CLADOGRAMS & GENETIC PHYLOGENIES

Size: px
Start display at page:

Download "CLADOGRAMS & GENETIC PHYLOGENIES"

Transcription

1 CLADOGRAMS & GENETIC PHYLOGENIES INTRODUCTION Taxonomists since Linnaeus have used relative similarities and differences to group species into a taxonomic hierarchy of genera, families, orders, etc. Darwin did not change the way species were classified, but he did change the interpretation of the taxonomic hierarchy. He considered species in the same genus to share a relatively recent common ancestral species, species in the same family to have a more distant common ancestor, and species in the same order to have a more distant common ancestor. The development of modern gene sequencing has led to a revolution in the way species are currently classified. Recall that DNA consists of a sequence of A, G, C and T bases that code for specific amino acids in a protein. For example, the following sequence of sixty nucleotide bases codes for the first twenty amino acids of beta-hemoglobin, a part of the protein that carries oxygen in human red blood cells: ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAAC Not only has the human genome been sequenced, but all or part of the genome of many other species has also been sequenced. These sequences can be accessed by anyone and searched using powerful search engines to find similar genes and sequences in other species. Similarities and differences in the sequence of bases of a particular gene are now used to classify species into taxonomic groups. Just as in traditional taxonomy, the similarities in a gene like beta hemoglobin are assumed to be due to inheritance from a common ancestral species with bata hemoglobin. Any differences are assumed to be due to mutations that can change one base into another, or add a base into a sequence, or delete a base from a sequence. It is assumed that the longer the time since a common ancestor of two species, the more time there has been to accumulate random mutations. For example, if two species differ in 5% of the bases in their beta hemoglobin gene, they share a more recent common ancestor than if they differ in 10% of their bases. Molecular biologists construct trees of similarities and differences between species that are termed cladograms. Cladograms are assumed to represent the phylogenetic (evolutionary) history of the species. Your textbook has examples and illustrations of cladograms. In this lab you will compare a part of the beta-hemoglobin gene of several species and construct a cladogram depicting the degree of similarity and difference between species. OBJECTIVES 1. Determine the similarities and differences between two nucleotide sequences. 2. Explain how evolutionary biologists interpret the similarities and differences between nucleotide sequences. 3. Construct a phylogenetic tree of several species using a set of nucleotide sequences. 4. Explain the assumptions upon which the phylogenetic tree is based.

2 PROCEDURE 1. Your instructor will provide you with a sheet of paper with the nucleotide sequences of a portion of the same gene (beta-hemoglobin) from several species. The sequence of each species is fifty nucleotides long. Note that nucleotides are arranged in groups of ten, with spaces separating each group. A - may appear in a sequence where a nucleotide has been deleted by mutation (or where an extra nucleotide has been inserted in another species. 2. Your instructor will assign each person or group one or more pairs of species to compare. 3. Use a pair of scissors to cut out each species sequence to form long strips of paper. Set the pair your assigned species nucleotide sequences next to each other so the first through fiftieth nucleotides of each species align. 4. Compare each pair of nucleotides to determine if they match or if they differ. Count the number of differences between the two species. Record this number in the table below and on the class table on the whiteboard at the front of the room. Chic Chim Dog Gorr Huma Mars Monk Mous Rat Chicken 0 Chimp 0 Dog 0 Gorilla 0 Human 0 Marsupial 0 Monkey 0 Mouse 0 Rat 0 5. Repeat this procedure for all pair of species you have been assigned. 6. When all of the information on the board has been recorded, transcribe the class results onto your table. You now have the information necessary to construct your phylogenetic tree. 7. Observe the pairs of nucleotide differences in the table. Find the pair with the least number of differences. 8. Place the names of these two species next to each other at the top of a sheet of paper. Draw a shallow V below the two species and write the number of differences between the species below the V. Your instructor will illustrate how this is done on the board. 9. Determine from the table the pair of species with the next fewest differences. Write the names of these two species at the top of the page and connect them with another, deeper V. If one of the species is already on the page, do not rewrite the name, but connect the existing species with the new species with the deeper V. 10. Continue this process until all of the species are connected together into one large cladogram. FOR THOUGHT AND DISCUSSION

3 1. How do evolutionary biologists account for the similarities and differences between the sequences of these species? 2. Does the cladogram seem to accurately reflect how the species are classified by taxonomists? Why or why not? 3. What are some of the assumptions that must be made if the cladogram is to be accepted as a depiction of the evolutionary history of these species?

