed to develop BC 4 F 1 populations. Whereas in KCMS31A MAS 99 derived population MABS was carried out to select plants which recovered more recurrent parent genome and backcrossed to develop BC 4 F 1 populations (Plate1 and 2). 3.3 Observations Table 2. Observations recorded on individual plants of BC 2 F 1 and BC 3 F 1 populations. Plant characters Flower characters Yield characters Drought characters 1) Plant height 45days(cm) 2) Plant Height at maturity (cm) 3) Total number of tillers. 4) Days to50% flowering. 5) Days to maturity 1) Stigma length.(mm) 2) Pollen sterility (%). 3) Style length (mm). 4) Spikelet fertility. 5) Panicle exertion (%). 6) Stigma exertion (%) 1) Number of panicles plant -1. 2) Panicle length (cm). 3) Number of spikelets/panicle. 1)SPAD reading* *Recorded only in BC 3 F 1 populations 3.3.1Recording of observations Plant height at 45 days (cm): The height of the plant from the base to the tip of the leaf was recorded at 45 th day of crop growth and expressed in centi meter (s). 26 Raghavendra, P

44 Plant height at maturity (cm): The height of the plant from the base to the tip of the main panicle was recorded and expressed in centimeter (s) Pollen fertility (%): Three spikelets, one each from top, middle and bottom of main panicle of two CMS or hybrid plants each from two replications were collected and pollen grains were squeezed out from all the anthers on a clean glass slides and stained with 1.0 per cent Acetocarmine stain and examined under microscope at a magnification of 40X. The pollens were considered to be fertile if they were plumpy, round and deeply stained, while they were considered as sterile if they were shrunken, unstained and irregular in shape. Five microscopic fields were counted for each plant and pollen fertility was expressed in percentage. Pollen fertility (%)= Days to 50 per cent flowering: Number of fertile (stained) pollen grains Total number of pollen grains 100 Number of days required for 50 per cent of panicle emergence from the date of sowing in most of the plants of a line Stigma exertion (%): It is the ratio of spikelets with stigma exerted (on one or both sides of the spikelet) recorded on 3 rd to 5 th day of flower opening to the total number of spikelets from 5 randomly selected panicles and expressed as stigma exertion per cent. Stigma exsertion(%)= Style length (mm): Total Number of spikelets with exserted stigma Total number of spikelets 100 Three spikelets one each from top, middle and bottom of a panicle were considered for measuring the length of style by measuring the distance between the base of the stigma and ovary and expressed in millimetres. The length of style was measured using an ocular micrometer under a microscope at magnification of 10X.

45 Stigma length (mm): It is the distance between the base of the feathery stigma and tip of the stigma which was expressed in millimetres from the same sample collected to measure the style length Number of tillers per plant: It is the total number of tillers in each plant at maturity Number of Panicles per plant: It is the total number of panicles in each plant at maturity Panicle length (cm): The length of the 5 main panicles in each plant was measured from the base to tip and is expressed in centimetres Spikelet fertility (%): Three randomly selected CMS lines were bagged at the time of panicle exertion to prevent seed set due to outcrossing (to ensure self-fertilization) and number of filled and chaffy spikelets were counted at time of harvest, spikelet fertility per cent was computed as follows. Spikelet fertility(%)= Number of filled spikelets Total number of spikelets Panicle exertion (cm): The total length between the flag leaf collar and the base of the panicle was measured to indicate the extent of panicle exertion. Depending on whether, the panicle base was above, below or in line with the flag leaf collar, the exertion was given positive, negative and zero values, respectively Spikelets per panicle: Total number of spikelets per panicle was counted for 5 main panicles for each plant. 28 Raghavendra, P

46 Days to maturity: Total number of days taken by each plant from sowing to physiological maturity of plant was recorded SCMR (SPAD Chlorophyll Meter Reading): The fully expanded leaf from the top was selected and clamped into the SPAD meter (Minolta 680). Observations on the light transmittance in 660 and 730 nm were recorded at least on 5 random positions on a single leaf. Three leaves were selected from different tillers in each plant; the values were averaged and noted down for that individual plant, this observation was recorded only in BC 3 F 1 populations Statistical analysis Descriptive statistics The following descriptive statistics were calculated as per Sundararaj et al. (1972) Mean On the basis of individual plant observations, the population mean for each character was computed as follows. (Σ n i=1x i ) X = n X= population mean X i = individual value n= number of observations The trait means of Backcross populations were compared with parental trait mean values using two sample t-test with unequal variances.

47 A) B) (C1) (C2) (C1) (C2) Plate 1: Field view of BC2F1 (A) and BC3F1 (B) rice plants derived from IR70369A MAS 99(C1) and KCMS31A MAS 99 (C2) crosses. 30 Raghavendra, P

48 1 A) Selection of plants B) Transferring in to pots C) Pollen sterility D) 1/3 rd of spikelet clipping E) Anthesis in pollen chamber F) Pollination G) Bagging of pollinated H) Harvesting of hybrid seeds Plate 2: Schematic representation of crossing program followed to back crosses and generate aerobic rice hybrids

49

50 Range and standardized range Range is the minimum and maximum values of the observations in a sample. Range for each trait was estimated as difference between highest and lowest trait mean value and standardized by dividing it by mean value of the respective trait Variance: Mean of squared deviations of individual values from their mean is called variance. Variance = ( ) Skewness and Kurtosis Skewness, the third degree statistics and kurtosis, the fourth degree statistics were estimated as per Snedecor and Cochran (1994) to understand the nature of distribution of BC 2 F 1 population for growth and related traits, under aerobic. The mean values of quantitative traits of above cross was used to estimate coefficients of skewness and kurtosis using SPSS software program. Kurtosis indicates the relative number of genes controlling the traits (Robson, 1956). Three types of kurtosis are recognized based on the kurtosis value which depends on distribution curve. If kurtosis value = 3 = Normal curve If kurtosis value > 3 = Leaping curve If kurtosis value < 3 = Flat curve = Mesokurtic = Leptokurtic = Platykurtic Similarly, the lack of symmetry i.e., skewness was recognized based on the coefficient of skewness values which range from -3 to +3. The type of distribution based on the skewness values are as follows. If skewness value is zero If skewness value is negative If skewness value is positive = symmetrical distribution = negatively skewed distribution = positively skewed distribution Phenotypic and Genotypic coefficient of variation (PCV and GCV) The phenotypic and genotypic coefficient of variation was computed as per Burton and Dewane (1953) for low moisture stress.

51 PCV (%) = 100 GCV(%) = Where, 100 = Phenotypic standard deviation = Genotypic standard deviation X = Grand mean of character PCV = Phenotypic coefficient of variation GCV = Genotypic coefficient of variation PCV and GCV were classified according to Robinson et al. (1949). 0-10% was considered as low, 10-20% as moderate and 20% and above as high Heritability (%) Broad sense Heritability estimate as per cent mean was calculated using the formula (Hanson et al., 1956). Vg h 2 (%) = x 100 Vp Where, h 2 % = Heritability percentage Vg = Genotypic variance Vp = Phenotypic variance Heritability percentage was categorized as follows (Robinson et al., 1949) 0-30% was considered as low, 30-60% was considered as moderate 60% and above as high Correlation Coefficient The correlation coefficient of two variables, sometimes simply called their correlation, is the covariance of the two variables divided by the product of their individual standard deviations. It is a normalized measurement of how the two variables are linearly related. 26 Raghavendra, P

52 The population correlation coefficient is defined as follows, where and are the population standard deviations, and COV(X,Y) is the population covariance: 3.4 Marker assisted background selection (, )= (, ) = ( μ ) μ Out of two BC 3 F 1 crosses, KCMS31A MAS99 was used for marker assisted background selection study. Marker assisted background selection was performed on fourty-five BC 3 F 1 progenies grown in the test cross nursery to confirm the recurrent parent genome recovery in BC 3 F 1 plants. Procedure followed is given below Collection of leaf sample for DNA extraction Young vigorously growing fresh leaf samples from KCMS31A MAS99 BC 3 F 1 progenies were collected from 25 day old seedlings to extract genomic DNA of forty-five individuals. Initially, healthy portion of the youngest leaves were cut apart with sterilized scissors and washed in distilled water and ethanol (70%) and dried on fresh tissue paper to remove spores of microorganisms and any other source of foreign DNA. The collected leaf samples were then kept in polythene bags, avoiding any damage to the leaf tissues and the bags were placed in an ice box to carry. Finally, the samples were stored in -20 C freezer with marking Genomic DNA extraction The genomic DNA was isolated using leaf sample of thirty days old seedlings. DNA was prepared as per the modified Cetyl trimethyl ammonium bromide (CTAB) method (Cao and Oard, 1997). The step-vise methodology detail is given below. a) Young and healthy leaves (1 g) of 30 days old were collected from plants and brought to laboratory in liquid nitrogen (-196ºC). b) The leaves were cut into pieces and homogenized completely in a mortar and pestle with liquid nitrogen. c) The leaf powder was then transferred to 50 ml Falcon tube containing Four hundred µl of CTAB (0.2M Tris, 2M NaCl, 0.05M EDTA, ph 7.5, 2% C-TAB) buffer was added and tubes were maintained at 65 C for 15 minutes during the incubation period tubes were shaked twice.

53 d) Equal volume of chloroform/isoamylalcohol (24:1) was added and tubes were incubated for 15 minutes at 65 C. e) The tubes were centrifuged for 10 minutes at rpm and supernatant was then transferred to fresh eppendorf tube, to which, absolute ethanol was added and mixture was incubated at room temperature for 20 min for DNA precipitation. f) The tubes were centrifuged for 10 minutes at rpm and supernatant was discarded. g) DNA pellet obtained was washed with 70 per cent ethanol then ethanol was removed and pellet was dried. h) Finally, DNA pellet was dissolved in 200 µl of TE buffer and stored at 20 C until use PCR analysis using rice microsatellite (SSR) markers Polymorphism survey for primer selection to employ in marker assisted background selection, polymorphism survey of parents were carried out using 480 SSR markers distributed equally on 12 linkage groups. Out of these 96 SSR primers showed clear polymorphisms between the parents are used in genotyping for the background selection of the forty-five BC 3 F 1 plants.the detail of the primers used in this study is given in Appendix Reaction mixture The microsatellites reaction mixture consisted of ng of template DNA, 100 p mohls of each of forward and reverse primer (Research Genetics, USA), 100 µm of dntps, 0.2µl of Taq DNA polymerase (Bengaluru Genei, India) and 10x PCR buffer (10 mm Tris ph 8.0, 50 mm KCl, 1.8 mm MgCl2 and 0.01 mg/ml gelatin) in a volume of 10 µl. One drop of mineral oil (Sigma) was dropped on each well of reaction mixture to avoid evaporation Amplification conditions Amplification was carried out on an Eppendorf Thermal cycler. The amplification profile was as follows: 28 Raghavendra, P

54 Initial Denaturation temperature: 94 C - 5 min Denaturation : 94 C - 1 min Primer annealing : 56 C - 1 min Primer extension : 72 C - 2 min Latter three stages were repeated 35 times Complete primer extension: 72 C - 5 min Holding/Soak temperature: 4 C - Until removed Selection strategy for marker assisted selection (MAS) The uses of DNA markers in backcrossing greatly increase the efficiency of selection. Markers can be used in combination with or to replace phenotypic screening for the target background. This is referred to as background selection (Hospital and Charcosset, 1997, Tanksleyet al., 1989). This may be particularly useful for target background that has laborious or time-consuming phenotypic screening procedures. It can also be used to select for reproductive-stage traits in the seedling stage, allowing the best plants to be identified for backcrossing. Furthermore, recessive alleles can be selected, which is difficult to do using conventional methods. The resultant 96 polymorphic markers between parents KCMS31A and MAS 99 were employed for Marker Assisted Background Selection on 45 BC 3 F 1 genotypes. Scoring of BC 3 F 1 genotypes were done based on recurrent and donor parent banding pattern, if the bands are like donor parent (KCMS31A) then individuals were scored as A similarly if the bands were like recurrent parent (MAS99) then it was scored as B. Since in diploids 2 alleles will be there we considered number of allele as twice the number of markers used therefore for the present study total number of alleles became 192. Similarly twice the number of A and B alleles were considered for calculation of recurrent parent genome recovery symbolically given below. Recurrent parent genome recovery (%) = ( ) ( & ) 100 The resultant genotypic data was subjected to graphical genotypic analysis.

