CLADOGRAMS & GENETIC PHYLOGENIES
|
|
- Myra Strickland
- 5 years ago
- Views:
Transcription
1 CLADOGRAMS & GENETIC PHYLOGENIES INTRODUCTION Taxonomists since Linnaeus have used relative similarities and differences to group species into a taxonomic hierarchy of genera, families, orders, etc. Darwin did not change the way species were classified, but he did change the interpretation of the taxonomic hierarchy. He considered species in the same genus to share a relatively recent common ancestral species, species in the same family to have a more distant common ancestor, and species in the same order to have a more distant common ancestor. The development of modern gene sequencing has led to a revolution in the way species are currently classified. Recall that DNA consists of a sequence of A, G, C and T bases that code for specific amino acids in a protein. For example, the following sequence of sixty nucleotide bases codes for the first twenty amino acids of beta-hemoglobin, a part of the protein that carries oxygen in human red blood cells: ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAAC Not only has the human genome been sequenced, but all or part of the genome of many other species has also been sequenced. These sequences can be accessed by anyone and searched using powerful search engines to find similar genes and sequences in other species. Similarities and differences in the sequence of bases of a particular gene are now used to classify species into taxonomic groups. Just as in traditional taxonomy, the similarities in a gene like beta hemoglobin are assumed to be due to inheritance from a common ancestral species with bata hemoglobin. Any differences are assumed to be due to mutations that can change one base into another, or add a base into a sequence, or delete a base from a sequence. It is assumed that the longer the time since a common ancestor of two species, the more time there has been to accumulate random mutations. For example, if two species differ in 5% of the bases in their beta hemoglobin gene, they share a more recent common ancestor than if they differ in 10% of their bases. Molecular biologists construct trees of similarities and differences between species that are termed cladograms. Cladograms are assumed to represent the phylogenetic (evolutionary) history of the species. Your textbook has examples and illustrations of cladograms. In this lab you will compare a part of the beta-hemoglobin gene of several species and construct a cladogram depicting the degree of similarity and difference between species. OBJECTIVES 1. Determine the similarities and differences between two nucleotide sequences. 2. Explain how evolutionary biologists interpret the similarities and differences between nucleotide sequences. 3. Construct a phylogenetic tree of several species using a set of nucleotide sequences. 4. Explain the assumptions upon which the phylogenetic tree is based.
2 PROCEDURE 1. Your instructor will provide you with a sheet of paper with the nucleotide sequences of a portion of the same gene (beta-hemoglobin) from several species. The sequence of each species is fifty nucleotides long. Note that nucleotides are arranged in groups of ten, with spaces separating each group. A - may appear in a sequence where a nucleotide has been deleted by mutation (or where an extra nucleotide has been inserted in another species. 2. Your instructor will assign each person or group one or more pairs of species to compare. 3. Use a pair of scissors to cut out each species sequence to form long strips of paper. Set the pair your assigned species nucleotide sequences next to each other so the first through fiftieth nucleotides of each species align. 4. Compare each pair of nucleotides to determine if they match or if they differ. Count the number of differences between the two species. Record this number in the table below and on the class table on the whiteboard at the front of the room. Chic Chim Dog Gorr Huma Mars Monk Mous Rat Chicken 0 Chimp 0 Dog 0 Gorilla 0 Human 0 Marsupial 0 Monkey 0 Mouse 0 Rat 0 5. Repeat this procedure for all pair of species you have been assigned. 6. When all of the information on the board has been recorded, transcribe the class results onto your table. You now have the information necessary to construct your phylogenetic tree. 7. Observe the pairs of nucleotide differences in the table. Find the pair with the least number of differences. 8. Place the names of these two species next to each other at the top of a sheet of paper. Draw a shallow V below the two species and write the number of differences between the species below the V. Your instructor will illustrate how this is done on the board. 9. Determine from the table the pair of species with the next fewest differences. Write the names of these two species at the top of the page and connect them with another, deeper V. If one of the species is already on the page, do not rewrite the name, but connect the existing species with the new species with the deeper V. 10. Continue this process until all of the species are connected together into one large cladogram. FOR THOUGHT AND DISCUSSION
3 1. How do evolutionary biologists account for the similarities and differences between the sequences of these species? 2. Does the cladogram seem to accurately reflect how the species are classified by taxonomists? Why or why not? 3. What are some of the assumptions that must be made if the cladogram is to be accepted as a depiction of the evolutionary history of these species?