4 Mouse Rat Human Chimp Gorilla Monkey Dog ATGGTGCACC TGACTGATGC TGAGAAGTCT GCTGTCTCTT GCC-TGTGGG ATGGTGCACC TAACTGATGC TGAGAAGGCT GCTGT-TAAT GCCCTGTGGG ATGGTGCATC TGACTCCTGA GGAGAAGTCT GCCGT-TACT GCCCTGTGGG ATGGTGCACC TGACTCCTGA GGAGAAGTCT GCCGT-TACT GCCCTGTGGG ATGGTGCACC TGACTCCTGA GGAGAAGTCT GCCGT-TACT GCCCTGTGGG ATGGTGCATC TGACTCCTGA GGAGAAGACT GCCGT-TACC ACCCTGTGGG ATGGTGCATT TTACTGCTGA GGAGAAGGCT GCTGT-TATT AGCCTGTGGG Marsupial ATGGTGCATC TGACTGCTGA AGAGAAGAGT CTTGTCT-CC GGCCTGTGGG Chicken ATGGTGCACT GGACTGCTGA GGAGAAG-CA GCTCATCACC GGCCTCTGGG

5 Chic Chim Dog Gorr Huma Mars Monk Mous Rat Chicken 0 Chimp 0 Dog 0 Gorilla 0 Human 0 Marsupial 0 Monkey 0 Mouse 0 Rat 0

The practice of naming and classifying organisms is called taxonomy.

The practice of naming and classifying organisms is called taxonomy. Chapter 18 Key Idea: Biologists use taxonomic systems to organize their knowledge of organisms. These systems attempt to provide consistent ways to name and categorize organisms. The practice of naming

More information

Concept Modern Taxonomy reflects evolutionary history.

Concept Modern Taxonomy reflects evolutionary history. Concept 15.4 Modern Taxonomy reflects evolutionary history. What is Taxonomy: identification, naming, and classification of species. Common Names: can cause confusion - May refer to several species (ex.

More information

Lecture 11 Friday, October 21, 2011

Lecture 11 Friday, October 21, 2011 Lecture 11 Friday, October 21, 2011 Phylogenetic tree (phylogeny) Darwin and classification: In the Origin, Darwin said that descent from a common ancestral species could explain why the Linnaean system

More information

Macroevolution Part I: Phylogenies

Macroevolution Part I: Phylogenies Macroevolution Part I: Phylogenies Taxonomy Classification originated with Carolus Linnaeus in the 18 th century. Based on structural (outward and inward) similarities Hierarchal scheme, the largest most

More information

8/23/2014. Phylogeny and the Tree of Life

8/23/2014. Phylogeny and the Tree of Life Phylogeny and the Tree of Life Chapter 26 Objectives Explain the following characteristics of the Linnaean system of classification: a. binomial nomenclature b. hierarchical classification List the major

More information

Investigation 3: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST

Investigation 3: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST Investigation 3: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST Introduction Bioinformatics is a powerful tool which can be used to determine evolutionary relationships and

More information

Organizing Life s Diversity

Organizing Life s Diversity 17 Organizing Life s Diversity section 2 Modern Classification Classification systems have changed over time as information has increased. What You ll Learn species concepts methods to reveal phylogeny

More information

Biology. Slide 1 of 24. End Show. Copyright Pearson Prentice Hall

Biology. Slide 1 of 24. End Show. Copyright Pearson Prentice Hall Biology 1 of 24 18-2 Modern Evolutionary Classification 2 of 24 18-2 Modern Evolutionary Classification Evolutionary Classification Evolutionary Classification Phylogeny is the study of evolutionary relationships

More information

Chapter 26 Phylogeny and the Tree of Life

Chapter 26 Phylogeny and the Tree of Life Chapter 26 Phylogeny and the Tree of Life Chapter focus Shifting from the process of how evolution works to the pattern evolution produces over time. Phylogeny Phylon = tribe, geny = genesis or origin

More information

Modern Evolutionary Classification. Section 18-2 pgs

Modern Evolutionary Classification. Section 18-2 pgs Modern Evolutionary Classification Section 18-2 pgs 451-455 Modern Evolutionary Classification In a sense, organisms determine who belongs to their species by choosing with whom they will mate. Taxonomic

More information

For Classroom Trial Testing

For Classroom Trial Testing For Classroom Trial Testing Video Description Secrets of the Sequence, Show 141, Episode 2 From Slime to Sublime approximately 10 minutes viewing time While we are similar to our fellow man in size, shape,

More information

Chapter 19: Taxonomy, Systematics, and Phylogeny

Chapter 19: Taxonomy, Systematics, and Phylogeny Chapter 19: Taxonomy, Systematics, and Phylogeny AP Curriculum Alignment Chapter 19 expands on the topics of phylogenies and cladograms, which are important to Big Idea 1. In order for students to understand

More information

CHAPTERS 24-25: Evidence for Evolution and Phylogeny

CHAPTERS 24-25: Evidence for Evolution and Phylogeny CHAPTERS 24-25: Evidence for Evolution and Phylogeny 1. For each of the following, indicate how it is used as evidence of evolution by natural selection or shown as an evolutionary trend: a. Paleontology

More information

How should we organize the diversity of animal life?