55 3.5 Validation of SSR markers linked to fertility restoration (Rf) locus on tester genotypes Plant material All the eight male parents (testers) of newly produced F 1 hybrids were used for validation of SSR markers with KMR 3R and IR58025B as standard checks for restorer and maintainers restorer allele, respectively Methods DNA Extraction: Procedure followed to extract DNA and its quantification is as mentioned in marker assisted background selection (MABS), (3.4.2) & (3.4.3) Microsatellite marker analysis: Reported linked, high LOD score markers were used for genotyping of male testers with checks. List of SSR markers used in the study with their features were presented in table 3. Reaction mixture ( ), Amplification conditions ( ), Gel electrophoresis ( ) Scoring of Bands: The bands generated by microsatellite primers were given as score M for maintainer type allele of IR B and Score R for KMR 3 type alleles. IR 58025B and KMR 3 were used as standard for marker validation. 3.6 Evaluation of new experimental hybrids for identification of maintainers and restorer genotypes. In this experiment seeds of all the 72 Aerobic rice hybrids along with their parents and three standard checks were sown in summer The seedlings were transplanted at 23 days after sowing with a spacing of 25cm x 15cm in two rows with single seedling per hill in a Randomized complete Block Design (RCBD) with two replications (Plate 3). All the recommended package of practices were followed timely to ensure good crop establishment. List of CMS lines, testers and checks used in the development of rice hybrids and list of hybrids developed involving nine CMS lines and eight testers in Line x Tester mating design and are given in Table 4 & 5 respectively. 30 Raghavendra, P

56 Development of partially converted novel male sterile in rice (Oryza sativa L.) for aerobic condition 31 Table 3: List of SSR markers used for validation of fertility restoration (Rf) locus in rice testers SI. No. Marker Name Allele Chrom. No. F: Forward primer R: Reverse primer Genetic distance 1 RM490 Rf cM 2 RM443 Rf cm 3 RM1 Rf cm 4 RM3866 Rf cm 5 RM6344 Rf cM 6 RM470 Rf cm 7 RM22242 Rf cm 8 RM3702 Rf cm 9 Sequences (5 3 ) F: ATCTGCACACTGCAAACACC R: AGCAAGCAGTGCTTTCAGAG F: GATGGTTTTCATCGGCTACG R: AGTCCCAGAATGTCGTTTCG F: GCGAAAACACAATGCAAAAA R: GCGTTGGTTGGACCTGAC F: AGTTGGTCATCTACCAGAGC R: GATCTTCTTGCCTCAGAAAG F:ACACGCCATGGATGATGAC R:TGGCATCATCACTTCCTCAC F: GATTGAGGAGACGAGCCATC R: CTTTTTCAGATCTGCGCTCC F:TGTTCCACATGTTGTACTCCATCC R: ACGTTCAGTACAGTCGCCAACG F: TCTGAAATAGAAGCTCAGCA R: GAAAGTTATTGCACTCTCCA RM6100 Rf cM F: TCCTCTACCAGTACCGCACC R: GCTGGATCACAGATCATTGC 10 RM6737 Rf cm F: CACGTAAATGATAGGCACCATTGC R: CACAAGGTGGTGTGGGCTAGACG Reference Sheeba et al. (2009) Bazrkar et al. (2008) Ahmadikhah et al. (2007) Sota Fujii et al. (2005) Bazrkar et al. (2008) Wenchao Huang. Et al. (2012) Wenchao Huang. Et al. (2012) Wenchao Huang. Et al. (2012) Sheeba et al. (2009), Ahmadikhah & Karlov (2006)

57 32 Raghavendra, P Table 3 contd.., SI. No Marker Name Allele Chrom. No. Genetic Distance Sequences (5' - 3') RM258 Rf cM F: TGCTGTATGTAGCTCGCACC R: TGGCCTTTAAAGCTGTCGC RM171 Rf cM F: AACGCGAGGACACGTACTTAC R: ACGAGATACGTACGCCTTTG RM1108 Rf cM F: GCTCGCGAATCAATCCAC R: CTGGATCCTGGACAGACGAG RM 244 Rf cM F:CCGACTGTTCGTCCTTATCA 15 RM7466 Rf cm 16 RM7003 Rf cM F: Forward primer R: Reverse primer R:CTGCTCTCGGGTGAACGT F: CGGTCTGCCTAGCTTGTCTC R: ACCGAACACGGAAAAGCC F:GGCAGACATACAGCTTATAGGC R:TGCAAATGAACCCCTCTAGC Reference Majid Sattari. et al. ( 2008), Bazrkar et al. (2008) Sheeba et al. (2009), Majid Sattari. et al. ( 2008) Sheeba et al. (2009) Sheeba et al. (2009) Majid Sattari. et al. ( 2008) Bazrkar et al. (2008)

58 3.6.1 Observations recorded: Pollen fertility ( ) and spikelet fertility ( ) was tested as per standard procedure as done in backcross populations. The genotypes were grouped into four different classes based on pollen fertility per cent of the corresponding hybrids. SI. No. Class Pollen fertility (%) 1 Maintainer (M) : % 2 Partial maintainer ( PM) : % 3 Partial restorer (PR) : % 4 Restorer (R) : % The genotypes were grouped into four different classes based on spikelet fertility per cent of the corresponding hybrids. The range of fertility per cent of different groups is given below. SI. No. Class Spikelet fertility (%) 1 Maintainer (M) : % 2 Partial maintainer ( PM) : % 3 Partial restorer (PR) : % 4 Restorer (R) : % Development of partially converted novel male sterile in rice (Oryza sativa L.) for aerobic condition 33

59 Table 4: List of CMS lines, testers and checks used in the development of rice hybrids Sl.No. Genotype Salient features Source CMS lines 1 BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F Individual plants of BC 3 F 1 male sterile Population derived from IR70369AxMAS99 Individual plants of BC 3 F 1 male sterile Population derived from KCMS31AxMAS99 MAS LAB, GKVK, UAS, Bengaluru Testers SL.NO. Genotype Salient features Source 1 P Pyramided genotype for rice thungro, WUE, Bacterial blight resistance/tolerant. 2 P Pyramided genotype for rice thungro, WUE, Blast, Bacterial 3 P blight resistance/tolerant. 4 P Pyramided genotype for Bacterial blight resistance/tolerant. 5 RASI Released variety 6 POUSTIC-9/ HPR HPR-565 High protein rice genotypes 8 HPR-2278 Checks MAS LAB, GKVK, UAS, Bengaluru SL.NO. Genotype Salient features Source 1 KRH-4 Released hybrid of UAS ZARS,VC FARM, Bengaluru Mandya 2 PHB-71 Released hybrid from pioneer Pioneer hybrid international 3 MAS99 Short duration, drought tolerant Promising genotype suitable for aerobic condition MASLAB,GKVK, UAS, Bengaluru 34 Raghavendra, P

60 R1 R2 Plate 3: Field view of rice hybrids evaluated during summer 2015 Development of partially converted novel male sterile in rice (Oryza sativa L.) for aerobic condition 35

61 Table 5: List of hybrids developed involving nine CMS lines and eight testers in line x tester mating design F 1 Cross combination SL. No. F 1 Cross combination SL. No. F 1 Cross combination 1 BC 3 F P BC 3 F P BC 3 F P BC 3 F P BC 3 F P BC 3 F P BC 3 F P BC 3 F P BC 3 F RASI 4 BC 3 F P BC 3 F RASI 54 BC 3 F POUSTIC-9 5 BC 3 F RASI 30 BC 3 F POUSTI-9 55 BC 3 F HPR565 6 BC 3 F POUSTIC-9 31 BC 3 F HPR BC 3 F HPR BC 3 F HPR BC 3 F HPR BC 3 F P BC 3 F HPR BC 3 F P BC 3 F P BC 3 F P BC 3 F P BC 3 F P BC 3 F P BC 3 F P BC 3 F P BC 3 F P BC 3 F P BC 3 F RASI 12 BC 3 F P BC 3 F RASI 62 BC 3 F POUSTIC-9 13 BC 3 F RASI 38 BC 3 F POUSTIC-9 63 BC 3 F HPR BC 3 F POUSTIC-9 39 BC 3 F HPR BC 3 F HPR BC 3 F HPR BC 3 F P BC 3 F P BC 3 F HPR BC 3 F P BC 3 F P BC 3 F P BC 3 F P BC 3 F P BC 3 F P BC 3 F P BC 3 F P BC 3 F P BC 3 F P BC 3 F RASI 20 BC 3 F P BC 3 F RASI 70 BC 3 F POUSTIC-9 21 BC 3 F RASI 46 BC 3 F POUSTIC-9 71 BC 3 F HPR BC 3 F POUSTIC-9 47 BC 3 F HPR BC 3 F HPR BC 3 F HPR BC 3 F P check 1 PHB BC 3 F HPR BC 3 F P check 2 KRH-4 25 BC 3 F P BC 3 F P check 3 MAS99 36 Raghavendra, P

62 IV. RESULTS The results obtained in the present study are presented under the following headings. 1. Mean performance of BC 2 F 1 and BC 3 F 1 populations in comparison with recurrent parent, MAS Variability studies in BC 2 F 1 and BC 3 F 1 generations derived from IR70369A MAS99 and KCMS31A MAS99 crosses. 3. Third and fourth degree statistics in BC 2 F 1 and BC 3 F 1 back cross populations. 4. Phenotypic foreground selection inbackcross populations. 5. Superior CMS plants identified in back cross populations. 6. Trait inter-relationship in BC 3 F 1 populations for style length, stigma length and stigma exertion. 7. Marker Assisted Background selection (MABS) using rice SSR markers in BC 3 F 1 generation derived from KCMS31A MAS99 cross. 8. Validation of SSR markers linked to fertility Restoration (Rf) locus. 9. Identification of restorers and maintainers for new BC 3 F 1 CMS lines. 1. Mean performance of BC 2 F 1 and BC 3 F 1 populations in comparison with recurrent parent MAS99. 1a. In IR70369A MAS 99 cross derived BC 2 F 1 and BC 3 F 1 populations. In BC 2 F 1 population mean values of traits such as plant height at 45 days (35.40), total tillers (21.42),panicles plant -1 (19.14),plant height at maturity(71.30 cm) and spikelet panicle -1 (125.80),were found comparable with recurrent parent MAS99 mean values and remaining traits such as days to fifty percent flowering(93.05 days),style length(0.95mm), stigma length(1.10mm), stigma exertion(30.65%),daysto maturity( days), panicle length(16.95cm) and panicle exertion (6.80cm) were significantly different from recurrent parent MAS99 mean values(table 6). In BC 3 F 1 population mean values of traits such as plant height at 45 days(37.53cm), days to fifty percent flowering (94.78 days),spad reading (34.65), total tillers (22.01), panicles plant -1 (19.33), plant height at maturity(73.68 cm), panicle length(17.73 cm),spikelet panicle -1 (130.20) were comparable with recurrent parent mean values whereas for style length (0.93mm), stigma length (1.07 mm),stigma exertion (30.19 %), days to maturity ( days ),panicle exertion(-6.22cm),were significantly different from recurrent parent (Table 6). Development of partially converted novel male sterile in rice (Oryza sativa L.) for aerobic condition 42

63 43 Raghavendra, P Table 6. Comparison of Parental trait means with BC 2 F 1 and BC 3 F 1 populations derived from IR70369A MAS99 in rice SL. No. Traits IR70369A MAS99 (RP) BC 2 F 1 RP- BC 2 F 1 P(T<=t) two-tail BC 3 F 1 P 0.05=Significant at 5% level of significance P 0.01=Significant at 1% level of significance RP- BC 3 F 1 P(T<=t) two-tail 1) Plant height at 45 days(cm) ) Days to 50% flowering ) Style length (mm) ) Stigma length (mm) ) Stigma exertion (%) ) SPAD reading ) Days to maturity ) Total tillers ) Panicles plant ) Plant height at maturity (cm) ) Panicle length (cm) ) Panicle exertion (cm) ) Spikelet panicle

64 1b. In KCMS31A MAS 99 cross derived BC 2 F 1 and BC 3 F 1 population In BC 2 F 1 population trait means of plant height at 45 days (35.34 cm), days to fifty percent flowering (96.53days), stigma length (1.12mm), panicles plant -1 (18.71), spikelets panicle -1 (127.83) were comparable with recurrent parent mean values whereas for style length (0.95), stigma exertion (21.16%), days to maturity ( days), total tillers (20.59), plant height at maturity(70.80cm), panicle length (17.11cm ), and panicle exertion (-6.95cm) were differing significantly from recurrent parent trait means (Table 7). In BC 3 F 1 population trait means of total tillers (22.06), SPAD reading (33.23), panicles plant -1 (20.20), panicle length (17.66 cm), plant height at maturity (72.52 cm) and spikelet panicle -1 (130.28), were statistically comparable with recurrent parent, whereas traits means of plant height at 45 days (36.46 cm), days to fifty percent flowering (96.90 days), style length (0.93 mm), stigma length (1.06 mm), stigma exertion rate (24.78%), days to maturity ( days) and panicle exertion (-6.32cm ) differing significantly from recurrent parent (Table 7) Variability studies in BC 2 F 1 and BC 3 F 1 populations derived from IR70369A MAS 99 and KCMS31A MAS Standardised range: 4.2.1a Standardized range in back cross populations derived from IR70369A MAS99 cross. In BC 2 F 1 population standardised range was found highest for panicles plant -1 (0.73), followed by total tillers (0.70), panicle exertion (-0.67), spikelet panicle -1 (0.3), stigma exertion rate (0.48), plant height at maturity (0.25), days to fifty percent flowering (0.12) and lowest was found in days to maturity (0.11). (Table 8). In BC 3 F 1 generation derived from IR70369A MAS99 standardised range was found highest for panicles plant -1 (1.05), followed by stigma exertion (0.83), panicle exertion (0.82), total tillers (0.73), style length (0.60), SPAD (0.83), panicle length (0.58), stigma length (0.46), plant height at 45 days (0.35), plant height at maturity (0.33) with lowest for days to 50% flowering and days to maturity (0.90).(Table 8). In both generations highest standardised range was found for panicles plant -1 and lowest for days to 50% flowering and days to maturity (Table 8) b: Standardised range of backcross populations derived from KCMS31A MAS99 crosses. In BC 2 F 1 generation the value of standardised range was found highest for stigma exertion (0.84), followed by total tillers (0.64), panicle exertion (-0.64), panicles plant -1 (0.60), stigma length (0.46), style length (0.48), panicle length (0.41), spikelet panicle- 1(0.38), plant height at maturity (0.25), lowest standardised range was noticed for days to 50% flowering (0.11) and days to maturity (0.10). (Table 8). Development of partially converted novel male sterile in rice (Oryza sativa L.) for aerobic condition 44

