Molecular evolution. Joe Felsenstein. GENOME 453, Autumn Molecular evolution p.1/49

Size: px

Start display at page:

Download "Molecular evolution. Joe Felsenstein. GENOME 453, Autumn Molecular evolution p.1/49"

Thomas West
5 years ago
Views:

1 Molecular evolution Joe Felsenstein GENOME 453, utumn 2009 Molecular evolution p.1/49

2 data example for phylogeny inference Five DN sequences, for some gene in an imaginary group of species whose names are lpha, Beta, Gamma, Delta, and Epsilon: site species lpha T G G C Beta C T C T C Gamma G G T C Delta G G G T Epsilon C T C G C Molecular evolution p.2/49

3 The tree we are evaluating lpha Delta Gamma Beta Epsilon Molecular evolution p.3/49

4 Steps in character 1 C C lpha Delta Gamma Beta Epsilon lpha Beta Gamma Delta Epsilon T G G C C T C T C G G T C G G G T C T C G C or C C lpha Delta Gamma Beta Epsilon Molecular evolution p.4/49

5 Steps in character 2 T G G T T lpha Delta Gamma Beta Epsilon lpha Beta Gamma Delta Epsilon T G G C C T C T C G G T C G G G T C T C G C or T G G T T lpha Delta Gamma Beta Epsilon or T G G T T lpha Delta Gamma Beta Epsilon Molecular evolution p.5/49

6 Steps in character 3 G G G C C lpha Delta Gamma Beta Epsilon lpha Beta Gamma Delta Epsilon T G G C C T C T C G G T C G G G T C T C G C G G G C C lpha Delta Gamma Beta Epsilon Molecular evolution p.6/49

7 Steps in character 4 T T lpha Delta Gamma Beta Epsilon lpha Beta Gamma Delta Epsilon T G G C C T C T C G G T C G G G T C T C G C or T T lpha Delta Gamma Beta Epsilon Molecular evolution p.7/49

8 Steps in character 5 G G G lpha Delta Gamma Beta Epsilon lpha Beta Gamma Delta Epsilon T G G C C T C T C G G T C G G G T C T C G C or G G G lpha Delta Gamma Beta Epsilon Molecular evolution p.8/49

9 Steps in character 6 lpha Beta Gamma Delta Epsilon T G G C C T C T C G G T C G G G T C T C G C C T C C C lpha Delta Gamma Beta Epsilon Molecular evolution p.9/49

10 Steps in all characters showing one of their possible placements lpha Delta Gamma Beta Epsilon Molecular evolution p.10/49

11 The most parsimonious tree with one possible placement of the changes Gamma Delta lpha Beta Epsilon Molecular evolution p.11/49

12 The same tree as an unrooted tree shown as an unrooted tree root can be anywhere changes can occur in either direction lpha Gamma Beta Delta Epsilon Molecular evolution p.12/49

13 Direction of change depends on where root is Placement of the root affects which way bases change but not how many changes there are lpha Gamma Delta G if root is here C T T G T C G C G T Beta 5 Epsilon Molecular evolution p.13/49

14 Changing the root changes the direction Placement of the root affects which way bases change but not how many changes there are lpha Gamma Beta G T G T C T 6 G T C G C Delta if root is here Epsilon Molecular evolution p.14/49

15 ll possible trees (15 in all) C D B E D B E C B C E D B D C E B C E D E B C D D B C E B C D E C B D E D B E C B D C E B C D E C B D E E B D C E C B D Molecular evolution p.15/49

16 Their best numbers of nucleotide substitutions C D D B B E E C 11 9 B C E B D C D E 11 B C 11 D E E B 11 B C C D D E B D E B D B C C E B D C B 9 E C 11 C E D E C 9 9 E D B D 10 C B 10 D E 8 D B E C 9 Molecular evolution p.16/49

17 The most parsimonious tree C D D B B E E C 11 9 B C E B D C D E 11 B C 11 D E E B 11 B C C D D E B D E B D B C C E B D C B 9 E C 11 C E D E C 9 9 E D B D 10 C B 10 D E 8 D B E C 9 Molecular evolution p.17/49

18 Distance matrix methods C Each possible tree (with branch lengths) predict pairwise distances F D B E B C D E F B C D E F Find the tree which comes closest to predicting the observed pairwise distances compare observed distances calculated from the data B C D E F B C D E F Molecular evolution p.18/49

