Practice Problems 6. a) Why is there such a big difference between the length of the HMG CoA gene found on chromosome 5 and the length of the mrna?
|
|
- Phillip Griffin
- 6 years ago
- Views:
Transcription
1 Life Sciences 1a Practice Probems 6 1. HMG CoA Reductase is an enzyme invoved in the biosynthesis of choestero. The protein and mrna sequences were identified before the genomic sequence, and it was determined that the mrna is 4471 nuceotides ong, and encodes a protein of 888 amino acids. During the human genome project, the genomic sequence for HMG CoA Reductase was found on chromosome 5 spread out over 24,826 nuceotides. a) Why is there such a big difference between the ength of the HMG CoA gene found on chromosome 5 and the ength of the mrna? b) If a 24,826 nuceotides encoded a protein, how ong woud it be? c) Based on your understanding of the nuceic acid tripet code, how many nuceotides of mrna sequence are necessary to encode a protein of 888 amino acids? d) Is there a disparity between your answer to C and the the ength of HMG CoA Reductase mrna? If so, pease expain a resoution to this difference. e) In the bakers yeast, S. cerevisiae, it has been found that the mrna and the genomic sequence for HMG CoA Reductase are the exact same ength. What does this information te you about how this gene is organized in yeast?
2 The Genetic Code: 2. During transation, does the peptide extend in the C-termina or N-termina direction? 3. In one of the first experiments to decipher the genetic code, Marsha Nirenberg synthesized a strand of poy(u) mrna (that is, a strand that reads 5 UUU UUU 3 ). Nirenberg then added the synthesized mrna to ce extracts that were capabe of transation. a) What poypeptide(s) woud you expect to find from the transation of this strand? Expain.
3 4. In a simiar experiment, Gobind Khorana synthesized an mrna strand that was composed of repeating units of 5 -UAC-3. He then transated the mrna using a technique simiar to Nirenberg. a) What poypeptide(s) woud you expect to find from the transation of this strand? (hint: assume the mrna was synthesized in such a way that the first base coud not be estabished). Expain. b) Woud you expect to see mixtures of amino acids in any of the transated peptides? Why or why not? Khorana aso attempted to transate mrnas composed of four base repeats. ne mrna he attempted to transate, 5 -GUAA-3, resuted in the formation of ony triand di-peptides. c) Why didn t any protein onger than a tripeptide resut? Expain. 5. Which of the foowing amino acids woud Ie-tRNA synthetase have the most difficuty discriminating against? Why? H H H H Phenyaanine Leucine Vaine Asparagine
4 6. Beow is the DNA sequence of a gene invoved in eucine biosynthesis in E. coi TAGTGTATTGACATGATAGAAGCACTCTACTATATTCTCAATAGGTCCACGGGTCCACCG 5 -ATCACATAACTGTACTATCTTCGTGAGATGATATAAGAGTTATCCAGGTGCCCAGGTGGC AATATGACTCACATCGTTCGCTTTATCGGTCTACTACTACTAAACGCATCTTCTTTGCGCGGT TTATACTGAGTGTAGCAAGCGAAATAGCCAGATGATGATGATTTGCGTAGAAGAAACGCGCCA AGACGAGTGAGCGGCATCCAGCATTAACCCACAGCCGCCACTTCCGCTGGCGGCATTTTAAA-3 TCTGCTCACTCGCCGTAGGTCGTAATTGGGTGTCGGCGGTCAAGGCGACCGCCGTAAAATTT-5 a) Pease write the first 18 bases of the mrna that woud be transcribed, 5 to 3. b) What wi be the first five amino acids of the protein derived from the mrna (pease denote N and C ends of the peptide and give your answer in both the three etter code and singe etter code) c) What wi be the ast five amino acids of the protein derived from the mrna (pease denote N and C ends of the peptide and give your answer in both the three etter code and singe etter code)? d) What is the ength of this protein (in amino acids)? e) For each of the foowing nuceotide changes, pease determine their effects on the codon, amino acid specified, and on the resuting protein (truncation, singe amino acid change, radicay different protein, or no change). Mutation Exampe: C75 deetion T74 deetion G76 A76 A124 T124 C81 T81 C100 nothing G175 A175 Change in Codon Change in Amino Acid Effect on Protein ATC ATG Ie Met Radicay different protein