4 Mouse Rat Human Chimp Gorilla Monkey Dog ATGGTGCACC TGACTGATGC TGAGAAGTCT GCTGTCTCTT GCC-TGTGGG ATGGTGCACC TAACTGATGC TGAGAAGGCT GCTGT-TAAT GCCCTGTGGG ATGGTGCATC TGACTCCTGA GGAGAAGTCT GCCGT-TACT GCCCTGTGGG ATGGTGCACC TGACTCCTGA GGAGAAGTCT GCCGT-TACT GCCCTGTGGG ATGGTGCACC TGACTCCTGA GGAGAAGTCT GCCGT-TACT GCCCTGTGGG ATGGTGCATC TGACTCCTGA GGAGAAGACT GCCGT-TACC ACCCTGTGGG ATGGTGCATT TTACTGCTGA GGAGAAGGCT GCTGT-TATT AGCCTGTGGG Marsupial ATGGTGCATC TGACTGCTGA AGAGAAGAGT CTTGTCT-CC GGCCTGTGGG Chicken ATGGTGCACT GGACTGCTGA GGAGAAG-CA GCTCATCACC GGCCTCTGGG
5 Chic Chim Dog Gorr Huma Mars Monk Mous Rat Chicken 0 Chimp 0 Dog 0 Gorilla 0 Human 0 Marsupial 0 Monkey 0 Mouse 0 Rat 0
The practice of naming and classifying organisms is called taxonomy.
Chapter 18 Key Idea: Biologists use taxonomic systems to organize their knowledge of organisms. These systems attempt to provide consistent ways to name and categorize organisms. The practice of naming
More informationConcept Modern Taxonomy reflects evolutionary history.
Concept 15.4 Modern Taxonomy reflects evolutionary history. What is Taxonomy: identification, naming, and classification of species. Common Names: can cause confusion - May refer to several species (ex.
More informationLecture 11 Friday, October 21, 2011
Lecture 11 Friday, October 21, 2011 Phylogenetic tree (phylogeny) Darwin and classification: In the Origin, Darwin said that descent from a common ancestral species could explain why the Linnaean system
More informationMacroevolution Part I: Phylogenies
Macroevolution Part I: Phylogenies Taxonomy Classification originated with Carolus Linnaeus in the 18 th century. Based on structural (outward and inward) similarities Hierarchal scheme, the largest most
More information8/23/2014. Phylogeny and the Tree of Life
Phylogeny and the Tree of Life Chapter 26 Objectives Explain the following characteristics of the Linnaean system of classification: a. binomial nomenclature b. hierarchical classification List the major
More informationInvestigation 3: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST
Investigation 3: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST Introduction Bioinformatics is a powerful tool which can be used to determine evolutionary relationships and
More informationOrganizing Life s Diversity
17 Organizing Life s Diversity section 2 Modern Classification Classification systems have changed over time as information has increased. What You ll Learn species concepts methods to reveal phylogeny
More informationBiology. Slide 1 of 24. End Show. Copyright Pearson Prentice Hall
Biology 1 of 24 18-2 Modern Evolutionary Classification 2 of 24 18-2 Modern Evolutionary Classification Evolutionary Classification Evolutionary Classification Phylogeny is the study of evolutionary relationships
More informationChapter 26 Phylogeny and the Tree of Life
Chapter 26 Phylogeny and the Tree of Life Chapter focus Shifting from the process of how evolution works to the pattern evolution produces over time. Phylogeny Phylon = tribe, geny = genesis or origin
More informationModern Evolutionary Classification. Section 18-2 pgs
Modern Evolutionary Classification Section 18-2 pgs 451-455 Modern Evolutionary Classification In a sense, organisms determine who belongs to their species by choosing with whom they will mate. Taxonomic
More informationFor Classroom Trial Testing
For Classroom Trial Testing Video Description Secrets of the Sequence, Show 141, Episode 2 From Slime to Sublime approximately 10 minutes viewing time While we are similar to our fellow man in size, shape,
More informationChapter 19: Taxonomy, Systematics, and Phylogeny
Chapter 19: Taxonomy, Systematics, and Phylogeny AP Curriculum Alignment Chapter 19 expands on the topics of phylogenies and cladograms, which are important to Big Idea 1. In order for students to understand
More informationCHAPTERS 24-25: Evidence for Evolution and Phylogeny
CHAPTERS 24-25: Evidence for Evolution and Phylogeny 1. For each of the following, indicate how it is used as evidence of evolution by natural selection or shown as an evolutionary trend: a. Paleontology
More informationHow should we organize the diversity of animal life?