65 45 Raghavendra, P Table 7. Comparison of Parental trait means with BC 2 F 1 and BC 3 F 1 populations derived from KCMS31A MAS99 crosses in rice SL.N O. Traits KCMS31A MAS99 (RP) BC 2 F 1 RP- BC 2 F 1 P(T<=t) two-tail BC 3 F 1 P 0.05=Significant at 5% level of significance P 0.01=Significant at 1% level of significance RP- BC 3 F 1 P(T<=t) two-tail 1) Plant height at 45 days (cm) ) Days to 50% flowering ) Style length (mm) ) Stigma length (mm) ) Stigma exertion (%) ) SPAD reading ) Days to maturity ) Total tillers ) Panicles plant ) Plant height at maturity (cm) ) Panicle length (cm) ) Panicle exertion (cm) ) Spikelet panicle

66 Development of partially converted novel male sterile in rice (Oryza sativa L.) for aerobic condition 46 Table 8. Estimates of quantitative trait range and standardized range of BC 2 F 1 and BC 3 F 1 populations derived from IR70369A MAS99 and KCMS31A MAS99 in rice SL. NO. Traits IR70369A MAS99 KCMS31A MAS99 Range Standardized Range range Min Max Min Max Standardized range BC 2 F 1 BC 3 F 1 BC 2 F 1 BC 3 F 1 BC 2 F 1 BC 3 F 1 BC 2 F 1 BC 3 F 1 BC 2 F 1 BC 3 F 1 BC 2 F 1 BC 3 F 1 1) Plant height at 45 days (cm) ) Days to 50% flowering ) Style length (mm) ) Stigma length (mm) ) Stigma exertion (%) ) SPAD chlorophyll meter reading ) Days to maturity ) Total tillers ) Panicles plant ) Plant height at maturity (cm) ) Panicle length (cm) ) Panicle exertion (cm) ) Spikelet panicle

67 In BC 3 F 1 generation the values of standardised range was found highest for panicles plant -1 (0.79) followed by total tillers (0.77), stigma exertion (0.61), panicle length(0.59), style length(0.45), SPAD(0.44), Panicle exertion (-0.42), plant height at 45 days (0.41), stigma length (0.39), spikelet panicle-1 (0.35) plant height at maturity (0.21), and lowest standardised range was noticed in days to maturity (0.08) and days to 50% flowering (0.06).( Table 8). In KCMS31AxMAS99 cross traits like panicles plant -1, total tillers and stigma exertion were recorded highest standardised range and lowest for days to 50% flowering and days to maturity in both generations (Table 8) Phenotypic Co-efficient of Variation (%) 4.2.2a.Phenotypic coefficient of variation in BC 2 F 1 and BC 3 F 1 population derived from IR70369A MAS99 cross. In BC 2 F 1 generation PCV was found highest for stigma exertion (22.02) where as moderate for total tillers (19.39), panicles plant -1 (18.54), panicle exertion (15.14), spikelet per panicle (12.85), style length (11.04) and low for panicle length (9.40), stigma length (9.96), plant height at maturity (9.18), plant height at 45 days (8.44), days to fifty percent flowering (3.5) and days to maturity (3.10).(Table 9). In BC 3 F 1 generation PCV was found moderate for stigma exertion (15.78), panicles plant - 1 (16.99), total tillers (15.65), panicle exertion (13.80), style length (11.72),panicle length(10.76), spikelet per panicle(10.35) where as PCV waslowfor Stigma length(9.74), SPAD (9.26), plant height at 45 days (8.19), plant height at maturity(5.79), days to maturity(2.24) and days to 50% flowering(1.92).(table 9). In both generations highest PCV was recorded for total tillers and stigma exertion and panicles plant -1 and lowest PCV was found for days to 50% flowering and days to maturity. PCV of all most all the traits in BC 3 F 1 was less as compared to BC 2 F 1 generation b Phenotypic coefficient of variation in BC 2 F 1 and BC 3 F 1 population derived from KCMS31A MAS99 cross. In BC 2 F 1 generation stigma exertion (25.07) and total tillers (21.11) has high PCV where as panicle exertion (14.30), stigma length (11.85), style length(11.55), panicles plant -1 (18.92), panicle length(10.24) and spikelet per panicle length(10.23) has moderate PCV and low PCV was recorded for plant height at 45 days (3.45),days to 50% flowering (3.46),days to maturity(3.33) and plant height at maturity(6.45).(table 9). In BC 3 F 1 generation PCV was moderate for total tillers (19.09), panicles plant - 1 (18.95), stigma exertion (13.69), panicle length (12.11) and style length(10.18), where as PCV was low for stigma length(9.82), panicle exertion(9.51), SPAD(9.49), plant height at 45 days (8.13), spikelet per panicle (7.52), plant height at maturity (4.25), days to maturity (1.92) and days to 50% flowering (1.74). (Table 9). 47 Raghavendra, P

68 In both generations PCV was highest for stigma exertion, total tillers and panicles plant -1 whereas PCV was lowest for days to fifty percent flowering and days to maturity. The value of PCV was less in BC 3 F 1 as compared to BC 2 F 1 for most of the traits (Table 9) Genotypic Co-efficient of Variation (%) 4.2.3aGenotypic co-effient of variation in BC 2 F 1 andbc 3 F 1 back cross populations derived from IR70369A MAS99 cross. The GCV in BC 2 F 1 generation was found moderate for panicles plant -1 (16.76), total tillers(16.34), stigma exertion (12.85), style length(10.83), spikelet per panicle(10.08), and stigma length(9.67) where as low GCV was foundfor plant height at maturity (8.74),panicleexertion(8.66), plant height at 45 days (8.25), daysto fifty percent flowering (3.40) and days to maturity(2.97), (table 9). The GCV in BC 3 F 1 generation was found moderate for panicles plant -1 (14.59), total tillers (12.99) and style length (11.51), where as GCV was low for stigma length (9.43), panicle length (8.64), SPAD (7.99), panicle exertion (7.65), plant height at 45 days (7.54), spikelet per panicle (7.25), stigma exertion (7.38), plant height at maturity (5.46), Days to maturity (2.20) and days ton 50% flowering (1.43) (Table 9). In both generation GCV was found highest for stigma exertion, total tillers, panicles plant -1 and lowest for days to 50% flowering and days to maturity. The GCV values were decreased in BC 3 F 1 as compared to BC 2 F 1 (Table 9) b Genotypic co-effient of variation in BC 2 F 1 and BC 3 F 1 backcross population derived from KCMS31A MAS99 cross. In BC 2 F 1 generation GCV was found moderate for panicles plant -1 (16.57),total tillers (9.13),whereas low for panicle length (7.48), spikelet panicle -1 (6.60), plant height at maturity (5.75), plant height at 45 days (3.34), days to fifty percent flowering (3.34) and days to maturity(3.39).(table 9). In BC 3 F 1 generation GCV of panicles plant -1 (17.78), total tillers (16.36), stigma exertion (10.17), style length (9.94), stigma length (9.70), and panicle length (10.08) was found moderate, where as for plant height at 45 days (7.68), SPAD (8.59), panicle exertion (5.66), spikelet per panicle (5.10), plant height at maturity (3.7), days to maturity (1.88) and days to 50% flowering (1.47).(Table 9). The GCV of panicles plant -1, total tillers and stigma exertion rate was found highest and days to 50% flowering and days to maturity were lowest in both generation. 9) The GCV for most of the traits were less in BC 3 F 1 as compared to BC 2 F 1 (Table Development of partially converted novel male sterile in rice (Oryza sativa L.) for aerobic condition 48

69 49 Raghavendra, P Table 9. Estimates of quantitative trait PCV, GCV and heritability ofbc 2 F 1 and BC 3 F 1 populations derived from IR70369A MAS99 and KCMS31A MAS99 in rice SL. NO Traits Phenotypic coefficient of variation Genotypic coefficient of variation Broad sense heritability IR70369A MAS99 KCMS31A MAS99 IR70369A MAS99 KCMS31A MAS99 IR70369A MAS99 KCMS31A MAS99 BC 2 F 1 BC 3 F 1 BC 2 F 1 BC 3 F 1 BC 2 F 1 BC 3 F 1 BC 2 F 1 BC 3 F 1 BC 2 F 1 BC 3 F 1 BC 2 F 1 BC 3 F 1 1) Plant height at 45 days (cm) ) Days to 50% flowering ) Style length (mm), ) Stigma length (mm), ) Stigma exertion (%) ) SPAD chlorophyll meter reading ) Days to maturity ) Total tillers ) Panicles plant ) Plant height at maturity (cm) ) Panicle length (cm) ) Panicle exertion (cm) ) Spikelet panicle

70 4.2.4 Broad sense heritability (%) 4.2.4a. Broad sense heritability in BC 2 F 1 and BC 3 F 1 derived from IR70369A MAS99 cross. In BC 2 F 1 generation heritability for plant height at 45 days (95.53),daysto 50% flowering (94.33), style length(96.16),stigma length(94.33),days to maturity(91.89), totaltillers(71.01), panicles plant -1 (81.73), plant heightat maturity(90.69) and spikelet per panicle was found high where as for panicle length (48.90), panicle exertion(32.78) and stigma exertion (31.94) heritability was moderate. In BC 3 F 1 heritability was found high for plant height at 45 days (84.15), days to 50% flowering (64.89), style length(96.48), stigma length(93.81), SPAD(74.56),days to maturity (96.37) and moderatefor panicle exertion (30.72), spikelet per panicle (49.07) where as low for stigma exertion (21.88). The heritability was highest for style length and stigma length, lowest for stigma exertion rate and panicle exertionin both generations a. Broad sense heritability in BC 2 F 1 and BC 3 F 1 derived from KCMS31A MAS99 cross. The heritability in BC 2 F 1 was high for plant height at 45 days (94.05),days to 50% flowering(93.70), style length(96.48), stigma length(98.40), days to maturity(97.40), totaltillers (83.37), panicles plant -1 (76.74), plant height at maturity(79.73) andpanicle length(53.41) whereas moderate for stigmaexertion (35.25),panicleexertion (35.36) and spikelet per panicle(41.74).(table 9). The heritability in BC 2 F 1 was high for plant height at 45 days (89.18),days to 50% flowering(71.70), style length(95.31), stigmalength(97.33), SPAD (81.85), days to maturity(96.12), totaltillers (73.49), panicles plant -1 (88.06), plant height at maturity(75.80) andpanicle length(69.35) whereas moderate for stigmaexertion (55.24),panicleexertion (35.36) andspikelet per panicle(46.04).(table 9). In both generations heritability wasfoundhighest for style length and stigma length and lowest for stigma exertion and panicle exertion.(table 9) Third and fourth degree statistics in BC 2 F 1 and BC 3 F 1 back cross populations 4.3.1a Skewness in BC 2 F 1 and BC 3 F 1 population derived from IR70369A MAS99 cross The frequency distribution of BC 2 F 1 plants was negatively skewed for plant height at 45 days (-0.59), days to 50% flowering (-0.13), stigma length (-1.02), stigma exertion (-0.2), days to maturity (-0.59), total tillers (-0.43), panicles plant -1 (-0.39), Development of partially converted novel male sterile in rice (Oryza sativa L.) for aerobic condition 50