5 1. HMG CoA Reductase a) There are introns in the HMG CoA gene. b) It woud be much onger than it actuay is amino acids (1 remaining nuceotide). c) 2664 nuceotides not incuding the stop codon. If they incude the stop codon (2667) it is fine. It is aso okay if they add three for the start codon (2670) and say this methionine is sometimes ceaved off. d) Yes, there is a disparity. The start site of transcription is not the same as the start site for transation. The termination of transation is aso not the same as the termination of transcription. e) This tes you that the coding region of this gene in yeast does not have any introns. 2. The poypeptide extends by adding amino acids onto the C-termina, so in the C-termina direction. 3. a) The codon UUU encodes phenyaanine, so one woud expect a poypeptide composed of entirey of phenyaanine this is exacty what Nirenberg saw. Since a the bases are identica, frames are not of any concern 4. a) You woud expect to find poy(tyrosine), poy(threonine), and poy(eucine), for their respective codons of UAC, ACU, and CUA. b) No, you woud not; since the tempates repeat every 3-bases, there is no change in codons within the reading frame. Thus, you woud not expect to see any heteropeptides formed c) The GUAA repeat shifts transation between 4 different codons: GUA, AGU, AAG, and UAA. GUA encodes for vaine, AGU for serine, and AAG for Lys. However, UAA is a stop codon; therefore, regardess of which frame transation began, a stop codon was aways reached within four codons. Thus, the ongest possibe transated peptide was a tripeptide. 5. Vaine and eucine since they are of a simiar size and have simiar chemica properties (both have aky sidechains made of carbon and hydrogen atoms). 6. Leucine biosynthesis in E. coi a) 5 -AGGUCCACGGGUCCACCG-3 b) N-Met-Thr-His-Ie-Va-C N-MTHIV-C
6 c) N-Ser-Gy-Ie-Gn-His-C N-SGIQH-C d) 28 e) Beow Mutation Change in Codon Change in Amino Acid Effect on Protein Exampe: C75 deetion AUC AUG Ie Met Radicay different protein T74 deetion AUC ACG Ie Thr Radicay different protein G76 A76 GUU AUU Va Ie Singe amino acid change A124 T124 AGA UGA Arg stop truncation C81 T81 CGC CGU Arg Arg, none No change C100 deetion CTA UAA Leu stop truncation G175 A175 No codon None-not in coding region No change
(Lys), resulting in translation of a polypeptide without the Lys amino acid. resulting in translation of a polypeptide without the Lys amino acid.
1. A change that makes a polypeptide defective has been discovered in its amino acid sequence. The normal and defective amino acid sequences are shown below. Researchers are attempting to reproduce the
More informationTranslation. Genetic code
Translation Genetic code If genes are segments of DNA and if DNA is just a string of nucleotide pairs, then how does the sequence of nucleotide pairs dictate the sequence of amino acids in proteins? Simple
More informationObjective: You will be able to justify the claim that organisms share many conserved core processes and features.
Objective: You will be able to justify the claim that organisms share many conserved core processes and features. Do Now: Read Enduring Understanding B Essential knowledge: Organisms share many conserved
More informationFrom Gene to Protein
From Gene to Protein Gene Expression Process by which DNA directs the synthesis of a protein 2 stages transcription translation All organisms One gene one protein 1. Transcription of DNA Gene Composed
More informationChapter
Chapter 17 17.4-17.6 Molecular Components of Translation A cell interprets a genetic message and builds a polypeptide The message is a series of codons on mrna The interpreter is called transfer (trna)
More informationGENETICS - CLUTCH CH.11 TRANSLATION.