How should we organize the diversity of animal life? The difference between Taxonomy Linneaus, and Cladistics Darwin What are phylogenies? How do we read them? How do we estimate them? Classification (Taxonomy)
More informationPhylogeny and systematics. Why are these disciplines important in evolutionary biology and how are they related to each other?
Phylogeny and systematics Why are these disciplines important in evolutionary biology and how are they related to each other? Phylogeny and systematics Phylogeny: the evolutionary history of a species
More informationChapter 17A. Table of Contents. Section 1 Categories of Biological Classification. Section 2 How Biologists Classify Organisms
Classification of Organisms Table of Contents Section 1 Categories of Biological Classification Section 1 Categories of Biological Classification Classification Section 1 Categories of Biological Classification
More information9/19/2012. Chapter 17 Organizing Life s Diversity. Early Systems of Classification
Section 1: The History of Classification Section 2: Modern Classification Section 3: Domains and Kingdoms Click on a lesson name to select. Early Systems of Classification Biologists use a system of classification
More informationOutline. Classification of Living Things
Outline Classification of Living Things Chapter 20 Mader: Biology 8th Ed. Taxonomy Binomial System Species Identification Classification Categories Phylogenetic Trees Tracing Phylogeny Cladistic Systematics
More informationChapter 26 Phylogeny and the Tree of Life
Chapter 26 Phylogeny and the Tree of Life Biologists estimate that there are about 5 to 100 million species of organisms living on Earth today. Evidence from morphological, biochemical, and gene sequence
More informationName: Class: Date: ID: A
Class: _ Date: _ Ch 17 Practice test 1. A segment of DNA that stores genetic information is called a(n) a. amino acid. b. gene. c. protein. d. intron. 2. In which of the following processes does change
More informationCHAPTER 26 PHYLOGENY AND THE TREE OF LIFE Connecting Classification to Phylogeny
CHAPTER 26 PHYLOGENY AND THE TREE OF LIFE Connecting Classification to Phylogeny To trace phylogeny or the evolutionary history of life, biologists use evidence from paleontology, molecular data, comparative
More informationSection 18-1 Finding Order in Diversity
Name Class Date Section 18-1 Finding Order in Diversity (pages 447-450) Key Concepts How are living things organized for study? What is binomial nomenclature? What is Linnaeus s system of classification?
More informationCladistics and Bioinformatics Questions 2013
AP Biology Name Cladistics and Bioinformatics Questions 2013 1. The following table shows the percentage similarity in sequences of nucleotides from a homologous gene derived from five different species
More informationChapter 17. Table of Contents. Objectives. Taxonomy. Classifying Organisms. Section 1 Biodiversity. Section 2 Systematics
Classification Table of Contents Objectives Relatebiodiversity to biological classification. Explainwhy naturalists replaced Aristotle s classification system. Identifythe main criterion that Linnaeus
More informationHuman Evolution Comparing Primates
Human Evolution Comparing Primates Background According to the theory of evolution, all species are are related and linked to a common ancestor. Species that are more closely related have common ancestor
More informationC3020 Molecular Evolution. Exercises #3: Phylogenetics
C3020 Molecular Evolution Exercises #3: Phylogenetics Consider the following sequences for five taxa 1-5 and the known outgroup O, which has the ancestral states (note that sequence 3 has changed from
More informationPhylogenies & Classifying species (AKA Cladistics & Taxonomy) What are phylogenies & cladograms? How do we read them? How do we estimate them?