71 plantheight at maturity (-0.5), panicle length (-0.38) and spikelet panicle-1(-0.6). Whereas positively skewed for style length(0.66),panicle exertion (0.66). (Table 10; Fig.2, 3, and 4). The frequency distribution of BC 2 F 1 plants was skewed towards recurrent parent MAS99 for traits such as days to 50% flowering, total tillers, plant height at maturity. (Table10; Fig 2 and 3). In BC 3 F 1 the frequency distribution of population was negatively skewed for traits such as days to 50% flowering (-0.41), stigma exertion (-0.56), days to maturity (-0.39), panicles plant -1 (-0.31), plant height at maturity (-0.56), spikelet per panicle (-0.27) where as positively skewed for style length (0.36), stigma exertion (0.15), SPAD (0.86), total tillers (0.15) and panicle length (0.97), whereas distribution was near normal for plant height at 45 days (0.01) and panicle exertion (-0.05). (Table 10; Fig 2, 3 and 4). The frequency distribution was skewed towards recurrent parent for days to 50% flowering, plant height at maturity, productive tillers, panicle exertion (Table 10, Fig 2, 3, 4). In both generations frequency distribution was skewed towards recurrent parent for days to 50% flowering, plant height at maturity, panicles plant -1, panicle exertion (table 8,fig 3,4,5). In BC 3 F 1 frequency distribution was more skewed towards recurrent parent for plant height at maturity, days to 50% flowering, productive tillers than in BC 2 F 1 population b Skewness in BC 2 F 1 and BC 3 F 1 population derived from KCMS31A MAS99 The frequency distribution of BC 2 F 1 plants was negatively skewed for plant height at 45 days (-0.33), days to 50% flowering (-0.16), style length (-0.66), stigma length (- 0.83), stigma exertion (-1.22), total tillers (-0.1), panicles plant -1 (-0.17), plant height at maturity (-0.39), panicle length (-0.9) and spikelet panicle-1(-0.67), whereas normally distributed for days to maturity (-0.03) and panicle exertion (-0.06), ( Table 10;Fig.6,7,8 and 9). The frequency distribution of BC 2 F 1 plants was skewed towards recurrent parent MAS99 for traits such as days to 50% flowering, total tillers, plant height at maturity. In BC 3 F 1 the frequency distribution of plants were negatively skewed for plant height at 45 days (-0.47), total tillers (-0.77), days to 50% flowering (-0.13), stigma length (-0.25), stigma exertion rate (-0.48), days to maturity (-0.86), plant height at maturity (-0.401), panicle length ( ), spikelet per panicle (-0.29) whereas positively skewed for style length (0.48), SPAD (0.91), total tillers (0.39), panicles plant -1 (0.44). The distribution was skewed towards recurrent parent (MAS99) for traits such as days to 50% flowering, total tillers, plant height at maturity. (Table 10; Fig.6, 7, 8 and 9). 51 Raghavendra, P

72 Table.10: Estimates of quantitave trait Skewness and Kurtosis of BC 2 F 1 and BC 3 F 1 populations derived from IR70369A MAS99 and KCMS31A MAS99 in rice SL.N O Traits IR70369A MAS99 Skewness KCMS31A MAS99 IR70369A MAS99 Kurtosis KCMS31A MAS99 BC 2 F 1 BC 3 F 1 BC 2 F 1 BC 3 F 1 BC 2 F 1 BC 3 F 1 BC 2 F 1 BC 3 F 1 1) Plant height at 45 days (cm) ) Days to 50% flowering ) Style length (mm) ) Stigma length (mm) ) Stigma exertion (%) ) SPAD chlorophyll meter reading ) Days to maturity ) Total tillers ) Panicles plant ) Plant height at maturity (cm) ) Panicle length (cm) ) Panicle exertion (cm) ) Spikelet panicle

73 4.3.2 Kurtosis The frequency distribution of BC 2 F 1 and BC 3 F 1 generation plants in both populations was platykurtic for all the traits (Table 10; Fig 2-9). 4. Phenotypic foreground selection in backcross populations. In IR70369A MAS 99 derived population 91.55% plants were completely male sterile in BC 2 F 1 generation where as 97% of the plants in BC 3 F 1 generation were completely male sterile. (Table 11). In KCMS31A MAS 99 derived populations 88% of the plants were completely male sterile in BC 2 F 1 where as 90% of the plants were completely male sterile in BC 3 F 1 generation. (Table 11). The frequency of male sterile plants were more in IR70369A MAS99 than in KCMS31A MAS99 in both generations (Table 11; Fig.10 and 11). 5. Superior CMS plants identified in back cross populations. 5.1 In BC 2 F 1 generation In IR70369A MAS99 derived population, some of the plants coded as A2, A13, A14, A33, A34 were found superior and are comparable to Check CMS lines for floral traits like stigma exertion and panicle exertion besides the 100% pollen and spikelet sterility. (Table 12). In KCMS31A MAS99 derived population some of the CMS plants coded as B18, B16, B21, B24, B29, were found superior and they were comparable to check for floral traits besides 100% pollen and spikelet sterility. (Table 12). 5.2 In BC 3 F 1 generation In IR70369A MAS99 derived population the best CMS plants observed were A04, A35, A47, A65, A84 the floral traits such as stigma exertion and panicle exertion rate of these plants were comparable to checks IR70369A and KCMS31A, and they were completely male sterile. (Table 12). Five superior plants in KCMS31A MAS99 were B06, B27, B30, B34, B44 the floral traits of this plants such as stigma exertion and panicle exertion were comparable to checks besides 100% pollen and spikelet sterility. (Table 12). Among two populations IR70369A MAS99 derived population was superior for days to 50% flowering and stigma exertion rate.

74 BC 2 F 1 BC 3 F 1 Skewness: Skewness:-0.01 Plant height at 45 days (cm) Plant height at 45 days (cm) Skewness: Skewness:-0.41 Days to 50% flowering Skewness:-0.66 Days to 50% flowering Skewness:-0.36 Style length (mm) Recurrent parent (MAS99) Style length (mm) Donor parent (IR70369A) Figure.2 Distribution pattern of Plant height at 45 days, days to 50% flowering and style length in BC 2 F 1 and BC 3 F 1 populations derived from IR70369A MAS9

75 BC 2 F 1 BC 3 F 1 Skewness: Skewness: Stigma length (mm) Skewness: -0.2 Skewness: 0.15 Stigma length (mm) Stigma exertion (%) Stigma exertion (%) Skewness: Skewness: Days to maturity Recurrent parent (MAS99) Days to maturity Donor parent (IR70369A) Figure.3 Distribution pattern of stigma length, stigma exertion and days to maturity in BC 2 F 1 and BC 3 F 1 populations derived from IR70369A MAS9

76 BC 2 F 1 BC 3 F 1 Skewness: Skewness: 0.15 Total tillers per plant Total tillers per plant Skewness: Skewness:-0.31 Panicles plant -1 Panicles plant -1 Skewness: Skewness: Plant height at maturity (cm) Recurrent parent (MAS99) Plant height at maturity (cm) Donor parent (IR70369A) Figure.4: Distribution pattern of Total tillers, panicles plant -1 and plan height at maturity in BC 2 F 1 and BC 3 F 1 populations derived from IR70369A MAS99

77 BC 2 F 1 BC 3 F 1 Skewness: Skewness: 0.97 Panicle length (cm) Skewness: 0.66 Panicle length (cm) Skewness: Panicle exertion (cm) Panicle exertion (cm) Skewness: -0.6 Skewness: Spikelets panicle -1 Recurrent parent (MAS99) Spikelets panicle -1 Donor parent (IR70369A) Figure.5: Distribution pattern of panicle length, panicle exertion and Spikelets panicle -1 in BC 2 F 1 and BC 3 F 1 populations derived from IR70369A MAS99.

78 BC 2 F 1 BC 3 F 1 Skewness: Skewness: Plant height at 45 days (cm) Plant height at 45 days (cm) Skewness: Skewness: Days to 50% flowering Days to 50% flowering Skewness: Skewness: 0.48 Style length (mm) Recurrent parent (MAS99) Style length (mm) Donor parent (KCMS31A) Figure.6 Distribution pattern of Plant height at 45 days, days to 50% flowering and style length in BC 2 F 1 and BC 3 F 1 populations derived from KCMS31A MAS99.

79 BC 2 F 1 BC 3 F 1 Skewness: Skewness: Stigma length (mm) Stigma length (mm) Skewness: Skewness: Stigma exertion (%) Skewness: 0.03 Skewness: Stigma exertion (%) Days to maturity Recurrent parent (MAS99) Days to maturity Donor parent (KCMS31A) Figure.7: Distribution pattern of stigma length, stigma exertion and days to maturity in BC 2 F 1 and BC 3 F 1 populations derived from KCMS31A MAS99.

80 BC 2 F 1 BC 3 F 1 Skewness: Skewness: 0.39 Total tillers plant -1 Total tillers plant -1 Skewness: Skewness: Skewness: Panicles plant -1 Panicles plant -1 Skewness: Skewness: Plant height at maturity (cm) Recurrent parent (MAS99) Plant height at maturity (cm) Donor parent (KCMS31A) Figure.8 Distribution pattern of Total tillers, panicles palnt -1 and plan height at maturity in BC 2 F 1 and BC 3 F 1 populations derived from KCMS31A MAS99.

81 BC 2 F 1 BC 3 F 1 Skewness: Skewness: Skewness: Panicle length (cm) Panicle length (cm) Skewness: Skewness: Panicle exertion (cm) Skewness: Panicle exertion (cm) Spikelets panicle -1 Recurrent parent (MAS99) Spikelets panicle -1 Donor parent (KCMS31A) Figure.9 Distribution pattern of panicle length,panicle exertion and Spikelets panicle -1 in BC 2 F 1 and BC 3 F 1 populations derived from KCMS31A MAS99.

82 Table 11. Details of phenotypic foreground selection in BC 2 F 1 and BC 3 F 1 populations derived from IR70369A MAS99and KCMS31A MAS99 crosses in rice Population Total number of plants Complete male sterile plants based on pollen fertility Complete male sterile plants based on spikelet fertility Per cent male sterile plants BC 2 F 1 1.IR70369A MAS KCMS31A MAS BC 3 F 1 1.IR70369A MAS KCMS31A MAS

83 Table 12. Superior CMS plants identified in BC 2 F 1 populations derivedfrom IR70369A MAS99 and KCMS31A MAS99 crosses in rice Sl.no Sl.no IR70369A MAS99 Pollen Total Plant sterility Days to 50 Stigma tillers Plant height Panicle Spikelet code no. % % flowering exertion rate plant -1 at maturity exertion sterility% 1 A A A A A KCMS31A MAS99 Pollen Total Plant sterility Days to 50 Stigma tillers Plant height Panicle Spikelet code no. % % flowering exertion rate plant -1 at maturity exertion sterility% 1 B B B B B Check CMS lines 1. IR70369A KCMS31A

84 IR70369AxMAS99 KCMS31AxMAS99 Total plants Male sterile plants Figure.10 Frequency of male sterile plants in BC 2 F 1 population derived from IR70369A MAS99 and KCMS31A MAS IR70369AxMAS99 KCMS31AxMAS99 Total plants Male sterile plants Figure.11 Frequency of male sterile plants in BC 3 F 1 population derived from IR70369A MAS99 and KCMS31A MAS99

85 Table 13.Superior CMS plantsidentified in BC 3 F 1 populations derived from IR70369A MAS99 and KCMS31A MAS99 crosses in rice IR70369A MAS99 Plant Stigma Plant SL.no code no. Pollen sterility% Days to 50 % flowering exertion rate Total tillers plant -1 height at maturity Panicle exertion Spikelet sterility% 1 A A A A A KCMS31A MAS99 Stigma exertion rate Plant height at maturity SL.no Plant code no. Pollen sterility% Days to 50 % flowering Total tillers plant -1 Panicle exertion Spikelet sterility% 1 B B B B B Check CMS lines 1. IR70369A KCMS31A

86 6. Trait inter-relationship in BC 3 F 1 populations for style length, stigma length and stigma exertion. 6.1 Correlation between style length and stigma exertion in BC 3 F 1 populations The style length was found positively correlated with stigma exertion in both IR70369A MAS99 (0.40)and KCMS31A MAS99 (0.31) derived populations. Stigma length was also found positively correlated with stigma exertion in both IR70369A MAS99 (0.35) and KCMS31A MAS99 (0.60) derived populations (Fig.12). 7. Marker Assisted Background selection (MABS) using rice SSR markers in BC 3 F 1 generation derived from KCMS31A MAS99 cross. 7.1 Parental polymorphism between KCMS31A MAS99. On chromosome 1, 20% of the markers showed polymorphism, on chromosome 2, 22.86%, on chromosome %, on 4 th chromosome 40%, on 5 th chromosome23.26%. On 6 th chromosome 20.00%, on 7 th chromosome 24.24%, on 8 th chromosome 9.52%, on 9 th chromosome 17.39%, on 10 th chromosome 14.29%, on 11 th chromosome 26.19%, on 12 th chromosome 26.16% of the markers showed polymorphismwith the average polymorphism of 20.05% (Table 14). 7.2 Estimation of proportion of recurrent parental genome in BC 3 F 1 progenies of cross KCMS31A MAS99 using rice SSR markers. The genotyping of 45 BC 3 F 1 plants were carried out and out of forty-five individuals analysed, 14 plants were found showing more than expected percent(92.75) recovery of the recurrent parent genome (MAS99), and the highest was by BC 3 F 1-15 (96.88 %) followed by BC 3 F 1-30 and BC 3 F 1-6 (93.75 %). The lowest per cent recovery of the recurrent parent genome was recorded by the BC 3 F 1-40 th individual (86.98%) (Table 15).` 7.3 Graphical genotyping of BC 3 F 1 progenies of cross KCMS31A MAS99 The resultant genotypic data was subjected to graphical genotypic analysis using GGT 2. Software. Graphical genotyping is a pictorial/ schematic representation of the blocks of chromosomes inherited from either parent. It is especially useful in identifying and following blocks of chromosomal segments through several generations based on marker genotypes. Graphical genotyping was done for the selection of BC 3 F 1 individuals which are introgressed maximum of recurrent parent genome (MAS99).(Plate 5).

87 r =0.40 Fig.12 Correlation between style length and stigma exertion in BC 3 F 1 population derived from IR70369A MAS99. r =0.35 Where r: correlation coefficient Fig.13 Correlation between stigma length and stigma exertion in BC 3 F 1 population derived from IR70369A MAS 99.