How should we organize the diversity of animal life? How should we organize the diversity of animal life? The difference between Taxonomy Linneaus, and Cladistics Darwin What are phylogenies? How do we read them? How do we estimate them? Classification (Taxonomy)

More information

Phylogeny and systematics. Why are these disciplines important in evolutionary biology and how are they related to each other?

Phylogeny and systematics. Why are these disciplines important in evolutionary biology and how are they related to each other? Phylogeny and systematics Why are these disciplines important in evolutionary biology and how are they related to each other? Phylogeny and systematics Phylogeny: the evolutionary history of a species

More information

Chapter 17A. Table of Contents. Section 1 Categories of Biological Classification. Section 2 How Biologists Classify Organisms

Chapter 17A. Table of Contents. Section 1 Categories of Biological Classification. Section 2 How Biologists Classify Organisms Classification of Organisms Table of Contents Section 1 Categories of Biological Classification Section 1 Categories of Biological Classification Classification Section 1 Categories of Biological Classification

More information

9/19/2012. Chapter 17 Organizing Life s Diversity. Early Systems of Classification

9/19/2012. Chapter 17 Organizing Life s Diversity. Early Systems of Classification Section 1: The History of Classification Section 2: Modern Classification Section 3: Domains and Kingdoms Click on a lesson name to select. Early Systems of Classification Biologists use a system of classification

More information

Outline. Classification of Living Things

Outline. Classification of Living Things Outline Classification of Living Things Chapter 20 Mader: Biology 8th Ed. Taxonomy Binomial System Species Identification Classification Categories Phylogenetic Trees Tracing Phylogeny Cladistic Systematics

More information

Chapter 26 Phylogeny and the Tree of Life

Chapter 26 Phylogeny and the Tree of Life Chapter 26 Phylogeny and the Tree of Life Biologists estimate that there are about 5 to 100 million species of organisms living on Earth today. Evidence from morphological, biochemical, and gene sequence

More information

Name: Class: Date: ID: A

Name: Class: Date: ID: A Class: _ Date: _ Ch 17 Practice test 1. A segment of DNA that stores genetic information is called a(n) a. amino acid. b. gene. c. protein. d. intron. 2. In which of the following processes does change

More information

CHAPTER 26 PHYLOGENY AND THE TREE OF LIFE Connecting Classification to Phylogeny

CHAPTER 26 PHYLOGENY AND THE TREE OF LIFE Connecting Classification to Phylogeny CHAPTER 26 PHYLOGENY AND THE TREE OF LIFE Connecting Classification to Phylogeny To trace phylogeny or the evolutionary history of life, biologists use evidence from paleontology, molecular data, comparative

More information

Section 18-1 Finding Order in Diversity

Section 18-1 Finding Order in Diversity Name Class Date Section 18-1 Finding Order in Diversity (pages 447-450) Key Concepts How are living things organized for study? What is binomial nomenclature? What is Linnaeus s system of classification?

More information

Cladistics and Bioinformatics Questions 2013

Cladistics and Bioinformatics Questions 2013 AP Biology Name Cladistics and Bioinformatics Questions 2013 1. The following table shows the percentage similarity in sequences of nucleotides from a homologous gene derived from five different species

More information

Chapter 17. Table of Contents. Objectives. Taxonomy. Classifying Organisms. Section 1 Biodiversity. Section 2 Systematics

Chapter 17. Table of Contents. Objectives. Taxonomy. Classifying Organisms. Section 1 Biodiversity. Section 2 Systematics Classification Table of Contents Objectives Relatebiodiversity to biological classification. Explainwhy naturalists replaced Aristotle s classification system. Identifythe main criterion that Linnaeus

More information

Human Evolution Comparing Primates

Human Evolution Comparing Primates Human Evolution Comparing Primates Background According to the theory of evolution, all species are are related and linked to a common ancestor. Species that are more closely related have common ancestor

More information

C3020 Molecular Evolution. Exercises #3: Phylogenetics

C3020 Molecular Evolution. Exercises #3: Phylogenetics C3020 Molecular Evolution Exercises #3: Phylogenetics Consider the following sequences for five taxa 1-5 and the known outgroup O, which has the ancestral states (note that sequence 3 has changed from

More information

Phylogenies & Classifying species (AKA Cladistics & Taxonomy) What are phylogenies & cladograms? How do we read them? How do we estimate them?