19 n example Turbeville. J. McC., Schulz, J.R. and R.. Raff Deuterostome phylogeny and the sister group of the chordates: evidence from molecules and morphology. Molecular Biology and Evolution 11: Xenopus?TCCTGGTTGTCCTGCCGTG-CTTGCTTGTCTCGTTGCCTGCCG Sebastol??????????????????????G-CTTGCTTGTCTCGTTGCCTGCG Latimeri?TCCTGGTTGTCCTGCCGTG-CTTGCTTGTCTCGTTGCCTGCTG Squalus??????????????????????G-CTTGCTTGTCTCGTTGCCTGCTG Myxine??CCCTGGTTGTCCTGCCGCCG-CTTGCTTGTCTCGCTGCCTGCTG Petromyz???CCTGGTTGTCCTGCCGTG-CTTGCTTGTCTCGTTGCCTGCTG Branch???CCTGGTTGTCCTGCCGTGTCTTGCTTGTCTCGTTGCCTGCCG Styela??TCTGGTTGTCCTGCCGTGTGTTGCTTGTCTCGTTGCCTGCGG Herdman?TTCTGGTTGTCCTGCCGTGTGTTGCTTGTCTC-GTTGCCTGCGG Saccogl??CCTGGTTGTCCTGCCGTGTCTTGCTTGTCTCGTTGCCTGCTG Ophiophol??CCTGGTTGTCCTGCCGTGTCTTGCTTGTCTCGTTGCCTGCTG Strongyl??CCTGGTTGTCCTGCCGTGTCTTGCTTGTCTCGTTGCCTGCTG Placopec CCCTGGTTGTCCTGCCGTGTCTTGCTTGTCTCGTTGCCTGCTG Limicol?TTCTGGTTGTCCTGCCGTGTCTTGCTTGTCTCGTTGCCTGCTG Eurypelm?TCCTGGTTGTCCTGCCGTGTCTTGCTTGTCTCGTTGCCTGCTG Tenebrio?TCCCTGGTTGTCCTGCCGTGTCTTGCTTGTCTCGTTGCCTGCTG (and so on for 33 more pages) Molecular evolution p.19/49

20 Tree using parsimony (acorn worms) Saccogl Ophiophol (echinoderms) Strongyl Herdman (sea squirts) Styela Brachiostoma (amphioxus) Placopec (molluscs) Limicol Petromyz(lamprey) Eurypelm (insects) Tenebrio Latimeri (coelacanth) Squalus(dogfish) Sebastol(fish) Xenopus (frog) Myxine (hagfish) Molecular evolution p.20/49

21 Saccogl Myxine Tree using a distance method Herdman Styela Ophiophol Branch (echinoderms) (acorn worms) (sea squirts) (amphioxus) Strongyl Placopec Squalus Sebastol (molluscs) Latimeri Xenopus Petromyz Limicol Eurypelm Tenebrio (insects) (lamprey) (dogfish) (fish) (coelacanth) (frog) (hagfish) Molecular evolution p.21/49

22 Tree using a maximum likelihood method Herdman (sea squirts) (acorn worm) Styela Saccogl Branch (amphioxus) Ophiophol (lamprey) (echinoderms) Petromyz Strongyl Myxine (hagfish) Placopec (molluscs) Limicol Squalus (dogfish) Sebastol (teleost) Xenopus Latimeri (frog) (coelacanth) Eurypelm (insects) Tenebrio Molecular evolution p.22/49

23 The tree with images of the animals Placopecten (scallop) Strongylocentrotus (sea urchin) Saccoglossus (acorn worm) Molecular evolution p.23/49

24 The tree with images of the animals Branchiostoma (amphioxus) tunicate Myxine (hagfish) Molecular evolution p.24/49

25 The tree with images of the animals Petromyzon dogfish dogfish (lamprey) Molecular evolution p.25/49

26 The tree with images of the animals Sebastoles (lrockfish) Latimeria (coelacanth) Xenopus (clawed frog) Molecular evolution p.26/49

27 Blair and Hedges alternative tree (in Molecular Biology and Evolution, 2005.) Molecular evolution p.27/49

28 Molecular evolution (1963 on) Linus Pauling in 1963 Emile Zuckerkandl, more recently Molecular evolution p.28/49

29 The late Margaret Dayhoff Responsible for the first computer-produced molecular phylogeny (1966), the start of protein sequence databases (1965), the recognition of gene families (1960s-1970s) Molecular evolution p.29/49

30 Morris Goodman Using immunological methods with proteins, defined the human-chimp-gorilla clade (1962), later pioneered work on evolution of gene families, especially the globin family. Molecular evolution p.30/49

31 The late llan Wilson With Vincent Sarich, supported the human-chimp-gorilla clade. dvocated use of the molecular clock by which they dated the divergence of these species to 5 million years ago. Later (as we shall see) found the tree of human mitochondria, whose ancestor was mitochondrial Eve. Molecular evolution p.31/49

32 n example: who is most closely related to whales? from mrine-madsen, H. et al., 2003, Molecular Phylogenetics and Evolution Molecular evolution p.32/49

33 The tree of human ancestry Old world monkeys Orangutan Chimp Bonobo Humans Gorilla Gibbon New world monkeys Molecular evolution p.33/49