88 35 30 r =0.31 Stigma exertion Style length Fig.14 Correlation between style length and stigma exertion in BC 3 F 1 population derived from KCMS31A MAS99. r =0.60 Where r: correlation coefficient Fig.15 Correlation between stigma length and stigma exertion in BC 3 F 1 population derived from KCMS31A MAS99

89 Table 14. Details of the polymorphic SSR markers survey on parents of BC 3 F 1 progenies for the cross KCMS31A MAS99 Chromosome Number Total SSR markers screened No. of polymorphic SSR markers Percent polymorphism Total Average = 20.16

90 Table 15. Proportion of recurrent parental genome in BC 3 F 1 progenies of cross KCMS31A MAS99 using rice SSR markers. SL.NO Total no. of alleles Recurre nt parent allele Non recurren t parent allele Percent recurrent genome recovered expected recurrent parent genome recovery Difference BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F

91 BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F Average

92 8.Validation of SSR markers linked to fertility Restoration (Rf) locus Sixteen reported SSR markers linked (Table 3) to fertility locus (Rf) were used to screen the ten male parents with IR 58025B and KMR-3 as standard for maintainer and restorer allele, respectively. Out of sixteen markers seven [RM6100, RM1108, RM6344, RM171, RM490, RM258 and RM1] exhibited polymorphism between IR 58025B and KMR 3 (Figure1). Scoring of male parents using these seven SSR markers was based on allele pattern of standard checks (Table 14). The allelic pattern of all seven polymorphic markers was compared with pollen fertility and spikelet fertility observations using nine CMS lines. Among seven markers used, four markers (RM171, RM1108, RM6100 and RM6344) showed highly positive association with phenotypic fertility restoration and maintainer type allele based on comparison with pollen fertilityand spikelet fertility (Table 16; plate 6). Table 16. Scoring data of male parents (testers) using seven SSR markers associated with Fertility restorer (Rf) locus for maintainer and restorer type allele SL. Genotypes RM RM RM 1 RM RM RM RM no P M M R M M M M 2 P M M R M M R M 3 P R M R R M M M 4 P M M R M M R M 5 Rasi R M R M M M M 6 Poustic-9 R M M R M R M 7 HPR565 M M R M M R M 8 HPR2278 M M M M M M M R: Restorer M: Maintainer

93 BC3F1-V-22 BC3F1-V-23 BC3F1-V-24 BC3F1-V-25 BC3F1-V-26 BC3F1-V-27 BC3F1-V-28 BC3F1-V-29 BC3F1-V-30 BC3F1-V-31 BC3F1-V-32 BC3F1-V-33 B3F1-V-34 BC3F1-V-35 BC3F1-V-36 BC3F1-V-37 BC3F1-V-38 BC3F1-V-39 BC3F1-V-40 BC3F1-V-41 BC3F1-V-42 BC3F1-V-43 BC3F1-V-44 BC3F1-V bp Donor Recurrent BC3F1-V-1 BC3F1-V-2 BC3F1-V-3 BC3F1-V-4 BC3F1-V-5 BC3F1-V-6 BC3F1-V-7 BC3F1-V-8 BC3F1-V-9 BC3F1-V-10 BC3F1-V-11 BC3F1-V-12 BC3F1-V-13 BC3F1-V-14 BC3F1-V-15 BC3F1-V-16 BC3F1-V-17 BC3F1-V-18 BC3F1-V-19 BC3F1-V-20 BC3F1-V-21 RM471 BC3F1-V-22 BC3F1-V-23 BC3F1-V-24 BC3F1-V-25 BC3F1-V-26 BC3F1-V-27 BC3F1-V-28 BC3F1-V-29 BC3F1-V-30 BC3F1-V-31 BC3F1-V-32 BC3F1-V-33 BC3F1-V-34 BC3F1-V-35 BC3F1-V-36 BC3F1-V-37 BC3F1-V-38 BC3F1-V-39 BC3F1-V-40 BC3F1-V-41 BC3F1-V-42 BC3F1-V-43 BC3F1-V-44 BC3F1-V bp Donor Recurrent BC3F1-V-1 BC3F1-V-2 BC3F1-V-3 BC3F1-V-4 BC3F1-V-5 BC3F1-V-6 BC3F1-V-7 BC3F1-V-8 BC3F1-V-9 BC3F1-V-10 BC3F1-V-11 BC3F1-V-12 BC3F1-V-13 BC3F1-V-14 BC3F1-V-15 BC3F1-V-16 BC3F1-V-17 BC3F1-V-18 BC3F1-V-19 BC3F1-V-20 BC3F1-V-21 RM437 Plate 3. Agarose gel profile of RM471 and RM437 SSR markers showing the amplification of 45 BC 3 F 1 s of the cross KCMS31A (Donor) MAS 99(Recurrent) b p Donor

94 D o n o r BC3F1-V-22 BC3F1-V-23 BC3F1-V-24 BC3F1-V-25 BC3F1-V-26 BC3F1-V-27 BC3F1-V-28 Recurrent BC3F1-V-1 BC3F1-V-2 BC3F1-V-3 BC3F1-V-4 BC3F1-V-5 BC3F1-V-6 BC3F1-V-7 BC3F1-V-8 BC3F1-V-9 BC3F1-V-10 BC3F1-V-11 BC3F1-V-12 BC3F1-V-13 BC3F1-V-14 BC3F1-V-15 BC3F1-V-16 BC3F1-V-17 BC3F1-V-18 BC3F1-V-19 BC3F1-V-20 BC3F1-V-21 BC3F1-V-29 BC3F1-V-30 BC3F1-V-31 BC3F1-V-32 BC3F1-V-33 BC3F1-V-34 BC3F1-V-35 BC3F1-V-36 BC3F1-V-37 BC3F1-V-38 BC3F1-V-39 BC3F1-V-40 BC3F1-V-41 BC3F1-V-42 BC3F1-V-43 BC3F1-V-44 BC3F1-V bp Recurrent BC3F1-V-1 BC3F1-V-2 BC3F1-V-3 BC3F1-V-4 BC3F1-V-5 BC3F1-V-6 BC3F1-V-7 BC3F1-V-8 BC3F1-V-9 BC3F1-V-10 BC3F1-V-22 BC3F1-V-23 BC3F1-V-24 BC3F1-V-25 BC3F1-V-26 BC3F1-V-27 BC3F1-V-28 BC3F1-V-29 BC3F1-V-30 BC3F1-V-31 BC3F1-V-32 BC3F1-V-33 BC3F1-V-34 BC3F1-V-35 BC3F1-V-36 BC3F1-V-37 BC3F1-V-11 BC3F1-V-12 BC3F1-V-13 BC3F1-V-14 BC3F1-V-15 BC3F1-V-16 BC3F1-V-17 BC3F1-V-18 BC3F1-V-19 BC3F1-V-20 BC3F1-V-21 RM11 BC3F1-V-38 BC3F1-V-39 BC3F1-V-40 BC3F1-V-41 BC3F1-V-42 BC3F1-V-43 BC3F1-V-44 BC3F1-V-45 RM13 Plate 4. Agarose gel profile of RM11 and 1370 SSR markers showing the amplification of 45 BC 3 F 1 s of the cross KCMS31A (Donor) MAS 99(Recurrent)

95 Male parent genome(mas99) Female parent genome(kcms31a) Unknown genome Plate 5: Graphical genotyping of the 12 linkage groups of 45 BC 3 F 1 sderived from KCMS31A MAS99CROSS in rice.

96 100bp ladder M bp ladder R M RM6100 RM bp ladder R M RM bp ladder R M RM6344 R: KMR-3, M: IR58025B. Plate 6: Screening of polymorphic Rf locus specific SSR markers across the 8 male parents 1: P , 2:P , 3: P , 4:P , 5: Rasi, 6: Poustic-9, 7: HPR-565, 8: HPR-2278.

97 9.Identification of restorers and maintainers for new BC 3 F 1 CMS lines. Seventy two F 1 hybrids were produced by crossing nine CMS lines with eight male parents in L T design. The results obtained based on pollen and spikelet fertility are presented in Table 15. The hybrids were classified as maintainer, partial maintainer and partial restorer based on pollen and spikelet fertility. Based on pollen fertility, 32 hybrids were found to be completely sterile, 34 as partially sterile and 6 as partially fertile, none of them shown complete fertility (plate 7). Based on spikelet fertility, 62 hybrids were found completely sterile and 10 hybrids showed partial sterile behaviour (Table 17). When both pollen fertility and spikelet fertility were considered, 62hybrids were found to be completely sterile and 10hybrids were partial sterility and none of the hybrids were completely fertile. Based on pollen fertility, the linesderived from IR70369A MAS99 (BC 3 F 1-2-1, BC 3 F 1-5-4, BC 3 F 1-7-8, BC 3 F 1-8-5, BC 3 F ) had highest number (4) of effective maintainers, than lines derived from KCMS31A MAS99 (BC 3 F , BC 3 F , BC 3 F , BC 3 F ) which had 3 effective maintainers each. While, the line BC 3 F had highest number of partial maintainers (5) and the line BC 3 F had lowest number of partial maintainers.(table 18).The male parents (testers), Rasi and P were classified as effective maintainers for all the nine CMS lines. Whereas P , Poustic-9, HPR565 and HPR 2278 were Classified as partial maintainer and partial restorer for all CMS lines. P and P were classified as maintainers for the lines derived from IR70369A MAS99 whereas they were acted as partial maintainers and partial restores for the lines derived from KCMS31A MAS99. Based on spikelet fertility most of the hybrids were found completely sterile except line BC 3 F had four partial maintainers and Poustic-9 was acted as partial maintainer for three lines. Based on both pollen and spikelet fertility test among eight testers used 6 were acted as maintainers for all the CMS lines except for line BC 3 F and P were acted as partial maintainers for BC 3 F 1-7-8, BC 3 F , BC 3 F line and poustic-9 also acted as partial maintainer for BC 3 F 1-5-4, BC 3 F 1-7-8, BC 3 F ,BC 3 F , BC 3 F lines.

98 Table 17. Classification of crosses as maintainers and restorers based on pollen fertility, spikelet fertility and both. SL. NO Hybrids Pollen fertility Spikelet fertility Based on Both Percent Class Percent Class 1 BC 3 F P M 0.00 M M 2 BC 3 F P M 0.00 M M 3 BC 3 F P M 0.00 M M 4 BC 3 F P PM 0.00 M M 5 BC 3 F RASI 0.00 M 0.00 M M 6 BC 3 F POUSTIC PM 1.35 M M 7 BC 3 F HPR PM 2.50 M M 8 BC 3 F HPR PM 4.12 M M 9 BC 3 F P M 0.00 M M 10 BC 3 F P M 0.00 M M 11 BC 3 F P M 0.00 M M 12 BC 3 F P PM 0.00 M M 13 BC 3 F RASI 0.00 M 0.00 M M 14 BC 3 F POUSTIC PM 7.62 PM PM 15 BC 3 F HPR PM 0.00 M M 16 BC 3 F HPR PM 3.25 M M 17 BC 3 F P M 0.00 M M 18 BC 3 F P M 0.00 M M 19 BC 3 F P M 0.00 M M 20 BC 3 F P PM 0.00 M PM/M 21 BC 3 F RASI 0.00 M 1.80 M M 22 BC 3 F POUSTIC PM 8.51 PM PM 23 BC 3 F HPR PM 2.68 M PM/M 24 BC 3 F HPR PM 2.31 M PM/M 25 BC 3 F P M 0.00 M M 26 BC 3 F P M 0.00 M M 27 BC 3 F P M 0.00 M M 28 BC 3 F P PM 2.16 M PM/M 29 BC 3 F RASI 0.00 M 0.00 M M 30 BC 3 F POUSTIC PM 3.42 M PM/M 31 BC 3 F HPR PM 2.73 M PM/M 32 BC 3 F HPR PM 3.62 M PM/M 33 BC 3 F P M 0.00 M M 34 BC 3 F P PM 2.30 M PM/M 35 BC 3 F P PM 3.52 M PM/M

99 Table contd 36 BC 3 F P PM 4.65 M PM/M 37 BC 3 F RASI 0.00 M 2.13 M M 38 BC 3 F POUSTIC PM 0.00 M PM/M 39 BC 3 F HPR PM 2.62 M PM/M 40 BC 3 F P M 0.00 M M 41 BC 3 F P M 0.00 M M 42 BC 3 F P PM 2.42 M PM/M 43 BC 3 F P PM 2.15 M PM/M 44 BC 3 F P PR 5.56 PM PR/PM 45 BC 3 F RASI 0.00 M 0.00 M M 46 BC 3 F POUSTIC PM 3.42 M PM/M 47 BC 3 F HPR PM 4.80 M PM/M 48 BC 3 F P M 0.00 M M 49 BC 3 F P M 0.00 M M 50 BC 3 F P PR 6.41 PM PR/PM 51 BC 3 F P PR 15.3 PM PR/PM 52 BC 3 F P PR PM PR/PM 53 BC 3 F RASI 0.00 M 3.20 M M 54 BC 3 F POUSTIC PR 8.56 PM PR/PM 55 BC 3 F HPR PM 2.24 M PM/M 56 BC 3 F HPR M 3.50 M M 57 BC 3 F P M 2.45 M M 58 BC 3 F P PM 4.56 M PM/M 59 BC 3 F P PM 2.84 M PM/M 60 BC 3 F P PM 3.45 M PM/M 61 BC 3 F RASI 0.00 M 3.60 M M 62 BC 3 F POUSTIC PM 7.25 PM PM/PM 63 BC 3 F HPR PR 2.43 M PR/M 64 BC 3 F HPR M 3.58 M M 65 BC 3 F P M 0.00 M M 66 BC 3 F P M 2.40 M M 67 BC 3 F P M 0.00 M M 68 BC 3 F P PM 8.62 PM PM 69 BC 3 F RASI 0.00 M 2.45 M M 70 BC 3 F POUSTIC PM 5.62 PM PM 71 BC 3 F HPR PM 4.56 M PM/M 72 BC 3 F HPR PM 6.75 M PM/M