Phylogenies & Classifying species (AKA Cladistics & Taxonomy) What are phylogenies & cladograms? How do we read them? How do we estimate them? Phylogenies & Classifying species (AKA Cladistics & Taxonomy) What are phylogenies & cladograms? How do we read them? How do we estimate them? Carolus Linneaus:Systema Naturae (1735) Swedish botanist &

More information

Chapter 26: Phylogeny and the Tree of Life Phylogenies Show Evolutionary Relationships

Chapter 26: Phylogeny and the Tree of Life Phylogenies Show Evolutionary Relationships Chapter 26: Phylogeny and the Tree of Life You Must Know The taxonomic categories and how they indicate relatedness. How systematics is used to develop phylogenetic trees. How to construct a phylogenetic

More information

Piecing It Together. 1) The envelope contains puzzle pieces for 5 vertebrate embryos in 3 different stages of

Piecing It Together. 1) The envelope contains puzzle pieces for 5 vertebrate embryos in 3 different stages of Piecing It Together 1) The envelope contains puzzle pieces for 5 vertebrate embryos in 3 different stages of development. Lay out the pieces so that you have matched up each animal name card with its 3

More information

What is the purpose of the Classifying System? To allow the accurate identification of a particular organism

What is the purpose of the Classifying System? To allow the accurate identification of a particular organism What is the purpose of the Classifying System? To allow the accurate identification of a particular organism Taxonomy The practice of classifying organisms -Taxonomy was founded nearly 300 years ago by

More information

Molecular phylogeny - Using molecular sequences to infer evolutionary relationships. Tore Samuelsson Feb 2016

Molecular phylogeny - Using molecular sequences to infer evolutionary relationships. Tore Samuelsson Feb 2016 Molecular phylogeny - Using molecular sequences to infer evolutionary relationships Tore Samuelsson Feb 2016 Molecular phylogeny is being used in the identification and characterization of new pathogens,

More information

Fig. 26.7a. Biodiversity. 1. Course Outline Outcomes Instructors Text Grading. 2. Course Syllabus. Fig. 26.7b Table

Fig. 26.7a. Biodiversity. 1. Course Outline Outcomes Instructors Text Grading. 2. Course Syllabus. Fig. 26.7b Table Fig. 26.7a Biodiversity 1. Course Outline Outcomes Instructors Text Grading 2. Course Syllabus Fig. 26.7b Table 26.2-1 1 Table 26.2-2 Outline: Systematics and the Phylogenetic Revolution I. Naming and

More information

BIOINFORMATICS LAB AP BIOLOGY

BIOINFORMATICS LAB AP BIOLOGY BIOINFORMATICS LAB AP BIOLOGY Bioinformatics is the science of collecting and analyzing complex biological data. Bioinformatics combines computer science, statistics and biology to allow scientists to

More information

9.3 Classification. Lesson Objectives. Vocabulary. Introduction. Linnaean Classification

9.3 Classification. Lesson Objectives. Vocabulary. Introduction. Linnaean Classification 9.3 Classification Lesson Objectives Outline the Linnaean classification, and define binomial nomenclature. Describe phylogenetic classification, and explain how it differs from Linnaean classification.

More information

Classification, Phylogeny yand Evolutionary History

Classification, Phylogeny yand Evolutionary History Classification, Phylogeny yand Evolutionary History The diversity of life is great. To communicate about it, there must be a scheme for organization. There are many species that would be difficult to organize

More information

CREATING PHYLOGENETIC TREES FROM DNA SEQUENCES

CREATING PHYLOGENETIC TREES FROM DNA SEQUENCES INTRODUCTION CREATING PHYLOGENETIC TREES FROM DNA SEQUENCES This worksheet complements the Click and Learn developed in conjunction with the 2011 Holiday Lectures on Science, Bones, Stones, and Genes:

More information

Chapter 26. Phylogeny and the Tree of Life. Lecture Presentations by Nicole Tunbridge and Kathleen Fitzpatrick Pearson Education, Inc.

Chapter 26. Phylogeny and the Tree of Life. Lecture Presentations by Nicole Tunbridge and Kathleen Fitzpatrick Pearson Education, Inc. Chapter 26 Phylogeny and the Tree of Life Lecture Presentations by Nicole Tunbridge and Kathleen Fitzpatrick Investigating the Tree of Life Phylogeny is the evolutionary history of a species or group of

More information

PHYLOGENY AND SYSTEMATICS

PHYLOGENY AND SYSTEMATICS AP BIOLOGY EVOLUTION/HEREDITY UNIT Unit 1 Part 11 Chapter 26 Activity #15 NAME DATE PERIOD PHYLOGENY AND SYSTEMATICS PHYLOGENY Evolutionary history of species or group of related species SYSTEMATICS Study

More information

Classification and Phylogeny

Classification and Phylogeny Classification and Phylogeny The diversity of life is great. To communicate about it, there must be a scheme for organization. There are many species that would be difficult to organize without a scheme

More information

Evolution. Changes over Time

Evolution. Changes over Time Evolution Changes over Time TEKS Students will analyze and evaluate B. 7 C how natural selection produces change in populations, not individuals B. 7 E/F effects of genetic mechanisms and their relationship

More information

Classification and Phylogeny

Classification and Phylogeny Classification and Phylogeny The diversity it of life is great. To communicate about it, there must be a scheme for organization. There are many species that would be difficult to organize without a scheme