!! www.clutchprep.com CONCEPT: GENETIC CODE Nucleotides and amino acids are translated in a 1 to 1 method The triplet code states that three nucleotides codes for one amino acid - A codon is a term for
More informationUsing an Artificial Regulatory Network to Investigate Neural Computation
Using an Artificial Regulatory Network to Investigate Neural Computation W. Garrett Mitchener College of Charleston January 6, 25 W. Garrett Mitchener (C of C) UM January 6, 25 / 4 Evolution and Computing
More informationRNA & PROTEIN SYNTHESIS. Making Proteins Using Directions From DNA
RNA & PROTEIN SYNTHESIS Making Proteins Using Directions From DNA RNA & Protein Synthesis v Nitrogenous bases in DNA contain information that directs protein synthesis v DNA remains in nucleus v in order
More informationAoife McLysaght Dept. of Genetics Trinity College Dublin
Aoife McLysaght Dept. of Genetics Trinity College Dublin Evolution of genome arrangement Evolution of genome content. Evolution of genome arrangement Gene order changes Inversions, translocations Evolution
More informationVideos. Bozeman, transcription and translation: https://youtu.be/h3b9arupxzg Crashcourse: Transcription and Translation - https://youtu.
Translation Translation Videos Bozeman, transcription and translation: https://youtu.be/h3b9arupxzg Crashcourse: Transcription and Translation - https://youtu.be/itsb2sqr-r0 Translation Translation The
More information1. In most cases, genes code for and it is that
Name Chapter 10 Reading Guide From DNA to Protein: Gene Expression Concept 10.1 Genetics Shows That Genes Code for Proteins 1. In most cases, genes code for and it is that determine. 2. Describe what Garrod
More informationومن أحياها Translation 1. Translation 1. DONE BY :Maen Faoury
Translation 1 DONE BY :Maen Faoury 0 1 ومن أحياها Translation 1 2 ومن أحياها Translation 1 In this lecture and the coming lectures you are going to see how the genetic information is transferred into proteins
More informationProtein Synthesis. Unit 6 Goal: Students will be able to describe the processes of transcription and translation.
Protein Synthesis Unit 6 Goal: Students will be able to describe the processes of transcription and translation. Types of RNA Messenger RNA (mrna) makes a copy of DNA, carries instructions for making proteins,
More informationPROTEIN SYNTHESIS INTRO
MR. POMERANTZ Page 1 of 6 Protein synthesis Intro. Use the text book to help properly answer the following questions 1. RNA differs from DNA in that RNA a. is single-stranded. c. contains the nitrogen
More informationIn previous lecture. Shannon s information measure x. Intuitive notion: H = number of required yes/no questions.
In previous lecture Shannon s information measure H ( X ) p log p log p x x 2 x 2 x Intuitive notion: H = number of required yes/no questions. The basic information unit is bit = 1 yes/no question or coin
More informationProtein Synthesis. Unit 6 Goal: Students will be able to describe the processes of transcription and translation.