100 Table 18. Number of restorers, maintainers, partial restorers and partial maintainers for different CMS lines SL. NO CMS Line Classification Pollen fertility Spikelet fertility Both R PR PM M R PR PM M R M PR/PM 1 BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F BC 3 F

101 Maintainer (0-1%) Results of pollen fertility test Partial restorer (20-60%) Partial maintainer (1-20%)

Development of male-sterile lines in sorghum

Development of male-sterile lines in sorghum Development of male-sterile lines in sorghum A Ashok Kumar, Belum VS Reddy, P Sanjana Reddy and B Ramaiah International Crops Research Institute for the Semi-Arid Tropics, Patancheru 502 324, Andhra Pradesh,

More information

Introduction to Plant Breeding. Master Gardener Training

Introduction to Plant Breeding. Master Gardener Training Introduction to Plant Breeding Master Gardener Training Start with a seed Germplasm Germplasm The greatest service which can be rendered to any country is to add a useful plant to its culture -Thomas Jefferson

More information

Germplasm. Introduction to Plant Breeding. Germplasm 2/12/2013. Master Gardener Training. Start with a seed

Germplasm. Introduction to Plant Breeding. Germplasm 2/12/2013. Master Gardener Training. Start with a seed Introduction to Plant Breeding Master Gardener Training Start with a seed Germplasm Germplasm The greatest service which can be rendered to any country is to add a useful plant to its culture -Thomas Jefferson

More information

C.v. Dr. Mohammed Ali Hussein

C.v. Dr. Mohammed Ali Hussein C.v. Dr. Mohammed Ali Hussein - Dr Mohammed Ali Hussien Al- Falahe Email: dr.mohammed1953@yahoo.com Tele : 07507718671. - Was born in Baghdad Iraq 1953. - Graduated from Al-Nasar primary school in 1966.

More information

Principles of QTL Mapping. M.Imtiaz

Principles of QTL Mapping. M.Imtiaz Principles of QTL Mapping M.Imtiaz Introduction Definitions of terminology Reasons for QTL mapping Principles of QTL mapping Requirements For QTL Mapping Demonstration with experimental data Merit of QTL

More information

Eiji Yamamoto 1,2, Hiroyoshi Iwata 3, Takanari Tanabata 4, Ritsuko Mizobuchi 1, Jun-ichi Yonemaru 1,ToshioYamamoto 1* and Masahiro Yano 5,6

Eiji Yamamoto 1,2, Hiroyoshi Iwata 3, Takanari Tanabata 4, Ritsuko Mizobuchi 1, Jun-ichi Yonemaru 1,ToshioYamamoto 1* and Masahiro Yano 5,6 Yamamoto et al. BMC Genetics 2014, 15:50 METHODOLOGY ARTICLE Open Access Effect of advanced intercrossing on genome structure and on the power to detect linked quantitative trait loci in a multi-parent

More information

Plant Propagation PLS 3223/5222

Plant Propagation PLS 3223/5222 Plant Propagation PLS 3223/5222 Dr. Sandra Wilson Dr. Mack Thetford Principles and Practices of Seed Selection Chapter 5 1 Chapter 5 Objectives are to Understand: Self and cross pollination Sexual incompatibility

More information

Sporic life cycles involve 2 types of multicellular bodies:

Sporic life cycles involve 2 types of multicellular bodies: Chapter 3- Human Manipulation of Plants Sporic life cycles involve 2 types of multicellular bodies: -a diploid, spore-producing sporophyte -a haploid, gamete-producing gametophyte Sexual Reproduction in

More information

Quantitative trait loci mapping of the stigma exertion rate and spikelet number per panicle in rice (Oryza sativa L.)

Quantitative trait loci mapping of the stigma exertion rate and spikelet number per panicle in rice (Oryza sativa L.) Quantitative trait loci mapping of the stigma exertion rate and spikelet number per panicle in rice (Oryza sativa L.) M.H. Rahman, P. Yu, Y.X. Zhang, L.P. Sun, W.X. Wu, X.H. Shen, X.D. Zhan, D.B. Chen,

More information

IDENTIFICATION OF THERMOSENSITIVE GENIC MALE-STERILE LINES WITH LOW CRITICAL STERILITY POINT FOR HYBRID RICE BREEDING

IDENTIFICATION OF THERMOSENSITIVE GENIC MALE-STERILE LINES WITH LOW CRITICAL STERILITY POINT FOR HYBRID RICE BREEDING Philippine Journal of Crop Science April 2005, 30(1): 19-28 Copyright 2005, Crop Science Society of the Philippines Released 22 April 2005 IDENTIFICATION OF THERMOSENSITIVE GENIC MALE-STERILE LINES WITH

More information

CYTOPLASMIC INHERITANCE

CYTOPLASMIC INHERITANCE CYTOPLASMIC INHERITANCE Inheritance of most of the characters in eukaryotic organisms shows the following characteristic features. 1. The contributions by both male and female parents are equal so that

More information

Relationship Between Coleoptile Length and Drought Resistance and Their QTL Mapping in Rice

Relationship Between Coleoptile Length and Drought Resistance and Their QTL Mapping in Rice Rice Science, 2007, 14(1): 13-20 Copyright 2007, China National Rice Research Institute. Published by Elsevier BV. All rights reserved Relationship Between Coleoptile Length and Drought Resistance and

More information

Genetic and physiological approach to elucidation of Cd absorption mechanism by rice plants

Genetic and physiological approach to elucidation of Cd absorption mechanism by rice plants Genetic and physiological approach to elucidation of Cd absorption mechanism by rice plants Satoru Ishikawa National Institute for Agro-Environmental Sciences, 3-1-3, Kannondai, Tsukuba, Ibaraki, 305-8604,

More information

Mendel and the Gene Idea. Biology Exploring Life Section Modern Biology Section 9-1

Mendel and the Gene Idea. Biology Exploring Life Section Modern Biology Section 9-1 Mendel and the Gene Idea Biology Exploring Life Section 10.0-10.2 Modern Biology Section 9-1 Objectives Summarize the Blending Hypothesis and the problems associated with it. Describe the methods used

More information

Kentucky Seed Certification Standards. I. Explanation of General Standards as Applied to Corn Hybrids

Kentucky Seed Certification Standards. I. Explanation of General Standards as Applied to Corn Hybrids Kentucky Seed Certification Standards H Y B R I D C O R N I. Explanation of General Standards as Applied to Corn Hybrids A. The General Seed Certification Standards as adopted are basic and, together with

More information

COMBINING ABILITY ANALYSIS FOR CURED LEAF YIELD AND ITS COMPONENT TRAITS IN BIDI TOBACCO (NicotianatabacumL.)

COMBINING ABILITY ANALYSIS FOR CURED LEAF YIELD AND ITS COMPONENT TRAITS IN BIDI TOBACCO (NicotianatabacumL.) International Journal of Science, Environment and Technology, Vol. 5, No 3, 2016, 1373 1380 ISSN 2278-3687 (O) 2277-663X (P) COMBINING ABILITY ANALYSIS FOR CURED LEAF YIELD AND ITS COMPONENT TRAITS IN

More information

POSSIBILITY TO SELECT HETEROZYGOUS GENOTYPES BY POLLEN FERTILITY IN SEGREGATION HYBRID AND BACKCROSS PROGENIES CREATED based on NUCLEAR MALE STERILITY

POSSIBILITY TO SELECT HETEROZYGOUS GENOTYPES BY POLLEN FERTILITY IN SEGREGATION HYBRID AND BACKCROSS PROGENIES CREATED based on NUCLEAR MALE STERILITY 565 Bulgarian Journal of Agricultural Science, 18 (No 4) 2012, 565-570 Agricultural Academy POSSIBILITY TO SELECT HETEROZYGOUS GENOTYPES BY POLLEN FERTILITY IN SEGREGATION HYBRID AND BACKCROSS PROGENIES

More information

Name Class Date. KEY CONCEPT Gametes have half the number of chromosomes that body cells have.

Name Class Date. KEY CONCEPT Gametes have half the number of chromosomes that body cells have. Section 1: Chromosomes and Meiosis KEY CONCEPT Gametes have half the number of chromosomes that body cells have. VOCABULARY somatic cell autosome fertilization gamete sex chromosome diploid homologous

More information

12.1 Mendel s Experiments and the Laws of Probability

12.1 Mendel s Experiments and the Laws of Probability 314 Chapter 12 Mendel's Experiments and Heredity 12.1 Mendel s Experiments and the Laws of Probability By the end of this section, you will be able to: Describe the scientific reasons for the success of

More information

PEST MANAGEMENT: WEEDS

PEST MANAGEMENT: WEEDS PEST MANAGEMENT: WEEDS Outcrossing Frequency and Phenotypes of Outcrosses Based on Flowering of Red Rice Accessions and Clearfield Cultivars in the Grand Prairie V.K. Shivrain, N.R. Burgos, J.A. Bullington,

More information

Research Notes: G. B. Pant University of Agriculture and Technology

Research Notes: G. B. Pant University of Agriculture and Technology Volume 1 Article 6 4-1-1974 Research Notes: G. B. Pant University of Agriculture and Technology G. B. Pant University of Agriculture and Technology G. B. Pant University of Agriculture and Technology G.

More information

Evaluation of Taro (Colocasia esculenta (L.) Schott.) Germplasm Using Multivariate Analysis

Evaluation of Taro (Colocasia esculenta (L.) Schott.) Germplasm Using Multivariate Analysis 150 Journal of Root Crops, 2011, Vol. 37 No. 2, pp. 150-154 Indian Society for Root Crops ISSN 0378-2409 Evaluation of Taro (Colocasia esculenta (L.) Schott.) Germplasm Using Multivariate Analysis Central

More information

Investigation of Correlation and Board Sense Heritability in Tritipyrum Lines under Normal and Drought Stress Conditions

Investigation of Correlation and Board Sense Heritability in Tritipyrum Lines under Normal and Drought Stress Conditions American-Eurasian J. Agric. & Environ. Sci., 3 (): 07-, 03 ISSN 88-6769 IDOSI Publications, 03 DOI: 0.589/idosi.aejaes.03.3.0.333 Investigation of Correlation and Board Sense Heritability in Tritipyrum

More information

Pollination and Seed Yield in Grass Seed Crops. Thomas G Chastain Oregon State University

Pollination and Seed Yield in Grass Seed Crops. Thomas G Chastain Oregon State University Pollination and Seed Yield in Grass Seed Crops Thomas G Chastain Oregon State University Seed Yield Potential vs. Actual Yield An example for perennial ryegrass Florets not pollinated, fertilized, or aborted

More information

1 Rice Growth and Development

1 Rice Growth and Development 1 Rice Growth and Development Karen Moldenhauer and Nathan Slaton Rice is an annual grass (Figure 1-1) with round, hollow, jointed culms; narrow, flat, sessile leaf blades joined to the leaf sheaths with

More information

Lodging-Resistance Breeding of Platycodon grandiflorus Using Distant Hybridization

Lodging-Resistance Breeding of Platycodon grandiflorus Using Distant Hybridization American Journal of Plant Sciences, 2015, 6, 2844-2849 Published Online November 2015 in SciRes. http://www.scirp.org/journal/ajps http://dx.doi.org/10.4236/ajps.2015.618281 Lodging-Resistance Breeding

More information

Classical Selection, Balancing Selection, and Neutral Mutations

Classical Selection, Balancing Selection, and Neutral Mutations Classical Selection, Balancing Selection, and Neutral Mutations Classical Selection Perspective of the Fate of Mutations All mutations are EITHER beneficial or deleterious o Beneficial mutations are selected

More information

Reinforcement Unit 3 Resource Book. Meiosis and Mendel KEY CONCEPT Gametes have half the number of chromosomes that body cells have.

