Practice Problems 6. a) Why is there such a big difference between the length of the HMG CoA gene found on chromosome 5 and the length of the mrna?

Transcription

1 Life Sciences 1a Practice Probems 6 1. HMG CoA Reductase is an enzyme invoved in the biosynthesis of choestero. The protein and mrna sequences were identified before the genomic sequence, and it was determined that the mrna is 4471 nuceotides ong, and encodes a protein of 888 amino acids. During the human genome project, the genomic sequence for HMG CoA Reductase was found on chromosome 5 spread out over 24,826 nuceotides. a) Why is there such a big difference between the ength of the HMG CoA gene found on chromosome 5 and the ength of the mrna? b) If a 24,826 nuceotides encoded a protein, how ong woud it be? c) Based on your understanding of the nuceic acid tripet code, how many nuceotides of mrna sequence are necessary to encode a protein of 888 amino acids? d) Is there a disparity between your answer to C and the the ength of HMG CoA Reductase mrna? If so, pease expain a resoution to this difference. e) In the bakers yeast, S. cerevisiae, it has been found that the mrna and the genomic sequence for HMG CoA Reductase are the exact same ength. What does this information te you about how this gene is organized in yeast?

2 The Genetic Code: 2. During transation, does the peptide extend in the C-termina or N-termina direction? 3. In one of the first experiments to decipher the genetic code, Marsha Nirenberg synthesized a strand of poy(u) mrna (that is, a strand that reads 5 UUU UUU 3 ). Nirenberg then added the synthesized mrna to ce extracts that were capabe of transation. a) What poypeptide(s) woud you expect to find from the transation of this strand? Expain.

3 4. In a simiar experiment, Gobind Khorana synthesized an mrna strand that was composed of repeating units of 5 -UAC-3. He then transated the mrna using a technique simiar to Nirenberg. a) What poypeptide(s) woud you expect to find from the transation of this strand? (hint: assume the mrna was synthesized in such a way that the first base coud not be estabished). Expain. b) Woud you expect to see mixtures of amino acids in any of the transated peptides? Why or why not? Khorana aso attempted to transate mrnas composed of four base repeats. ne mrna he attempted to transate, 5 -GUAA-3, resuted in the formation of ony triand di-peptides. c) Why didn t any protein onger than a tripeptide resut? Expain. 5. Which of the foowing amino acids woud Ie-tRNA synthetase have the most difficuty discriminating against? Why? H H H H Phenyaanine Leucine Vaine Asparagine

4 6. Beow is the DNA sequence of a gene invoved in eucine biosynthesis in E. coi TAGTGTATTGACATGATAGAAGCACTCTACTATATTCTCAATAGGTCCACGGGTCCACCG 5 -ATCACATAACTGTACTATCTTCGTGAGATGATATAAGAGTTATCCAGGTGCCCAGGTGGC AATATGACTCACATCGTTCGCTTTATCGGTCTACTACTACTAAACGCATCTTCTTTGCGCGGT TTATACTGAGTGTAGCAAGCGAAATAGCCAGATGATGATGATTTGCGTAGAAGAAACGCGCCA AGACGAGTGAGCGGCATCCAGCATTAACCCACAGCCGCCACTTCCGCTGGCGGCATTTTAAA-3 TCTGCTCACTCGCCGTAGGTCGTAATTGGGTGTCGGCGGTCAAGGCGACCGCCGTAAAATTT-5 a) Pease write the first 18 bases of the mrna that woud be transcribed, 5 to 3. b) What wi be the first five amino acids of the protein derived from the mrna (pease denote N and C ends of the peptide and give your answer in both the three etter code and singe etter code) c) What wi be the ast five amino acids of the protein derived from the mrna (pease denote N and C ends of the peptide and give your answer in both the three etter code and singe etter code)? d) What is the ength of this protein (in amino acids)? e) For each of the foowing nuceotide changes, pease determine their effects on the codon, amino acid specified, and on the resuting protein (truncation, singe amino acid change, radicay different protein, or no change). Mutation Exampe: C75 deetion T74 deetion G76 A76 A124 T124 C81 T81 C100 nothing G175 A175 Change in Codon Change in Amino Acid Effect on Protein ATC ATG Ie Met Radicay different protein

5 1. HMG CoA Reductase a) There are introns in the HMG CoA gene. b) It woud be much onger than it actuay is amino acids (1 remaining nuceotide). c) 2664 nuceotides not incuding the stop codon. If they incude the stop codon (2667) it is fine. It is aso okay if they add three for the start codon (2670) and say this methionine is sometimes ceaved off. d) Yes, there is a disparity. The start site of transcription is not the same as the start site for transation. The termination of transation is aso not the same as the termination of transcription. e) This tes you that the coding region of this gene in yeast does not have any introns. 2. The poypeptide extends by adding amino acids onto the C-termina, so in the C-termina direction. 3. a) The codon UUU encodes phenyaanine, so one woud expect a poypeptide composed of entirey of phenyaanine this is exacty what Nirenberg saw. Since a the bases are identica, frames are not of any concern 4. a) You woud expect to find poy(tyrosine), poy(threonine), and poy(eucine), for their respective codons of UAC, ACU, and CUA. b) No, you woud not; since the tempates repeat every 3-bases, there is no change in codons within the reading frame. Thus, you woud not expect to see any heteropeptides formed c) The GUAA repeat shifts transation between 4 different codons: GUA, AGU, AAG, and UAA. GUA encodes for vaine, AGU for serine, and AAG for Lys. However, UAA is a stop codon; therefore, regardess of which frame transation began, a stop codon was aways reached within four codons. Thus, the ongest possibe transated peptide was a tripeptide. 5. Vaine and eucine since they are of a simiar size and have simiar chemica properties (both have aky sidechains made of carbon and hydrogen atoms). 6. Leucine biosynthesis in E. coi a) 5 -AGGUCCACGGGUCCACCG-3 b) N-Met-Thr-His-Ie-Va-C N-MTHIV-C

6 c) N-Ser-Gy-Ie-Gn-His-C N-SGIQH-C d) 28 e) Beow Mutation Change in Codon Change in Amino Acid Effect on Protein Exampe: C75 deetion AUC AUG Ie Met Radicay different protein T74 deetion AUC ACG Ie Thr Radicay different protein G76 A76 GUU AUU Va Ie Singe amino acid change A124 T124 AGA UGA Arg stop truncation C81 T81 CGC CGU Arg Arg, none No change C100 deetion CTA UAA Leu stop truncation G175 A175 No codon None-not in coding region No change