Protein Synthesis Unit 6 Goal: Students will be able to describe the processes of transcription and translation. Protein Synthesis: Protein synthesis uses the information in genes to make proteins. 2 Steps
More informationDegeneracy. Two types of degeneracy:
Degeneracy The occurrence of more than one codon for an amino acid (AA). Most differ in only the 3 rd (3 ) base, with the 1 st and 2 nd being most important for distinguishing the AA. Two types of degeneracy:
More informationLesson Overview. Ribosomes and Protein Synthesis 13.2
13.2 The Genetic Code The first step in decoding genetic messages is to transcribe a nucleotide base sequence from DNA to mrna. This transcribed information contains a code for making proteins. The Genetic
More informationNewly made RNA is called primary transcript and is modified in three ways before leaving the nucleus:
m Eukaryotic mrna processing Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: Cap structure a modified guanine base is added to the 5 end. Poly-A tail
More informationG C T G U A. template strand
A 5 w 3 3 c 5 mrna RNA polymerase T G C A G C C T G U A coding or sense st AUG?? template strand The triplet code 3 bases = 1 amino acid Punctuation: sta rt: sto p: AUGA CUU CAGUAAC AU U AA C C AUG = methionine,
More informationChapter 17. From Gene to Protein. Biology Kevin Dees
Chapter 17 From Gene to Protein DNA The information molecule Sequences of bases is a code DNA organized in to chromosomes Chromosomes are organized into genes What do the genes actually say??? Reflecting
More informationTranslation and the Genetic Code
Chapter 11. Translation and the Genetic Code 1. Protein Structure 2. Components required for Protein Synthesis 3. Properties of the Genetic Code: An Overview 4. A Degenerate and Ordered Code 1 Sickle-Cell
More informationEdinburgh Research Explorer
Edinburgh Research Explorer Codon usage patterns in Escherichia coli, Bacillus subtilis, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Drosophila melanogaster and Homo sapiens; a review of the considerable
More informationGene Expression: Translation. transmission of information from mrna to proteins Chapter 5 slide 1
Gene Expression: Translation transmission of information from mrna to proteins 601 20000 Chapter 5 slide 1 Fig. 6.1 General structural formula for an amino acid Peter J. Russell, igenetics: Copyright Pearson
More informationMidterm Review Guide. Unit 1 : Biochemistry: 1. Give the ph values for an acid and a base. 2. What do buffers do? 3. Define monomer and polymer.
Midterm Review Guide Name: Unit 1 : Biochemistry: 1. Give the ph values for an acid and a base. 2. What do buffers do? 3. Define monomer and polymer. 4. Fill in the Organic Compounds chart : Elements Monomer
More informationTranslation. A ribosome, mrna, and trna.
Translation The basic processes of translation are conserved among prokaryotes and eukaryotes. Prokaryotic Translation A ribosome, mrna, and trna. In the initiation of translation in prokaryotes, the Shine-Dalgarno
More informationGet started on your Cornell notes right away
UNIT 10: Evolution DAYSHEET 100: Introduction to Evolution Name Biology I Date: Bellringer: 1. Get out your technology and go to www.biomonsters.com 2. Click the Biomonsters Cinema link. 3. Click the CHS
More information1. Contains the sugar ribose instead of deoxyribose. 2. Single-stranded instead of double stranded. 3. Contains uracil in place of thymine.
Protein Synthesis & Mutations RNA 1. Contains the sugar ribose instead of deoxyribose. 2. Single-stranded instead of double stranded. 3. Contains uracil in place of thymine. RNA Contains: 1. Adenine 2.
More informationOrganic Chemistry Option II: Chemical Biology
Organic Chemistry Option II: Chemical Biology Recommended books: Dr Stuart Conway Department of Chemistry, Chemistry Research Laboratory, University of Oxford email: stuart.conway@chem.ox.ac.uk Teaching
More informationLecture IV A. Shannon s theory of noisy channels and molecular codes
Lecture IV A Shannon s theory of noisy channels and molecular codes Noisy molecular codes: Rate-Distortion theory S Mapping M Channel/Code = mapping between two molecular spaces. Two functionals determine
More informationAdvanced Topics in RNA and DNA. DNA Microarrays Aptamers
Quiz 1 Advanced Topics in RNA and DNA DNA Microarrays Aptamers 2 Quantifying mrna levels to asses protein expression 3 The DNA Microarray Experiment 4 Application of DNA Microarrays 5 Some applications
More informationA p-adic Model of DNA Sequence and Genetic Code 1
ISSN 2070-0466, p-adic Numbers, Ultrametric Analysis and Applications, 2009, Vol. 1, No. 1, pp. 34 41. c Pleiades Publishing, Ltd., 2009. RESEARCH ARTICLES A p-adic Model of DNA Sequence and Genetic Code
More informationThe Gene The gene; Genes Genes Allele;
Gene, genetic code and regulation of the gene expression, Regulating the Metabolism, The Lac- Operon system,catabolic repression, The Trp Operon system: regulating the biosynthesis of the tryptophan. Mitesh
More informationA modular Fibonacci sequence in proteins
A modular Fibonacci sequence in proteins P. Dominy 1 and G. Rosen 2 1 Hagerty Library, Drexel University, Philadelphia, PA 19104, USA 2 Department of Physics, Drexel University, Philadelphia, PA 19104,
More informationSection 7. Junaid Malek, M.D.