More information

Bio 1B Lecture Outline (please print and bring along) Fall, 2007

Bio 1B Lecture Outline (please print and bring along) Fall, 2007 Bio 1B Lecture Outline (please print and bring along) Fall, 2007 B.D. Mishler, Dept. of Integrative Biology 2-6810, bmishler@berkeley.edu Evolution lecture #5 -- Molecular genetics and molecular evolution

More information

Chapter 26: Phylogeny and the Tree of Life

Chapter 26: Phylogeny and the Tree of Life Chapter 26: Phylogeny and the Tree of Life 1. Key Concepts Pertaining to Phylogeny 2. Determining Phylogenies 3. Evolutionary History Revealed in Genomes 1. Key Concepts Pertaining to Phylogeny PHYLOGENY

More information

Molecular phylogeny How to infer phylogenetic trees using molecular sequences

Molecular phylogeny How to infer phylogenetic trees using molecular sequences Molecular phylogeny How to infer phylogenetic trees using molecular sequences ore Samuelsson Nov 2009 Applications of phylogenetic methods Reconstruction of evolutionary history / Resolving taxonomy issues

More information

USING BLAST TO IDENTIFY PROTEINS THAT ARE EVOLUTIONARILY RELATED ACROSS SPECIES

USING BLAST TO IDENTIFY PROTEINS THAT ARE EVOLUTIONARILY RELATED ACROSS SPECIES USING BLAST TO IDENTIFY PROTEINS THAT ARE EVOLUTIONARILY RELATED ACROSS SPECIES HOW CAN BIOINFORMATICS BE USED AS A TOOL TO DETERMINE EVOLUTIONARY RELATIONSHPS AND TO BETTER UNDERSTAND PROTEIN HERITAGE?

More information

Open a Word document to record answers to any italicized questions. You will the final document to me at

Open a Word document to record answers to any italicized questions. You will  the final document to me at Molecular Evidence for Evolution Open a Word document to record answers to any italicized questions. You will email the final document to me at tchnsci@yahoo.com Pre Lab Activity: Genes code for amino

More information

Mechanisms of Evolution Darwinian Evolution

Mechanisms of Evolution Darwinian Evolution Mechanisms of Evolution Darwinian Evolution Descent with modification by means of natural selection All life has descended from a common ancestor The mechanism of modification is natural selection Concept

More information

Characteristics of Life

Characteristics of Life UNIT 2 BIODIVERSITY Chapter 4- Patterns of Life Biology 2201 Characteristics of Life All living things share some basic characteristics: 1) living things are organized systems made up of one or more cells

More information

Molecular phylogeny How to infer phylogenetic trees using molecular sequences

Molecular phylogeny How to infer phylogenetic trees using molecular sequences Molecular phylogeny How to infer phylogenetic trees using molecular sequences ore Samuelsson Nov 200 Applications of phylogenetic methods Reconstruction of evolutionary history / Resolving taxonomy issues

More information

1/17/2012. Class Aves. Avian Systematics. Avian Systematics. Subclass Sauriurae

1/17/2012. Class Aves. Avian Systematics. Avian Systematics. Subclass Sauriurae Systematics deals with evolutionary relationships among organisms. Allied with classification (or taxonomy). All birds are classified within the single Class Aves 2 Subclasses 4 Infraclasses Class Aves

More information

Emily Blanton Phylogeny Lab Report May 2009

Emily Blanton Phylogeny Lab Report May 2009 Introduction It is suggested through scientific research that all living organisms are connected- that we all share a common ancestor and that, through time, we have all evolved from the same starting

More information

Phylogenetic Trees. How do the changes in gene sequences allow us to reconstruct the evolutionary relationships between related species?

Phylogenetic Trees. How do the changes in gene sequences allow us to reconstruct the evolutionary relationships between related species? Why? Phylogenetic Trees How do the changes in gene sequences allow us to reconstruct the evolutionary relationships between related species? The saying Don t judge a book by its cover. could be applied

More information

Evidence of EVOLUTION

Evidence of EVOLUTION Evidence of EVOLUTION Evolution: Genetic change in a population through time Charles Darwin On his journey around the world, Darwin found evidence of GRADUAL CHANGE (evolution) He cited evidences he found

More information

"Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky

Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky MOLECULAR PHYLOGENY "Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky EVOLUTION - theory that groups of organisms change over time so that descendeants differ structurally

More information

METHODS FOR DETERMINING PHYLOGENY. In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task.