Phylogenies & Classifying species (AKA Cladistics & Taxonomy) What are phylogenies & cladograms? How do we read them? How do we estimate them? Carolus Linneaus:Systema Naturae (1735) Swedish botanist &
More informationChapter 26: Phylogeny and the Tree of Life Phylogenies Show Evolutionary Relationships
Chapter 26: Phylogeny and the Tree of Life You Must Know The taxonomic categories and how they indicate relatedness. How systematics is used to develop phylogenetic trees. How to construct a phylogenetic
More informationPiecing It Together. 1) The envelope contains puzzle pieces for 5 vertebrate embryos in 3 different stages of
Piecing It Together 1) The envelope contains puzzle pieces for 5 vertebrate embryos in 3 different stages of development. Lay out the pieces so that you have matched up each animal name card with its 3
More informationWhat is the purpose of the Classifying System? To allow the accurate identification of a particular organism
What is the purpose of the Classifying System? To allow the accurate identification of a particular organism Taxonomy The practice of classifying organisms -Taxonomy was founded nearly 300 years ago by
More informationMolecular phylogeny - Using molecular sequences to infer evolutionary relationships. Tore Samuelsson Feb 2016
Molecular phylogeny - Using molecular sequences to infer evolutionary relationships Tore Samuelsson Feb 2016 Molecular phylogeny is being used in the identification and characterization of new pathogens,
More informationFig. 26.7a. Biodiversity. 1. Course Outline Outcomes Instructors Text Grading. 2. Course Syllabus. Fig. 26.7b Table
Fig. 26.7a Biodiversity 1. Course Outline Outcomes Instructors Text Grading 2. Course Syllabus Fig. 26.7b Table 26.2-1 1 Table 26.2-2 Outline: Systematics and the Phylogenetic Revolution I. Naming and
More informationBIOINFORMATICS LAB AP BIOLOGY
BIOINFORMATICS LAB AP BIOLOGY Bioinformatics is the science of collecting and analyzing complex biological data. Bioinformatics combines computer science, statistics and biology to allow scientists to
More information9.3 Classification. Lesson Objectives. Vocabulary. Introduction. Linnaean Classification
9.3 Classification Lesson Objectives Outline the Linnaean classification, and define binomial nomenclature. Describe phylogenetic classification, and explain how it differs from Linnaean classification.
More informationClassification, Phylogeny yand Evolutionary History
Classification, Phylogeny yand Evolutionary History The diversity of life is great. To communicate about it, there must be a scheme for organization. There are many species that would be difficult to organize
More informationCREATING PHYLOGENETIC TREES FROM DNA SEQUENCES
INTRODUCTION CREATING PHYLOGENETIC TREES FROM DNA SEQUENCES This worksheet complements the Click and Learn developed in conjunction with the 2011 Holiday Lectures on Science, Bones, Stones, and Genes:
More informationChapter 26. Phylogeny and the Tree of Life. Lecture Presentations by Nicole Tunbridge and Kathleen Fitzpatrick Pearson Education, Inc.