Section 7 Junaid Malek, M.D. RNA Processing and Nomenclature For the purposes of this class, please do not refer to anything as mrna that has not been completely processed (spliced, capped, tailed) RNAs
More informationTHE GENETIC CODE AND EVOLUTION
Scientific Insights into the Evolution of the Universe and of Life Pontifical Academy of Sciences, Acta 20, 2009 www.pas.va/content/dam/accademia/pdf/acta20/acta20-nirenberg.pdf THE GENETIC CODE AND EVOLUTION
More informationReducing Redundancy of Codons through Total Graph
American Journal of Bioinformatics Original Research Paper Reducing Redundancy of Codons through Total Graph Nisha Gohain, Tazid Ali and Adil Akhtar Department of Mathematics, Dibrugarh University, Dibrugarh-786004,
More informationGenetic code on the dyadic plane
Genetic code on the dyadic plane arxiv:q-bio/0701007v3 [q-bio.qm] 2 Nov 2007 A.Yu.Khrennikov, S.V.Kozyrev June 18, 2018 Abstract We introduce the simple parametrization for the space of codons (triples
More informationSlide 1 / 54. Gene Expression in Eukaryotic cells
Slide 1 / 54 Gene Expression in Eukaryotic cells Slide 2 / 54 Central Dogma DNA is the the genetic material of the eukaryotic cell. Watson & Crick worked out the structure of DNA as a double helix. According
More informationTranslation Part 2 of Protein Synthesis
Translation Part 2 of Protein Synthesis IN: How is transcription like making a jello mold? (be specific) What process does this diagram represent? A. Mutation B. Replication C.Transcription D.Translation
More informationFrom gene to protein. Premedical biology
From gene to protein Premedical biology Central dogma of Biology, Molecular Biology, Genetics transcription replication reverse transcription translation DNA RNA Protein RNA chemically similar to DNA,
More informationComputational Biology: Basics & Interesting Problems
Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information
More informationMolecular Biology - Translation of RNA to make Protein *
OpenStax-CNX module: m49485 1 Molecular Biology - Translation of RNA to make Protein * Jerey Mahr Based on Translation by OpenStax This work is produced by OpenStax-CNX and licensed under the Creative
More informationOrganization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p
Organization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p.110-114 Arrangement of information in DNA----- requirements for RNA Common arrangement of protein-coding genes in prokaryotes=
More informationVocabulary Review. Biology and You
Skis Worksheet Vocabuary Review Bioogy and You Circe the term that best competes each sentence 1 A (ce, gene, or hypothesis) is the smaest unit abe to have ife 2 The sum of a chemica reactions that happen
More informationGenetic Code, Attributive Mappings and Stochastic Matrices
Genetic Code, Attributive Mappings and Stochastic Matrices Matthew He Division of Math, Science and Technology Nova Southeastern University Ft. Lauderdale, FL 33314, USA Email: hem@nova.edu Abstract: In
More informationLecture 5. How DNA governs protein synthesis. Primary goal: How does sequence of A,G,T, and C specify the sequence of amino acids in a protein?
Lecture 5 (FW) February 4, 2009 Translation, trna adaptors, and the code Reading.Chapters 8 and 9 Lecture 5. How DNA governs protein synthesis. Primary goal: How does sequence of A,G,T, and C specify the
More informationSEQUENCE ALIGNMENT BACKGROUND: BIOINFORMATICS. Prokaryotes and Eukaryotes. DNA and RNA
SEQUENCE ALIGNMENT BACKGROUND: BIOINFORMATICS 1 Prokaryotes and Eukaryotes 2 DNA and RNA 3 4 Double helix structure Codons Codons are triplets of bases from the RNA sequence. Each triplet defines an amino-acid.