METHODS FOR DETERMINING PHYLOGENY. In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task. Chapter 12 (Strikberger) Molecular Phylogenies and Evolution METHODS FOR DETERMINING PHYLOGENY In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task. Modern

More information

UoN, CAS, DBSC BIOL102 lecture notes by: Dr. Mustafa A. Mansi. The Phylogenetic Systematics (Phylogeny and Systematics)

UoN, CAS, DBSC BIOL102 lecture notes by: Dr. Mustafa A. Mansi. The Phylogenetic Systematics (Phylogeny and Systematics) - Phylogeny? - Systematics? The Phylogenetic Systematics (Phylogeny and Systematics) - Phylogenetic systematics? Connection between phylogeny and classification. - Phylogenetic systematics informs the

More information

PHYLOGENY & THE TREE OF LIFE

PHYLOGENY & THE TREE OF LIFE PHYLOGENY & THE TREE OF LIFE PREFACE In this powerpoint we learn how biologists distinguish and categorize the millions of species on earth. Early we looked at the process of evolution here we look at

More information

Biology 2. Lecture Material. For. Macroevolution. Systematics

Biology 2. Lecture Material. For. Macroevolution. Systematics Biology 2 Macroevolution & Systematics 1 Biology 2 Lecture Material For Macroevolution & Systematics Biology 2 Macroevolution & Systematics 2 Microevolution: Biological Species: Two Patterns of Evolutionary

More information

Homework Assignment, Evolutionary Systems Biology, Spring Homework Part I: Phylogenetics:

Homework Assignment, Evolutionary Systems Biology, Spring Homework Part I: Phylogenetics: Homework Assignment, Evolutionary Systems Biology, Spring 2009. Homework Part I: Phylogenetics: Introduction. The objective of this assignment is to understand the basics of phylogenetic relationships

More information

Bioinformatics Exercises

Bioinformatics Exercises Bioinformatics Exercises AP Biology Teachers Workshop Susan Cates, Ph.D. Evolution of Species Phylogenetic Trees show the relatedness of organisms Common Ancestor (Root of the tree) 1 Rooted vs. Unrooted

More information

Biologists use a system of classification to organize information about the diversity of living things.

Biologists use a system of classification to organize information about the diversity of living things. Section 1: Biologists use a system of classification to organize information about the diversity of living things. K What I Know W What I Want to Find Out L What I Learned Essential Questions What are

More information

Organizing Life on Earth

Organizing Life on Earth Organizing Life on Earth Inquire: Organizing Life on Earth Overview Scientists continually obtain new information that helps to understand the evolutionary history of life on Earth. Each group of organisms

More information

CLASSIFICATION AND EVOLUTION OF CAMINALCULES:

CLASSIFICATION AND EVOLUTION OF CAMINALCULES: CLASSIFICATION AND EVOLUTION OF CAMINALCULES: One of the main goals of the lab is to illustrate the intimate connection between the classification of living species and their evolutionary relationships.

More information

The Tree of Life. Chapter 17

The Tree of Life. Chapter 17 The Tree of Life Chapter 17 1 17.1 Taxonomy The science of naming and classifying organisms 2000 years ago Aristotle Grouped plants and animals Based on structural similarities Greeks and Romans included

More information

CLASSIFICATION OF LIVING THINGS. Chapter 18

CLASSIFICATION OF LIVING THINGS. Chapter 18 CLASSIFICATION OF LIVING THINGS Chapter 18 How many species are there? About 1.8 million species have been given scientific names Nearly 2/3 of which are insects 99% of all known animal species are smaller

More information

Chapters 25 and 26. Searching for Homology. Phylogeny

Chapters 25 and 26. Searching for Homology. Phylogeny Chapters 25 and 26 The Origin of Life as we know it. Phylogeny traces evolutionary history of taxa Systematics- analyzes relationships (modern and past) of organisms Figure 25.1 A gallery of fossils The

More information

Curriculum Links. AQA GCE Biology. AS level

Curriculum Links. AQA GCE Biology. AS level Curriculum Links AQA GCE Biology Unit 2 BIOL2 The variety of living organisms 3.2.1 Living organisms vary and this variation is influenced by genetic and environmental factors Causes of variation 3.2.2

More information

Reading for Lecture 13 Release v10

Reading for Lecture 13 Release v10 Reading for Lecture 13 Release v10 Christopher Lee November 15, 2011 Contents 1 Evolutionary Trees i 1.1 Evolution as a Markov Process...................................... ii 1.2 Rooted vs. Unrooted Trees........................................

More information

Algorithms in Bioinformatics

Algorithms in Bioinformatics Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri Distance Methods Character Methods

More information

1. Construct and use dichotomous keys to identify organisms. 2. Define scientific name and the binomial system of nomenclature.

1. Construct and use dichotomous keys to identify organisms. 2. Define scientific name and the binomial system of nomenclature. OBJECTIVE SHEET TAXONOMY 1. Construct and use dichotomous keys to identify organisms. 2. Define scientific name and the binomial system of nomenclature. 3. Name and describe the general characteristics

More information

Phylogeny & Systematics

Phylogeny & Systematics Phylogeny & Systematics Phylogeny & Systematics An unexpected family tree. What are the evolutionary relationships among a human, a mushroom, and a tulip? Molecular systematics has revealed that despite

More information

Summary Finding Order in Diversity Modern Evolutionary Classification

Summary Finding Order in Diversity Modern Evolutionary Classification ( Is (.'I.isiifiuilimi Summary 18-1 Finding Order in Diversity There are millions of different species on Earth. To study this great diversity of organisms, biologists must give each organ ism a name.