Chapter 26 Phylogeny and the Tree of Life Lecture Presentations by Nicole Tunbridge and Kathleen Fitzpatrick Investigating the Tree of Life Phylogeny is the evolutionary history of a species or group of
More informationPHYLOGENY AND SYSTEMATICS
AP BIOLOGY EVOLUTION/HEREDITY UNIT Unit 1 Part 11 Chapter 26 Activity #15 NAME DATE PERIOD PHYLOGENY AND SYSTEMATICS PHYLOGENY Evolutionary history of species or group of related species SYSTEMATICS Study
More informationClassification and Phylogeny
Classification and Phylogeny The diversity of life is great. To communicate about it, there must be a scheme for organization. There are many species that would be difficult to organize without a scheme
More informationEvolution. Changes over Time
Evolution Changes over Time TEKS Students will analyze and evaluate B. 7 C how natural selection produces change in populations, not individuals B. 7 E/F effects of genetic mechanisms and their relationship
More informationClassification and Phylogeny
Classification and Phylogeny The diversity it of life is great. To communicate about it, there must be a scheme for organization. There are many species that would be difficult to organize without a scheme
More informationBio 1B Lecture Outline (please print and bring along) Fall, 2007
Bio 1B Lecture Outline (please print and bring along) Fall, 2007 B.D. Mishler, Dept. of Integrative Biology 2-6810, bmishler@berkeley.edu Evolution lecture #5 -- Molecular genetics and molecular evolution
More informationChapter 26: Phylogeny and the Tree of Life
Chapter 26: Phylogeny and the Tree of Life 1. Key Concepts Pertaining to Phylogeny 2. Determining Phylogenies 3. Evolutionary History Revealed in Genomes 1. Key Concepts Pertaining to Phylogeny PHYLOGENY
More informationMolecular phylogeny How to infer phylogenetic trees using molecular sequences
Molecular phylogeny How to infer phylogenetic trees using molecular sequences ore Samuelsson Nov 2009 Applications of phylogenetic methods Reconstruction of evolutionary history / Resolving taxonomy issues
More informationUSING BLAST TO IDENTIFY PROTEINS THAT ARE EVOLUTIONARILY RELATED ACROSS SPECIES
USING BLAST TO IDENTIFY PROTEINS THAT ARE EVOLUTIONARILY RELATED ACROSS SPECIES HOW CAN BIOINFORMATICS BE USED AS A TOOL TO DETERMINE EVOLUTIONARY RELATIONSHPS AND TO BETTER UNDERSTAND PROTEIN HERITAGE?
More informationOpen a Word document to record answers to any italicized questions. You will the final document to me at
Molecular Evidence for Evolution Open a Word document to record answers to any italicized questions. You will email the final document to me at tchnsci@yahoo.com Pre Lab Activity: Genes code for amino
More informationMechanisms of Evolution Darwinian Evolution
Mechanisms of Evolution Darwinian Evolution Descent with modification by means of natural selection All life has descended from a common ancestor The mechanism of modification is natural selection Concept
More informationCharacteristics of Life
UNIT 2 BIODIVERSITY Chapter 4- Patterns of Life Biology 2201 Characteristics of Life All living things share some basic characteristics: 1) living things are organized systems made up of one or more cells
More informationMolecular phylogeny How to infer phylogenetic trees using molecular sequences
Molecular phylogeny How to infer phylogenetic trees using molecular sequences ore Samuelsson Nov 200 Applications of phylogenetic methods Reconstruction of evolutionary history / Resolving taxonomy issues
More information1/17/2012. Class Aves. Avian Systematics. Avian Systematics. Subclass Sauriurae
Systematics deals with evolutionary relationships among organisms. Allied with classification (or taxonomy). All birds are classified within the single Class Aves 2 Subclasses 4 Infraclasses Class Aves
More informationEmily Blanton Phylogeny Lab Report May 2009
Introduction It is suggested through scientific research that all living organisms are connected- that we all share a common ancestor and that, through time, we have all evolved from the same starting
More informationPhylogenetic Trees. How do the changes in gene sequences allow us to reconstruct the evolutionary relationships between related species?
Why? Phylogenetic Trees How do the changes in gene sequences allow us to reconstruct the evolutionary relationships between related species? The saying Don t judge a book by its cover. could be applied
More informationEvidence of EVOLUTION
Evidence of EVOLUTION Evolution: Genetic change in a population through time Charles Darwin On his journey around the world, Darwin found evidence of GRADUAL CHANGE (evolution) He cited evidences he found
More information"Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky
MOLECULAR PHYLOGENY "Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky EVOLUTION - theory that groups of organisms change over time so that descendeants differ structurally
More informationMETHODS FOR DETERMINING PHYLOGENY. In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task.