Reinforcement Unit 3 Resource Book. Meiosis and Mendel KEY CONCEPT Gametes have half the number of chromosomes that body cells have. 6.1 CHROMOSOMES AND MEIOSIS KEY CONCEPT Gametes have half the number of chromosomes that body cells have. Your body is made of two basic cell types. One basic type are somatic cells, also called body cells,

More information

DROUGHT is one of the major abiotic stresses

DROUGHT is one of the major abiotic stresses Copyright Ó 2006 by the Genetics Society of America DOI: 10.1534/genetics.105.045062 Genetic Basis of Drought Resistance at Reproductive Stage in Rice: Separation of Drought Tolerance From Drought Avoidance

More information

Effect of Weather Parameters on Population Dynamics of Paddy Pests

Effect of Weather Parameters on Population Dynamics of Paddy Pests International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 6 Number 10 (2017) pp. 2049-2053 Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2017.610.243

More information

Duplication of an upstream silencer of FZP increases grain yield in rice

Duplication of an upstream silencer of FZP increases grain yield in rice SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41477-017-0042-4 In the format provided by the authors and unedited. Duplication of an upstream silencer of FZP increases grain yield in rice

More information

Mendelian Genetics. Introduction to the principles of Mendelian Genetics

Mendelian Genetics. Introduction to the principles of Mendelian Genetics + Mendelian Genetics Introduction to the principles of Mendelian Genetics + What is Genetics? n It is the study of patterns of inheritance and variations in organisms. n Genes control each trait of a living

More information

Meiosis and Mendel. Chapter 6

Meiosis and Mendel. Chapter 6 Meiosis and Mendel Chapter 6 6.1 CHROMOSOMES AND MEIOSIS Key Concept Gametes have half the number of chromosomes that body cells have. Body Cells vs. Gametes You have body cells and gametes body cells

More information

1 Mendel and His Peas

1 Mendel and His Peas CHAPTER 3 1 Mendel and His Peas SECTION Heredity BEFORE YOU READ After you read this section, you should be able to answer these questions: What is heredity? How did Gregor Mendel study heredity? National

More information

Biology Chapter 11: Introduction to Genetics

Biology Chapter 11: Introduction to Genetics Biology Chapter 11: Introduction to Genetics Meiosis - The mechanism that halves the number of chromosomes in cells is a form of cell division called meiosis - Meiosis consists of two successive nuclear

More information

Assessment of drought resistance among wild rice accessions using a protocol based on single-tiller propagation and PVC-tube cultivation

Assessment of drought resistance among wild rice accessions using a protocol based on single-tiller propagation and PVC-tube cultivation AJCS 6(7):1204-1211 (2012) ISSN:1835-2707 Assessment of drought resistance among wild rice accessions using a protocol based on single-tiller propagation and PVC-tube cultivation Fangjun Feng, Xiaoyan

More information

Chapter 1: Mendel s breakthrough: patterns, particles and principles of heredity

Chapter 1: Mendel s breakthrough: patterns, particles and principles of heredity Chapter 1: Mendel s breakthrough: patterns, particles and principles of heredity please read pages 10 through 13 Slide 1 of Chapter 1 One of Mendel s express aims was to understand how first generation

More information

NSave Nature to Survive

NSave Nature to Survive ISSN: 0974-0376 NSave Nature to Survive : Special issue, Vol. VII: 477-481: 2015 AN INTERNATIONAL QUARTERLY JOURNAL OF ENVIRONMENTAL SCIENCES www.theecoscan.in HETEROSIS STUDIES FOR GRAIN YIELD AND COMPONENT

More information

Partitioning of General and Specific Combining Ability Effects for Estimating Maternal and Reciprocal Effects

Partitioning of General and Specific Combining Ability Effects for Estimating Maternal and Reciprocal Effects Partitioning of General and Specific Combining Ability Effects for Estimating Maternal and Reciprocal Effects Galal M. A. Mahgoub Maize Research Department, Field Crops Research Institute. Agricultural

More information

Chapter 2: Extensions to Mendel: Complexities in Relating Genotype to Phenotype.

Chapter 2: Extensions to Mendel: Complexities in Relating Genotype to Phenotype. Chapter 2: Extensions to Mendel: Complexities in Relating Genotype to Phenotype. please read pages 38-47; 49-55;57-63. Slide 1 of Chapter 2 1 Extension sot Mendelian Behavior of Genes Single gene inheritance

More information

Combining Ability Estimates for Yield and Fibre Quality Traits in Line X Tester Crosses of Upland Cotton, (Gossypium hirsutum)

Combining Ability Estimates for Yield and Fibre Quality Traits in Line X Tester Crosses of Upland Cotton, (Gossypium hirsutum) Combining Ability Estimates for Yield and Fibre Quality Traits in Line X Tester Crosses of Upland Cotton, (Gossypium hirsutum) Kaliyaperumal Ashokkumar Department of Plant Molecular Biology and Biotechnology

More information

Research Journal of Biology Volume 1: (Published: 16 June, 2013) ISSN:

Research Journal of Biology Volume 1: (Published: 16 June, 2013) ISSN: Research Journal of Biology Volume 1: 24 30 (Published: 16 June, 2013) RESEARCH ARTICLE Molecular mapping of early vigour related QTLs in rice Jayateertha Diwan 1, Makanhally Channbyregowda 1, Vinay Shenoy

More information

HEREDITY: Objective: I can describe what heredity is because I can identify traits and characteristics

HEREDITY: Objective: I can describe what heredity is because I can identify traits and characteristics Mendel and Heredity HEREDITY: SC.7.L.16.1 Understand and explain that every organism requires a set of instructions that specifies its traits, that this hereditary information. Objective: I can describe

More information

Identification of Molecular Markers for Karnal Bunt Resistance by Using RGAP in Wheat (Triticum aestivum L. em. Thell)

Identification of Molecular Markers for Karnal Bunt Resistance by Using RGAP in Wheat (Triticum aestivum L. em. Thell) Available online at www.ijpab.com Priyanka et al Int. J. Pure App. Biosci. 5 (4): 1850-1856 (2017) ISSN: 2320 7051 DOI: http://dx.doi.org/10.18782/2320-7051.5375 ISSN: 2320 7051 Int. J. Pure App. Biosci.

More information

A mixed model based QTL / AM analysis of interactions (G by G, G by E, G by treatment) for plant breeding

A mixed model based QTL / AM analysis of interactions (G by G, G by E, G by treatment) for plant breeding Professur Pflanzenzüchtung Professur Pflanzenzüchtung A mixed model based QTL / AM analysis of interactions (G by G, G by E, G by treatment) for plant breeding Jens Léon 4. November 2014, Oulu Workshop

More information

Developing and implementing molecular markers in perennial ryegrass breeding

Developing and implementing molecular markers in perennial ryegrass breeding Developing and implementing molecular markers in perennial ryegrass breeding K.F. Smith 1,3, J.W. Forster 2,3, T.A. Ciavarella 1,3, J.L. Dumsday 2, M.P. Dupal 2,3, E.S. Jones 2,3, B.D. Kirkwood 1,3, A.

More information

Genetic Analysis of Yield and its Components of Some Egyptian Cotton (Gossypium barbadense L.) Varieties

Genetic Analysis of Yield and its Components of Some Egyptian Cotton (Gossypium barbadense L.) Varieties World Journal of Agricultural Sciences 6 (5): 65-6 00 ISSN 87-3047 IDOSI Publications 00 Genetic Analysis of Yield and its Components of Some Egyptian Cotton (Gossypium barbadense L.) Varieties 3 S.H.M.

More information

Genomewide Selection in Oil Palm: Increasing Selection Gain per Unit Time and Cost with Small Populations

Genomewide Selection in Oil Palm: Increasing Selection Gain per Unit Time and Cost with Small Populations Genomewide Selection in Oil Palm: Increasing Selection Gain per Unit Time and Cost with Small Populations C.K. Wong R. Bernardo 1 ABSTRACT Oil palm (Elaeis guineensis Jacq.) requires 19 years per cycle

More information

Estimation of Variability for Grain Yield and Quality Traits in Rice (Oryza sativa L.)

Estimation of Variability for Grain Yield and Quality Traits in Rice (Oryza sativa L.) Available online at www.ijpab.com Rukmini et al Int. J. Pure App. Biosci. 4 (2): 250-255 (2016) ISSN: 2320 7051 DOI: http://dx.doi.org/10.18782/2320-7051.2245 ISSN: 2320 7051 Int. J. Pure App. Biosci.

More information

Through the genetic bottleneck: O. rufipogon as a source of trait-enhancing alleles for O. sativa

Through the genetic bottleneck: O. rufipogon as a source of trait-enhancing alleles for O. sativa Euphytica (2007) 154:317 339 DOI 10.1007/s10681-006-9210-8 Through the genetic bottleneck: O. rufipogon as a source of trait-enhancing alleles for O. sativa Susan R. McCouch Æ Megan Sweeney Æ Jiming Li

More information

Descriptions and Performance

Descriptions and Performance LSU AgCenter Coastal Plants Program Smooth Cordgrass Varieties: Descriptions and Performance Smooth cordgrass (Spartina alterniflora Loisel.) is a perennial grass native to intertidal saline marshes along

More information

Qualities of monogerm male-sterile sugar beet lines

Qualities of monogerm male-sterile sugar beet lines RESEARCH PAPER International Journal of Agronomy and Agricultural Research (IJAAR) ISSN: 2223-7054 (Print) 2225-3610 (Online) http://www.innspub.net Vol. 8, No. 4, p. 81-86, 2016 Qualities of monogerm

More information

Genetic Variability, Coefficient of Variance, Heritability and Genetic Advance of Some Gossypium hirsutum L. Accessions

Genetic Variability, Coefficient of Variance, Heritability and Genetic Advance of Some Gossypium hirsutum L. Accessions Journal of Agricultural Science; Vol. 7, No. 2; 2015 ISSN 1916-9752 E-ISSN 1916-9760 Published by Canadian Center of Science and Education Genetic Variability, Coefficient of Variance, Heritability and

More information

QTL analysis for hybrid sterility and plant height in interspecific populations derived from a wild rice relative, Oryza longistaminata

QTL analysis for hybrid sterility and plant height in interspecific populations derived from a wild rice relative, Oryza longistaminata Breeding Science 59: 441 445 (2009) Note QTL analysis for hybrid sterility and plant height in interspecific populations derived from a wild rice relative, Oryza longistaminata Zhiwei Chen 1,2), Fengyi

More information

Chromosome duplication and distribution during cell division

Chromosome duplication and distribution during cell division CELL DIVISION AND HEREDITY Student Packet SUMMARY IN EUKARYOTES, HERITABLE INFORMATION IS PASSED TO THE NEXT GENERATION VIA PROCESSES THAT INCLUDE THE CELL CYCLE, MITOSIS /MEIOSIS AND FERTILIZATION Mitosis

More information

is the scientific study of. Gregor Mendel was an Austrian monk. He is considered the of genetics. Mendel carried out his work with ordinary garden.

is the scientific study of. Gregor Mendel was an Austrian monk. He is considered the of genetics. Mendel carried out his work with ordinary garden. 11-1 The 11-1 Work of Gregor Mendel The Work of Gregor Mendel is the scientific study of. Gregor Mendel was an Austrian monk. He is considered the of genetics. Mendel carried out his work with ordinary

More information

Seed Development and Yield Components. Thomas G Chastain CROP 460/560 Seed Production

Seed Development and Yield Components. Thomas G Chastain CROP 460/560 Seed Production Seed Development and Yield Components Thomas G Chastain CROP 460/560 Seed Production The Seed The zygote develops into the embryo which contains a shoot (covered by the coleoptile) and a root (radicle).

More information

Lesson Plan non mendelian inheritance

Lesson Plan non mendelian inheritance Lesson Plan non mendelian inheritance LEYNAR LEYTON NARANJO PH.D. STUDENT. INSTITUTE OF PLANT BREEDING, GENETICS AND GENOMICS Author(s): Author Affiliation and Location. Author Website Author Contact Information

More information

Bio Ch Plants.notebook. April 09, 2015

Bio Ch Plants.notebook. April 09, 2015 1 Plants are vitally important to all life on Earth, especially humans Form the base of the food chain Medicines Clothing Building Materials 2 Plants for Food Cereals - The grass family - Rich in carbohydrates

More information

Essential Questions. Meiosis. Copyright McGraw-Hill Education

Essential Questions. Meiosis. Copyright McGraw-Hill Education Essential Questions How does the reduction in chromosome number occur during meiosis? What are the stages of meiosis? What is the importance of meiosis in providing genetic variation? Meiosis Vocabulary

More information

CHAPTER 23 THE EVOLUTIONS OF POPULATIONS. Section C: Genetic Variation, the Substrate for Natural Selection

CHAPTER 23 THE EVOLUTIONS OF POPULATIONS. Section C: Genetic Variation, the Substrate for Natural Selection CHAPTER 23 THE EVOLUTIONS OF POPULATIONS Section C: Genetic Variation, the Substrate for Natural Selection 1. Genetic variation occurs within and between populations 2. Mutation and sexual recombination

More information

Chapter 5 Evolution of Biodiversity. Sunday, October 1, 17

Chapter 5 Evolution of Biodiversity. Sunday, October 1, 17 Chapter 5 Evolution of Biodiversity CHAPTER INTRO: The Dung of the Devil Read and Answer Questions Provided Module 14 The Biodiversity of Earth After reading this module you should be able to understand

More information

Science 9 - Unit A Review Sheet

Science 9 - Unit A Review Sheet Science 9 - Unit A Review Sheet Learning Outcomes Can you? describe the relative abundance of species on Earth and in different environments describe examples of variation among species and within species

More information

Outline for today s lecture (Ch. 14, Part I)