More information

thebiotutor.com AS Biology Unit 2 Classification, Adaptation & Biodiversity

thebiotutor.com AS Biology Unit 2 Classification, Adaptation & Biodiversity thebiotutor.com AS Biology Unit 2 Classification, Adaptation & Biodiversity 1 Classification and taxonomy Classification Phylogeny Taxonomy The process of sorting living things into groups. The study of

More information

Chapter 7: Covalent Structure of Proteins. Voet & Voet: Pages ,

Chapter 7: Covalent Structure of Proteins. Voet & Voet: Pages , Chapter 7: Covalent Structure of Proteins Voet & Voet: Pages 163-164, 185-194 Slide 1 Structure & Function Function is best understood in terms of structure Four levels of structure that apply to proteins

More information

Chapter 16: Reconstructing and Using Phylogenies

Chapter 16: Reconstructing and Using Phylogenies Chapter Review 1. Use the phylogenetic tree shown at the right to complete the following. a. Explain how many clades are indicated: Three: (1) chimpanzee/human, (2) chimpanzee/ human/gorilla, and (3)chimpanzee/human/

More information

Caminalcules Discovery Classifying Imaginary Animals by Analysis of Shared Characteristics

Caminalcules Discovery Classifying Imaginary Animals by Analysis of Shared Characteristics Caminalcules Discovery Classifying Imaginary Animals by Analysis of Shared Characteristics PURPOSE In this activity you will reinforce the concept of classification by grouping imaginary organisms with

More information

10 Biodiversity Support. AQA Biology. Biodiversity. Specification reference. Learning objectives. Introduction. Background

10 Biodiversity Support. AQA Biology. Biodiversity. Specification reference. Learning objectives. Introduction. Background Biodiversity Specification reference 3.4.5 3.4.6 3.4.7 Learning objectives After completing this worksheet you should be able to: recall the definition of a species and know how the binomial system is

More information

Microbial Taxonomy and the Evolution of Diversity

Microbial Taxonomy and the Evolution of Diversity 19 Microbial Taxonomy and the Evolution of Diversity Copyright McGraw-Hill Global Education Holdings, LLC. Permission required for reproduction or display. 1 Taxonomy Introduction to Microbial Taxonomy

More information

Evidence of Evolution by Natural Selection. Evidence supporting evolution. Fossil record. Fossil record. Anatomical record.

Evidence of Evolution by Natural Selection. Evidence supporting evolution. Fossil record. Fossil record. Anatomical record. Evidence of Evolution by Natural Selection Dodo bird Evidence supporting evolution Fossil record transition species Anatomical record homologous & vestigial structures embryology & development Molecular

More information

Tree of Life iological Sequence nalysis Chapter http://tolweb.org/tree/ Phylogenetic Prediction ll organisms on Earth have a common ancestor. ll species are related. The relationship is called a phylogeny

More information

Introduction to characters and parsimony analysis

Introduction to characters and parsimony analysis Introduction to characters and parsimony analysis Genetic Relationships Genetic relationships exist between individuals within populations These include ancestordescendent relationships and more indirect

More information

Unit 5: Taxonomy. KEY CONCEPT Organisms can be classified based on physical similarities.

Unit 5: Taxonomy. KEY CONCEPT Organisms can be classified based on physical similarities. KEY CONCEPT Organisms can be classified based on physical similarities. Linnaeus developed the scientific naming system still used today. Taxonomy is the science of naming and classifying organisms. White

More information

Chapter 19 Organizing Information About Species: Taxonomy and Cladistics

Chapter 19 Organizing Information About Species: Taxonomy and Cladistics Chapter 19 Organizing Information About Species: Taxonomy and Cladistics An unexpected family tree. What are the evolutionary relationships among a human, a mushroom, and a tulip? Molecular systematics

More information

Station A: #3. If two organisms belong to the same order, they must also belong to the same

Station A: #3. If two organisms belong to the same order, they must also belong to the same Station A: #1. Write your mnemonic for remembering the order of the taxa (from the broadest, most generic taxon to the most specific). Out to the side of each, write the name of each taxon the mnemonic

More information

What is Phylogenetics

What is Phylogenetics What is Phylogenetics Phylogenetics is the area of research concerned with finding the genetic connections and relationships between species. The basic idea is to compare specific characters (features)

More information

Anatomy of a tree. clade is group of organisms with a shared ancestor. a monophyletic group shares a single common ancestor = tapirs-rhinos-horses

Anatomy of a tree. clade is group of organisms with a shared ancestor. a monophyletic group shares a single common ancestor = tapirs-rhinos-horses Anatomy of a tree outgroup: an early branching relative of the interest groups sister taxa: taxa derived from the same recent ancestor polytomy: >2 taxa emerge from a node Anatomy of a tree clade is group