Chapter 12 (Strikberger) Molecular Phylogenies and Evolution METHODS FOR DETERMINING PHYLOGENY In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task. Modern
More informationUoN, CAS, DBSC BIOL102 lecture notes by: Dr. Mustafa A. Mansi. The Phylogenetic Systematics (Phylogeny and Systematics)
- Phylogeny? - Systematics? The Phylogenetic Systematics (Phylogeny and Systematics) - Phylogenetic systematics? Connection between phylogeny and classification. - Phylogenetic systematics informs the
More informationPHYLOGENY & THE TREE OF LIFE
PHYLOGENY & THE TREE OF LIFE PREFACE In this powerpoint we learn how biologists distinguish and categorize the millions of species on earth. Early we looked at the process of evolution here we look at
More informationBiology 2. Lecture Material. For. Macroevolution. Systematics
Biology 2 Macroevolution & Systematics 1 Biology 2 Lecture Material For Macroevolution & Systematics Biology 2 Macroevolution & Systematics 2 Microevolution: Biological Species: Two Patterns of Evolutionary
More informationHomework Assignment, Evolutionary Systems Biology, Spring Homework Part I: Phylogenetics:
Homework Assignment, Evolutionary Systems Biology, Spring 2009. Homework Part I: Phylogenetics: Introduction. The objective of this assignment is to understand the basics of phylogenetic relationships
More informationBioinformatics Exercises
Bioinformatics Exercises AP Biology Teachers Workshop Susan Cates, Ph.D. Evolution of Species Phylogenetic Trees show the relatedness of organisms Common Ancestor (Root of the tree) 1 Rooted vs. Unrooted
More informationBiologists use a system of classification to organize information about the diversity of living things.
Section 1: Biologists use a system of classification to organize information about the diversity of living things. K What I Know W What I Want to Find Out L What I Learned Essential Questions What are
More informationOrganizing Life on Earth
Organizing Life on Earth Inquire: Organizing Life on Earth Overview Scientists continually obtain new information that helps to understand the evolutionary history of life on Earth. Each group of organisms
More informationCLASSIFICATION AND EVOLUTION OF CAMINALCULES:
CLASSIFICATION AND EVOLUTION OF CAMINALCULES: One of the main goals of the lab is to illustrate the intimate connection between the classification of living species and their evolutionary relationships.
More informationThe Tree of Life. Chapter 17
The Tree of Life Chapter 17 1 17.1 Taxonomy The science of naming and classifying organisms 2000 years ago Aristotle Grouped plants and animals Based on structural similarities Greeks and Romans included
More informationCLASSIFICATION OF LIVING THINGS. Chapter 18
CLASSIFICATION OF LIVING THINGS Chapter 18 How many species are there? About 1.8 million species have been given scientific names Nearly 2/3 of which are insects 99% of all known animal species are smaller
More informationChapters 25 and 26. Searching for Homology. Phylogeny
Chapters 25 and 26 The Origin of Life as we know it. Phylogeny traces evolutionary history of taxa Systematics- analyzes relationships (modern and past) of organisms Figure 25.1 A gallery of fossils The
More informationCurriculum Links. AQA GCE Biology. AS level
Curriculum Links AQA GCE Biology Unit 2 BIOL2 The variety of living organisms 3.2.1 Living organisms vary and this variation is influenced by genetic and environmental factors Causes of variation 3.2.2
More informationReading for Lecture 13 Release v10
Reading for Lecture 13 Release v10 Christopher Lee November 15, 2011 Contents 1 Evolutionary Trees i 1.1 Evolution as a Markov Process...................................... ii 1.2 Rooted vs. Unrooted Trees........................................
More informationAlgorithms in Bioinformatics
Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri Distance Methods Character Methods
More information1. Construct and use dichotomous keys to identify organisms. 2. Define scientific name and the binomial system of nomenclature.