Outline for today s lecture (Ch. 14, Part I) Outline for today s lecture (Ch. 14, Part I) Ploidy vs. DNA content The basis of heredity ca. 1850s Mendel s Experiments and Theory Law of Segregation Law of Independent Assortment Introduction to Probability

More information

Pitahayas: introduction, agrotechniques and breeding

Pitahayas: introduction, agrotechniques and breeding Pitahayas: introduction, agrotechniques and breeding The French Associates Institute for Agriculture and Biotechnology of Drylands May 8 Noemi Tel-Zur The J. Blaustein Institutes for Desert Research Ben-Gurion

More information

Genetic diversity study of sorghum (Sorghum bicolor (L.) Moenc) genotypes, Ethiopia

Genetic diversity study of sorghum (Sorghum bicolor (L.) Moenc) genotypes, Ethiopia ACTA UNIVERSITATIS SAPIENTIAE AGRICULTURE AND ENVIRONMENT, 9 (2017) 44 54 DOI: 10.1515/ausae-2017-0004 Genetic diversity study of sorghum (Sorghum bicolor (L.) Moenc) genotypes, Ethiopia Kassahun TESFAYE

More information

Probability models for weekly rainfall at Thrissur

Probability models for weekly rainfall at Thrissur Journal of Tropical Agriculture 53 (1) : 56-6, 015 56 Probability models for weekly rainfall at Thrissur C. Laly John * and B. Ajithkumar *Department of Agricultural Statistics, College of Horticulture,

More information

BIOL EVOLUTION OF QUANTITATIVE CHARACTERS

BIOL EVOLUTION OF QUANTITATIVE CHARACTERS 1 BIOL2007 - EVOLUTION OF QUANTITATIVE CHARACTERS How do evolutionary biologists measure variation in a typical quantitative character? Let s use beak size in birds as a typical example. Phenotypic variation

More information

Development of regression models in ber genotypes under the agroclimatic conditions of south-western region of Punjab, India

Development of regression models in ber genotypes under the agroclimatic conditions of south-western region of Punjab, India Indian J. Agric. Res., 49 (3) 2015: 260-264 Print ISSN:0367-8245 / Online ISSN:0976-058X AGRICULTURAL RESEARCH COMMUNICATION CENTRE www.arccjournals.com/www.ijarjournal.com Development of regression models

More information

Linkage between genes for leaf colour, plant pubescence, number of leaflets and plant height in lentil (Lens culinaris Medik.)

Linkage between genes for leaf colour, plant pubescence, number of leaflets and plant height in lentil (Lens culinaris Medik.) Euphytica (2005) 145: 41 48 DOI: 10.1007/s10681-005-0103-z C Springer 2005 Linkage between genes for leaf colour, plant pubescence, number of leaflets and plant height in lentil (Lens culinaris Medik.)

More information

Genetic Parameters for Hydrocyanic acid Content in Forage Sorghum (Sorghum Bicolor L. Moench)

Genetic Parameters for Hydrocyanic acid Content in Forage Sorghum (Sorghum Bicolor L. Moench) International Journal of Biotechnology and Bioengineering Research. ISSN 2231-1238, Volume 4, Number 4 (2013), pp. 395-400 Research India Publications http://www.ripublication.com/ ijbbr.htm Genetic Parameters

More information

Quantitative trait locus analysis for ear height in maize based on a recombinant inbred line population

Quantitative trait locus analysis for ear height in maize based on a recombinant inbred line population Quantitative trait locus analysis for ear height in maize based on a recombinant inbred line population Z.Q. Li 4,5, H.M. Zhang 1,4, X.P. Wu 1,4, Y. Sun 3,4 and X.H. Liu 2 1 Maize Research Institute, Shanxi

More information

Chapter 24-Flowering Plant and Animal Coevolution

Chapter 24-Flowering Plant and Animal Coevolution Chapter 24-Flowering Plant and Animal Coevolution coevolutionary plant-animal associations alliances that have influenced the evoluton of both partners. These examples show that plants have acquired traits

More information

Interest Grabber. Analyzing Inheritance

Interest Grabber. Analyzing Inheritance Interest Grabber Section 11-1 Analyzing Inheritance Offspring resemble their parents. Offspring inherit genes for characteristics from their parents. To learn about inheritance, scientists have experimented

More information

Interactive Biology Multimedia Courseware Mendel's Principles of Heredity. Copyright 1998 CyberEd Inc.

Interactive Biology Multimedia Courseware Mendel's Principles of Heredity. Copyright 1998 CyberEd Inc. Interactive Biology Multimedia Courseware Mendel's Principles of Heredity Copyright 1998 CyberEd Inc. Mendel's Principles of Heredity TEACHING OBJECTIVES The following subject areas are illustrated throughout

More information

CSS 350 Midterm #2, 4/2/01

CSS 350 Midterm #2, 4/2/01 6. In corn three unlinked dominant genes are necessary for aleurone color. The genotypes B-D-B- are colored. If any of these loci is homozygous recessive the aleurone will be colorless. What is the expected

More information

Just to review Genetics and Cells? How do Genetics and Cells Relate? The cell s NUCLEUS contains all the genetic information.

Just to review Genetics and Cells? How do Genetics and Cells Relate? The cell s NUCLEUS contains all the genetic information. Just to review Genetics and Cells? How do Genetics and Cells Relate? The cell s NUCLEUS contains all the genetic information. It s called: DNA A. Describe what Gregor Mendel discovered in his experiments

More information

Section 11 1 The Work of Gregor Mendel

Section 11 1 The Work of Gregor Mendel Chapter 11 Introduction to Genetics Section 11 1 The Work of Gregor Mendel (pages 263 266) What is the principle of dominance? What happens during segregation? Gregor Mendel s Peas (pages 263 264) 1. The

More information

(51) Int Cl.: A01H 5/08 ( )

(51) Int Cl.: A01H 5/08 ( ) (19) TEPZZ_8_69Z8B_T (11) EP 1 816 908 B1 (12) EUROPEAN PATENT SPECIFICATION (4) Date of publication and mention of the grant of the patent: 19.02.14 Bulletin 14/08 (21) Application number: 084992.6 (22)

More information

INEA HYBRIDISATION PROTOCOLS 2011

INEA HYBRIDISATION PROTOCOLS 2011 INEA HYBRIDISATION PROTOCOLS 2011 Anton Ivancic Hybridisation of taro (Colocasia esculenta) Floral characteristics of taro Colocasia esculenta is an allogamous, protogynous species, for which the main

More information

Case Studies in Ecology and Evolution

Case Studies in Ecology and Evolution 3 Non-random mating, Inbreeding and Population Structure. Jewelweed, Impatiens capensis, is a common woodland flower in the Eastern US. You may have seen the swollen seed pods that explosively pop when

More information

Study of Genetic Divergence in Pea (Pisum sativum L.) based on Agro-Morphic Traits

Study of Genetic Divergence in Pea (Pisum sativum L.) based on Agro-Morphic Traits International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 6 Number 11 (2017) pp. 3816-3821 Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2017.611.448

More information

Chapter 1 INTRODUCTION

Chapter 1 INTRODUCTION Chapter 1 INTRODUCTION Bamboos with over 70 genera and 1200 species occur worldwide in natural forests, semi-exploited stands, and intensive plantations, covering an area of more than 14 million ha worldwide

More information

Nandana Nama Samvathsara Celebrations on Sunday April 1 st, 2012

Nandana Nama Samvathsara Celebrations on Sunday April 1 st, 2012 Namaskaara, President Vinayaka Sharma Lakshmi Naveen 2011-2012 Volume 4 Ugadi Nandana Naama Samvathsara Vice President Deepthi Bharadwaj Sheetal Rakesh R Shrinivas Secretary Seema Murthy Hemanth Kumar

More information

EFFECT OF POLLINATION TIME AND CROSSING RATIO ON SEED YIELD AND QUALITY OF BRINJAL HYBRID UNDER DHARWAD REGION OF KARNATAKA

EFFECT OF POLLINATION TIME AND CROSSING RATIO ON SEED YIELD AND QUALITY OF BRINJAL HYBRID UNDER DHARWAD REGION OF KARNATAKA Indian J. Agric. Res., 42 (1) : 7-12, 2008 EFFECT OF POLLINATION TIME AND CROSSING RATIO ON SEED YIELD AND QUALITY OF BRINJAL HYBRID UNDER DHARWAD REGION OF KARNATAKA Shivashankaragouda B. Patil, M.N.

More information

Class 10 Heredity and Evolution Gist of lesson

Class 10 Heredity and Evolution Gist of lesson Class 10 Heredity and Evolution Gist of lesson Genetics : Branch of science that deals with Heredity and variation. Heredity : It means the transmission of features / characters/ traits from one generation

More information

BENCHMARK 1 STUDY GUIDE SPRING 2017

BENCHMARK 1 STUDY GUIDE SPRING 2017 BENCHMARK 1 STUDY GUIDE SPRING 2017 Name: There will be semester one content on this benchmark as well. Study your final exam review guide from last semester. New Semester Material: (Chapter 10 Cell Growth

More information

Gene Flow Between Crops and Their Wild Progenitors

Gene Flow Between Crops and Their Wild Progenitors Gene Flow Between Crops and Their Wild Progenitors Roberto Papa Università Politecnica delle Marche, Ancona, Italy Paul Gepts University of California, Davis, California, U.S.A. INTRODUCTION Gene flow

More information

Correlation and Path Analysis for Yield and Quality Attributes in Sugarcane

Correlation and Path Analysis for Yield and Quality Attributes in Sugarcane IJSTE International Journal of Science Technology & Engineering Volume 3 Issue 02 August 2016 ISSN (online): 2349784X Correlation and Path Analysis for Yield and Quality Attributes in Swamy Gowda S. N.

More information

Melon Meiosis.

Melon Meiosis. Objective Students will read about the discovery of colchicine, which made seedless watermelon possible. Students will use modelling clay and beans to model meiosis and mitosis. Students will design imaginary

More information

Review of Plant Cytogenetics

Review of Plant Cytogenetics Review of Plant Cytogenetics Updated 2/13/06 Reading: Richards, A.J. and R.K. Dawe. 1998. Plant centromeres: structure and control. Current Op. Plant Biol. 1: 130-135. R.K. Dawe. 2005. Centromere renewal

More information

Ch 11.Introduction to Genetics.Biology.Landis

Ch 11.Introduction to Genetics.Biology.Landis Nom Section 11 1 The Work of Gregor Mendel (pages 263 266) This section describes how Gregor Mendel studied the inheritance of traits in garden peas and what his conclusions were. Introduction (page 263)

More information

Meiosis and Life Cycles - 1

Meiosis and Life Cycles - 1 Meiosis and Life Cycles - 1 We have just finished looking at the process of mitosis, a process that produces cells genetically identical to the original cell. Mitosis ensures that each cell of an organism

More information

X-Sheet 3 Cell Division: Mitosis and Meiosis

X-Sheet 3 Cell Division: Mitosis and Meiosis X-Sheet 3 Cell Division: Mitosis and Meiosis 13 Key Concepts In this session we will focus on summarising what you need to know about: Revise Mitosis (Grade 11), the process of meiosis, First Meiotic division,

More information

7.2: Natural Selection and Artificial Selection pg

7.2: Natural Selection and Artificial Selection pg 7.2: Natural Selection and Artificial Selection pg. 305-311 Key Terms: natural selection, selective pressure, fitness, artificial selection, biotechnology, and monoculture. Natural Selection is the process

More information

QTL mapping rolling, stomatal conductance and dimension traits of excised leaves in the Bala Azucena recombinant inbred population of rice

QTL mapping rolling, stomatal conductance and dimension traits of excised leaves in the Bala Azucena recombinant inbred population of rice Available online at www.sciencedirect.com Field Crops Research 106 (2008) 248 257 www.elsevier.com/locate/fcr QTL mapping rolling, stomatal conductance and dimension traits of excised leaves in the Bala

More information

VOCABULARY somatic cell autosome fertilization gamete sex chromosome diploid homologous chromosome sexual reproduction meiosis

VOCABULARY somatic cell autosome fertilization gamete sex chromosome diploid homologous chromosome sexual reproduction meiosis 6.1 CHROMOSOMES AND MEIOSIS Study Guide KEY CONCEPT Gametes have half the number of chromosomes that body cells have. VOCABULARY somatic cell autosome fertilization gamete sex chromosome diploid homologous

More information

INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS

INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS ORIGINAL: English DATE: October 30, 2008 INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS GENEVA E Associated Document to the General Introduction to the Examination of Distinctness, Uniformity

More information

RESPONSE FORM Infraspecific Taxon Protocol. Infraspecific Taxon: Resident Species: Requestor Name and Affiliation: ITP Completed by:

RESPONSE FORM Infraspecific Taxon Protocol. Infraspecific Taxon: Resident Species: Requestor Name and Affiliation: ITP Completed by: Infraspecific Taxon: Lantana camara UF-1013A-2A Resident Species: Lantana camara Requestor Name and Affiliation: Zhanao Deng, Environ Hort., GCREC, UF ITP Completed by: Deah Lieurance Date ITP started:

More information

Observing Patterns in Inherited Traits

Observing Patterns in Inherited Traits Observing Patterns in Inherited Traits Chapter 10 Before you go on Review the answers to the following questions to test your understanding of previous material. 1. Most organisms are diploid. What does

More information