More informationC CH 3 N C COOH. Write the structural formulas of all of the dipeptides that they could form with each other.
hapter 25 Biochemistry oncept heck 25.1 Two common amino acids are 3 2 N alanine 3 2 N threonine Write the structural formulas of all of the dipeptides that they could form with each other. The carboxyl
More informationChemistry Chapter 26
Chemistry 2100 Chapter 26 The Central Dogma! The central dogma of molecular biology: Information contained in DNA molecules is expressed in the structure of proteins. Gene expression is the turning on
More informationMathematics of Bioinformatics ---Theory, Practice, and Applications (Part II)
Mathematics of Bioinformatics ---Theory, Practice, and Applications (Part II) Matthew He, Ph.D. Professor/Director Division of Math, Science, and Technology Nova Southeastern University, Florida, USA December
More informationFrom DNA to protein, i.e. the central dogma
From DNA to protein, i.e. the central dogma DNA RNA Protein Biochemistry, chapters1 5 and Chapters 29 31. Chapters 2 5 and 29 31 will be covered more in detail in other lectures. ph, chapter 1, will be
More informationTypes of RNA. 1. Messenger RNA(mRNA): 1. Represents only 5% of the total RNA in the cell.
RNAs L.Os. Know the different types of RNA & their relative concentration Know the structure of each RNA Understand their functions Know their locations in the cell Understand the differences between prokaryotic
More informationWhat is the central dogma of biology?
Bellringer What is the central dogma of biology? A. RNA DNA Protein B. DNA Protein Gene C. DNA Gene RNA D. DNA RNA Protein Review of DNA processes Replication (7.1) Transcription(7.2) Translation(7.3)
More informationTranslation and Operons
Translation and Operons You Should Be Able To 1. Describe the three stages translation. including the movement of trna molecules through the ribosome. 2. Compare and contrast the roles of three different
More informationMarshall Nirenberg and the discovery of the Genetic Code
Marshall Nirenberg and the discovery of the Genetic Code The Coding Problem Once the function of DNA as the genetic substance was shown by Avery et al in 1944 And once the double helical structure of DNA
More informationBiology 155 Practice FINAL EXAM
Biology 155 Practice FINAL EXAM 1. Which of the following is NOT necessary for adaptive evolution? a. differential fitness among phenotypes b. small population size c. phenotypic variation d. heritability
More informationLecture 9 Translation.
1 Translation Summary of important events in translation. 2 Translation Reactions involved in peptide bond formation. Lecture 9 3 Genetic code Three types of RNA molecules perform different but complementary
More informationBME 5742 Biosystems Modeling and Control
BME 5742 Biosystems Modeling and Control Lecture 24 Unregulated Gene Expression Model Dr. Zvi Roth (FAU) 1 The genetic material inside a cell, encoded in its DNA, governs the response of a cell to various
More informationTranslation - Prokaryotes
1 Translation - Prokaryotes Shine-Dalgarno (SD) Sequence rrna 3 -GAUACCAUCCUCCUUA-5 mrna...ggagg..(5-7bp)...aug Influences: Secondary structure!! SD and AUG in unstructured region Start AUG 91% GUG 8 UUG
More informationCHEMISTRY 9701/42 Paper 4 Structured Questions May/June hours Candidates answer on the Question Paper. Additional Materials: Data Booklet
Cambridge International Examinations Cambridge International Advanced Level CHEMISTRY 9701/42 Paper 4 Structured Questions May/June 2014 2 hours Candidates answer on the Question Paper. Additional Materials:
More informationTRANSLATION: How to make proteins?