OBJECTIVE SHEET TAXONOMY 1. Construct and use dichotomous keys to identify organisms. 2. Define scientific name and the binomial system of nomenclature. 3. Name and describe the general characteristics
More informationPhylogeny & Systematics
Phylogeny & Systematics Phylogeny & Systematics An unexpected family tree. What are the evolutionary relationships among a human, a mushroom, and a tulip? Molecular systematics has revealed that despite
More informationSummary Finding Order in Diversity Modern Evolutionary Classification
( Is (.'I.isiifiuilimi Summary 18-1 Finding Order in Diversity There are millions of different species on Earth. To study this great diversity of organisms, biologists must give each organ ism a name.
More informationthebiotutor.com AS Biology Unit 2 Classification, Adaptation & Biodiversity
thebiotutor.com AS Biology Unit 2 Classification, Adaptation & Biodiversity 1 Classification and taxonomy Classification Phylogeny Taxonomy The process of sorting living things into groups. The study of
More informationChapter 7: Covalent Structure of Proteins. Voet & Voet: Pages ,
Chapter 7: Covalent Structure of Proteins Voet & Voet: Pages 163-164, 185-194 Slide 1 Structure & Function Function is best understood in terms of structure Four levels of structure that apply to proteins
More informationChapter 16: Reconstructing and Using Phylogenies
Chapter Review 1. Use the phylogenetic tree shown at the right to complete the following. a. Explain how many clades are indicated: Three: (1) chimpanzee/human, (2) chimpanzee/ human/gorilla, and (3)chimpanzee/human/
More informationCaminalcules Discovery Classifying Imaginary Animals by Analysis of Shared Characteristics
Caminalcules Discovery Classifying Imaginary Animals by Analysis of Shared Characteristics PURPOSE In this activity you will reinforce the concept of classification by grouping imaginary organisms with
More information10 Biodiversity Support. AQA Biology. Biodiversity. Specification reference. Learning objectives. Introduction. Background
Biodiversity Specification reference 3.4.5 3.4.6 3.4.7 Learning objectives After completing this worksheet you should be able to: recall the definition of a species and know how the binomial system is
More informationMicrobial Taxonomy and the Evolution of Diversity
19 Microbial Taxonomy and the Evolution of Diversity Copyright McGraw-Hill Global Education Holdings, LLC. Permission required for reproduction or display. 1 Taxonomy Introduction to Microbial Taxonomy
More informationEvidence of Evolution by Natural Selection. Evidence supporting evolution. Fossil record. Fossil record. Anatomical record.
Evidence of Evolution by Natural Selection Dodo bird Evidence supporting evolution Fossil record transition species Anatomical record homologous & vestigial structures embryology & development Molecular
More informationTree of Life iological Sequence nalysis Chapter http://tolweb.org/tree/ Phylogenetic Prediction ll organisms on Earth have a common ancestor. ll species are related. The relationship is called a phylogeny
More informationIntroduction to characters and parsimony analysis
Introduction to characters and parsimony analysis Genetic Relationships Genetic relationships exist between individuals within populations These include ancestordescendent relationships and more indirect
More informationUnit 5: Taxonomy. KEY CONCEPT Organisms can be classified based on physical similarities.
KEY CONCEPT Organisms can be classified based on physical similarities. Linnaeus developed the scientific naming system still used today. Taxonomy is the science of naming and classifying organisms. White
More informationChapter 19 Organizing Information About Species: Taxonomy and Cladistics
Chapter 19 Organizing Information About Species: Taxonomy and Cladistics An unexpected family tree. What are the evolutionary relationships among a human, a mushroom, and a tulip? Molecular systematics
More informationStation A: #3. If two organisms belong to the same order, they must also belong to the same
Station A: #1. Write your mnemonic for remembering the order of the taxa (from the broadest, most generic taxon to the most specific). Out to the side of each, write the name of each taxon the mnemonic
More informationWhat is Phylogenetics
What is Phylogenetics Phylogenetics is the area of research concerned with finding the genetic connections and relationships between species. The basic idea is to compare specific characters (features)
More informationAnatomy of a tree. clade is group of organisms with a shared ancestor. a monophyletic group shares a single common ancestor = tapirs-rhinos-horses
Anatomy of a tree outgroup: an early branching relative of the interest groups sister taxa: taxa derived from the same recent ancestor polytomy: >2 taxa emerge from a node Anatomy of a tree clade is group
More informationEVOLUTIONARY DISTANCES
EVOLUTIONARY DISTANCES FROM STRINGS TO TREES Luca Bortolussi 1 1 Dipartimento di Matematica ed Informatica Università degli studi di Trieste luca@dmi.units.it Trieste, 14 th November 2007 OUTLINE 1 STRINGS:
More informationDichotomous Key for Genus Problematica
Evolution Summative Assessment DO NOT WRITE ON TEST 1. Industrial melanism describes the change in moth color from pale to dark after pollution from factories resulting in coating tree trunks with a layer
More informationPhylogenetic Trees. Phylogenetic Trees Five. Phylogeny: Inference Tool. Phylogeny Terminology. Picture of Last Quagga. Importance of Phylogeny 5.