34 Just who are you calling an ape? Old world monkeys Orangutan Chimp Bonobo Humans Gorilla Gibbon New world monkeys Molecular evolution p.34/49

35 Just who are you calling an ape? Old world monkeys Orangutan Chimp Bonobo Humans Gorilla Gibbon New world monkeys Molecular evolution p.35/49

36 Molecular phylogenies Some examples of other important conclusions from molecular phylogenies: Using immunological distances, Morris Goodman (1962 on) and later Wilson and Sarich (1966) show that humans, gorilla, and chimps were a clade. Wilson and Sarich (in that work, 1967) date the divergence of humans to 5 million years. Charles Sibley and Jon hlquist (1984) use DN hybridization to argue for the clade humans-chimps. Carl Woese (1978) uses rrn trees to introduce evolution into microbiology, argue for the domain rchaea. Much progress on early radiation of angiosperms Protostome-deuterostome tree of metazoans (more or less) replaced by deuterostome-lophotrichozoa-ecdysozoa tree. Fungi closer to animals than either is to plants. Symbiotic origin of mitochondria and of chloroplasts verified. mphioxus diverged before split of tunicates from craniate chordates. Lots of horizontal gene transfer in prokaryotes, almost not a tree. Molecular evolution p.36/49

37 Different parts of hemoglobin genes lignment of hemoglobin ε loci of Human, Tarsier Exon 1 Exon 2 Exon 3 Intron 1 Intron 2 region bases differences % different upstream exon intron exon intron exon downstream Differences in exons position 1 10 position 2 5 position 3 33 Molecular evolution p.37/49

38 Higher Rates of Substitution for some proteins than others some sites within proteins than others (less in active sites, interior sites) some amino acid replacements than others (less changes to chemically more similar amino acids) silent changes than nonsilent ones in-between" DN than introns, introns than coding sequences transitions than transversions Molecular evolution p.38/49

39 Morris Goodman tabulation for β hemoglobin where sites change/100myr Heme contacts Nonheme contacts Salt bridges β-β ,3-DPG binding Nonsalt bridge α,β contacts Remaining interior Remaining exterior ll Molecular evolution p.39/49

40 PhyloHMM analysis of multiple genomes From a paper by Siepel and Haussler (Journal of Computational Biology, 2004) describing the machinery for finding conserved regions of multiple genomes. Molecular evolution p.40/49

41 Rates of change from neutral and selective mechanisms Neutral mutations fraction µ of all copies of a gene mutate. Of these 1 2N (equal to the initial frequency of the mutant) succeed in drifting to fixation for the mutant. There are in all 2N copies of the gene available to mutate. The resulting rate of substitution is µ 1 2N 2N = µ So the rate of substitution of neutral mutations is equal to the mutation rate (the mutation rate of neutral mutants, not the total mutation rate). Molecular evolution p.41/49

42 Change by neutral mutation end of a lineage which is the ancestry of a single copy of the gene: change is expected to be µ per generation gene copy ancestry Interestingly, the expected rate of change is the same no matter what the population size is (small populations make all copies more likely to become the same, but all are still expected to differ from their ancestors by this amount) time species boundary Molecular evolution p.42/49

43 Rates from neutral and selective mechanisms Selectively advantageous mutations fraction µ of copies of the gene mutate. There are in all 2N copies available. fraction 2s succeed in fixing. The resulting rate of substitution is µ 2N 2s = 4Nsµ Note that this is 4Ns times as high as for neutral mutants, if the mutation rate in both categories were equal (which it isn t). Molecular evolution p.43/49

44 Substitution of neutral and advantageous mutations Suppose that the population size is N = 1, 000, 000, and mutation rates are: dvantageous mutations Neutral mutations u a = 10 7 u n = 10 6 If the selection coefficient in favor of advantageous mutations is s = , the rates of substitution expected are: dvantageous mutations Neutral mutations (4Ns)u a = u n = 10 6 Molecular evolution p.44/49

45 The molecular clock (from Wilson, 1976) Molecular evolution p.45/49

46 not-quite-clocklike tree of Plethodon salamanders (Palmer et al., 2005, in Molecular Biology and Evolution) Molecular evolution p.46/49

47 Phylogeny and gene tree with a gene duplication phylogeny with a gene duplication event: Frog Human Monkey Squirrel a b a b a b species boundary gene duplication tree of genes Molecular evolution p.47/49

48 Phylogenies, gene trees, and gene duplication So when genes are all aligned with each other, their "gene tree" is: Frog Human Monkey Squirrel Human Monkey Squirrel a a a b b b These two subtrees should be identical Molecular evolution p.48/49

49 gene family Molecular evolution p.49/49

Inference of phylogenies, with some thoughts on statistics and geometry p.1/31

Inference of phylogenies, with some thoughts on statistics and geometry Joe Felsenstein University of Washington Inference of phylogenies, with some thoughts on statistics and geometry p.1/31 Darwin s