TRANSLATION: How to make proteins? EUKARYOTIC mrna CBP80 NUCLEUS SPLICEOSOME 5 UTR INTRON 3 UTR m 7 GpppG AUG UAA 5 ss 3 ss CBP20 PABP2 AAAAAAAAAAAAA 50-200 nts CYTOPLASM eif3 EJC PABP1 5 UTR 3 UTR m 7
More informationGENE ACTIVITY Gene structure Transcription Transcript processing mrna transport mrna stability Translation Posttranslational modifications
1 GENE ACTIVITY Gene structure Transcription Transcript processing mrna transport mrna stability Translation Posttranslational modifications 2 DNA Promoter Gene A Gene B Termination Signal Transcription
More informationUNIVERSITY OF CAMBRIDGE INTERNATIONAL EXAMINATIONS General Certifi cate of Education Advanced Subsidiary Level and Advanced Level
*1166350738* UNIVERSITY OF CAMBRIDGE INTERNATIONAL EXAMINATIONS General Certifi cate of Education Advanced Subsidiary Level and Advanced Level CEMISTRY 9701/43 Paper 4 Structured Questions October/November
More informationTHE GENETIC CODE INVARIANCE: WHEN EULER AND FIBONACCI MEET
Symmetry: Culture and Science Vol. 25, No. 3, 261-278, 2014 THE GENETIC CODE INVARIANCE: WHEN EULER AND FIBONACCI MEET Tidjani Négadi Address: Department of Physics, Faculty of Science, University of Oran,
More informationLaith AL-Mustafa. Protein synthesis. Nabil Bashir 10\28\ First
Laith AL-Mustafa Protein synthesis Nabil Bashir 10\28\2015 http://1drv.ms/1gigdnv 01 First 0 Protein synthesis In previous lectures we started talking about DNA Replication (DNA synthesis) and we covered
More informationLecture 15: Realities of Genome Assembly Protein Sequencing
Lecture 15: Realities of Genome Assembly Protein Sequencing Study Chapter 8.10-8.15 1 Euler s Theorems A graph is balanced if for every vertex the number of incoming edges equals to the number of outgoing
More informationChapter 10, 11, 14: Gene Expression, Regulation, and Development Exam
Chapter 10, 11, 14: Gene Expression, Regulation, and Development Exam Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Why did the original one-gene, one-enzyme
More informationReading Assignments. A. Genes and the Synthesis of Polypeptides. Lecture Series 7 From DNA to Protein: Genotype to Phenotype
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
More informationBCH 4054 Spring 2001 Chapter 33 Lecture Notes
BCH 4054 Spring 2001 Chapter 33 Lecture Notes Slide 1 The chapter covers degradation of proteins as well. We will not have time to get into that subject. Chapter 33 Protein Synthesis Slide 2 Prokaryotic
More informationMolecular Biology (9)
Molecular Biology (9) Translation Mamoun Ahram, PhD Second semester, 2017-2018 1 Resources This lecture Cooper, Ch. 8 (297-319) 2 General information Protein synthesis involves interactions between three
More informationNSCI Basic Properties of Life and The Biochemistry of Life on Earth
NSCI 314 LIFE IN THE COSMOS 4 Basic Properties of Life and The Biochemistry of Life on Earth Dr. Karen Kolehmainen Department of Physics CSUSB http://physics.csusb.edu/~karen/ WHAT IS LIFE? HARD TO DEFINE,
More informationNatural Selection. Nothing in Biology makes sense, except in the light of evolution. T. Dobzhansky
It is interesting to contemplate a tangled bank, clothed with many plants of many kinds, with birds singing on the bushes, with various insects flitting about, and with worms crawling through the damp
More informationMultiple Choice Review- Eukaryotic Gene Expression
Multiple Choice Review- Eukaryotic Gene Expression 1. Which of the following is the Central Dogma of cell biology? a. DNA Nucleic Acid Protein Amino Acid b. Prokaryote Bacteria - Eukaryote c. Atom Molecule
More informationProperties of amino acids in proteins
Properties of amino acids in proteins one of the primary roles of DNA (but not the only one!) is to code for proteins A typical bacterium builds thousands types of proteins, all from ~20 amino acids repeated
More informationCh 10, 11 &14 Preview
Ch 10, 11 &14 Preview Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Why did the original one-gene, one-enzyme hypothesis have to be modified? a. Some
More informationUnit Test on Cell Biology please read carefully and double-check your work! LO: Describe and explain the Central Dogma. SLE: Meet NGSS.