More information

EVOLUTIONARY DISTANCES

EVOLUTIONARY DISTANCES EVOLUTIONARY DISTANCES FROM STRINGS TO TREES Luca Bortolussi 1 1 Dipartimento di Matematica ed Informatica Università degli studi di Trieste luca@dmi.units.it Trieste, 14 th November 2007 OUTLINE 1 STRINGS:

More information

Dichotomous Key for Genus Problematica

Dichotomous Key for Genus Problematica Evolution Summative Assessment DO NOT WRITE ON TEST 1. Industrial melanism describes the change in moth color from pale to dark after pollution from factories resulting in coating tree trunks with a layer

More information

Phylogenetic Trees. Phylogenetic Trees Five. Phylogeny: Inference Tool. Phylogeny Terminology. Picture of Last Quagga. Importance of Phylogeny 5.

Phylogenetic Trees. Phylogenetic Trees Five. Phylogeny: Inference Tool. Phylogeny Terminology. Picture of Last Quagga. Importance of Phylogeny 5. Five Sami Khuri Department of Computer Science San José State University San José, California, USA sami.khuri@sjsu.edu v Distance Methods v Character Methods v Molecular Clock v UPGMA v Maximum Parsimony

More information

Primate Diversity & Human Evolution (Outline)

Primate Diversity & Human Evolution (Outline) Primate Diversity & Human Evolution (Outline) 1. Source of evidence for evolutionary relatedness of organisms 2. Primates features and function 3. Classification of primates and representative species

More information

Name Block Date Final Exam Study Guide

Name Block Date Final Exam Study Guide Name Block Date Final Exam Study Guide Unit 7: DNA & Protein Synthesis List the 3 building blocks of DNA (sugar, phosphate, base) Use base-pairing rules to replicate a strand of DNA (A-T, C-G). Transcribe

More information

Algorithmic Methods Well-defined methodology Tree reconstruction those that are well-defined enough to be carried out by a computer. Felsenstein 2004,

Algorithmic Methods Well-defined methodology Tree reconstruction those that are well-defined enough to be carried out by a computer. Felsenstein 2004, Tracing the Evolution of Numerical Phylogenetics: History, Philosophy, and Significance Adam W. Ferguson Phylogenetic Systematics 26 January 2009 Inferring Phylogenies Historical endeavor Darwin- 1837

More information

CHAPTER 10 Taxonomy and Phylogeny of Animals

CHAPTER 10 Taxonomy and Phylogeny of Animals CHAPTER 10 Taxonomy and Phylogeny of Animals 10-1 10-2 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Linnaeus and Taxonomy More than 1.5 million species of

More information

Unit 8 Classification

Unit 8 Classification Unit 8 Classification Chapter 18: Classification www.pearsonrealize.com 18.1 Finding Order in Diversity (510) 18.2 Modern Evolutionary Classification (516) 18.3 Building the Tree of Life (523) Name: Teacher:

More information

R.S. Kittrell Biology Wk 10. Date Skill Plan

R.S. Kittrell Biology Wk 10. Date Skill Plan Day of Wee k Date Skill Plan M 11/10/14 Unit 3:DNA, Protein Synthesis, Genetics and Biotechnology ALL Obj. #= 3.2.2 Unit? = # 1,3, 'I will' = # 6,7 Obj = Individual Focus Opening: Discuss Ghost in your

More information

Plant Names and Classification

Plant Names and Classification Plant Names and Classification Science of Taxonomy Identification (necessary!!) Classification (order out of chaos!) Nomenclature (why not use common names?) Reasons NOT to use common names Theophrastus

More information

C.DARWIN ( )

C.DARWIN ( ) C.DARWIN (1809-1882) LAMARCK Each evolutionary lineage has evolved, transforming itself, from a ancestor appeared by spontaneous generation DARWIN All organisms are historically interconnected. Their relationships

More information

Phylogeny and the Tree of Life

Phylogeny and the Tree of Life Chapter 26 Phylogeny and the Tree of Life Lecture Outline Overview: Investigating the Tree of Life Evolutionary biology is about both process and pattern. o The processes of evolution are natural selection

More information

Phylogenetic Tree Reconstruction

Phylogenetic Tree Reconstruction I519 Introduction to Bioinformatics, 2011 Phylogenetic Tree Reconstruction Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Evolution theory Speciation Evolution of new organisms is driven

More information

PHYLOGENY WHAT IS EVOLUTION? 1/22/2018. Change must occur in a population via allele

PHYLOGENY WHAT IS EVOLUTION? 1/22/2018. Change must occur in a population via allele PHYLOGENY EXERCISE 1 AND 2 WHAT IS EVOLUTION? The theory that all living organisms on earth are related and have a common ancestor. These organism have changed over time and are continuing to change. Changes

More information