Five Sami Khuri Department of Computer Science San José State University San José, California, USA sami.khuri@sjsu.edu v Distance Methods v Character Methods v Molecular Clock v UPGMA v Maximum Parsimony
More informationPrimate Diversity & Human Evolution (Outline)
Primate Diversity & Human Evolution (Outline) 1. Source of evidence for evolutionary relatedness of organisms 2. Primates features and function 3. Classification of primates and representative species
More informationName Block Date Final Exam Study Guide
Name Block Date Final Exam Study Guide Unit 7: DNA & Protein Synthesis List the 3 building blocks of DNA (sugar, phosphate, base) Use base-pairing rules to replicate a strand of DNA (A-T, C-G). Transcribe
More informationAlgorithmic Methods Well-defined methodology Tree reconstruction those that are well-defined enough to be carried out by a computer. Felsenstein 2004,
Tracing the Evolution of Numerical Phylogenetics: History, Philosophy, and Significance Adam W. Ferguson Phylogenetic Systematics 26 January 2009 Inferring Phylogenies Historical endeavor Darwin- 1837
More informationCHAPTER 10 Taxonomy and Phylogeny of Animals
CHAPTER 10 Taxonomy and Phylogeny of Animals 10-1 10-2 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Linnaeus and Taxonomy More than 1.5 million species of
More informationUnit 8 Classification
Unit 8 Classification Chapter 18: Classification www.pearsonrealize.com 18.1 Finding Order in Diversity (510) 18.2 Modern Evolutionary Classification (516) 18.3 Building the Tree of Life (523) Name: Teacher:
More informationR.S. Kittrell Biology Wk 10. Date Skill Plan
Day of Wee k Date Skill Plan M 11/10/14 Unit 3:DNA, Protein Synthesis, Genetics and Biotechnology ALL Obj. #= 3.2.2 Unit? = # 1,3, 'I will' = # 6,7 Obj = Individual Focus Opening: Discuss Ghost in your
More informationPlant Names and Classification
Plant Names and Classification Science of Taxonomy Identification (necessary!!) Classification (order out of chaos!) Nomenclature (why not use common names?) Reasons NOT to use common names Theophrastus
More informationC.DARWIN ( )
C.DARWIN (1809-1882) LAMARCK Each evolutionary lineage has evolved, transforming itself, from a ancestor appeared by spontaneous generation DARWIN All organisms are historically interconnected. Their relationships
More informationPhylogeny and the Tree of Life
Chapter 26 Phylogeny and the Tree of Life Lecture Outline Overview: Investigating the Tree of Life Evolutionary biology is about both process and pattern. o The processes of evolution are natural selection
More informationPhylogenetic Tree Reconstruction
I519 Introduction to Bioinformatics, 2011 Phylogenetic Tree Reconstruction Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Evolution theory Speciation Evolution of new organisms is driven
More informationPHYLOGENY WHAT IS EVOLUTION? 1/22/2018. Change must occur in a population via allele
PHYLOGENY EXERCISE 1 AND 2 WHAT IS EVOLUTION? The theory that all living organisms on earth are related and have a common ancestor. These organism have changed over time and are continuing to change. Changes
More information