[3 points for writing your name!] Unit Test on Cell Biology please read carefully and double-check your work! LO: Describe and explain the Central Dogma. SLE: Meet NGSS. 1. List 2 organelles or cell parts
More informationGCD3033:Cell Biology. Transcription
Transcription Transcription: DNA to RNA A) production of complementary strand of DNA B) RNA types C) transcription start/stop signals D) Initiation of eukaryotic gene expression E) transcription factors
More informationLecture 27. Phylogeny methods, part 4 (Models of DNA and protein change) p.1/26
Lecture 27. Phylogeny methods, part 4 (Models of DNA and protein change) Joe Felsenstein Department of Genome Sciences and Department of Biology Lecture 27. Phylogeny methods, part 4 (Models of DNA and
More informationConceptofcolinearity: a continuous sequence of nucleotides in DNA encodes a continuous sequence of amino acids in a protein
Translation Conceptofcolinearity: a continuous sequence of nucleotides in DNA encodes a continuous sequence of amino acids in a protein Para além do fenómeno do wobble, há que considerar Desvios ao código
More informationIntroduction to the Ribosome Overview of protein synthesis on the ribosome Prof. Anders Liljas
Introduction to the Ribosome Molecular Biophysics Lund University 1 A B C D E F G H I J Genome Protein aa1 aa2 aa3 aa4 aa5 aa6 aa7 aa10 aa9 aa8 aa11 aa12 aa13 a a 14 How is a polypeptide synthesized? 2
More informationA Minimum Principle in Codon-Anticodon Interaction
A Minimum Principle in Codon-Anticodon Interaction A. Sciarrino a,b,, P. Sorba c arxiv:0.480v [q-bio.qm] 9 Oct 0 Abstract a Dipartimento di Scienze Fisiche, Università di Napoli Federico II Complesso Universitario
More informationCHAPTER 3. Cell Structure and Genetic Control. Chapter 3 Outline
CHAPTER 3 Cell Structure and Genetic Control Chapter 3 Outline Plasma Membrane Cytoplasm and Its Organelles Cell Nucleus and Gene Expression Protein Synthesis and Secretion DNA Synthesis and Cell Division
More informationThe Genetic Code Degeneracy and the Amino Acids Chemical Composition are Connected
181 OPINION AND PERSPECTIVES The Genetic Code Degeneracy and the Amino Acids Chemical Composition are Connected Tidjani Négadi Abstract We show that our recently published Arithmetic Model of the genetic
More informationSupplemental Materials
JOURNAL OF MICROBIOLOGY & BIOLOGY EDUCATION, May 2013, p. 107-109 DOI: http://dx.doi.org/10.1128/jmbe.v14i1.496 Supplemental Materials for Engaging Students in a Bioinformatics Activity to Introduce Gene
More informationCS229 Lecture notes. Andrew Ng
CS229 Lecture notes Andrew Ng Part IX The EM agorithm In the previous set of notes, we taked about the EM agorithm as appied to fitting a mixture of Gaussians. In this set of notes, we give a broader view
More information2017 DECEMBER BIOLOGY SEMESTER EXAM DISTRICT REVIEW
Name: Period: 2017 DECEMBER BIOLOGY SEMESTER EXAM DISTRICT REVIEW 1. List the characteristics of living things. (p 7) 2. Use the Aquatic Food Web above to answer the following questions (Ch. 2) a. Which
More informationComputational Cell Biology Lecture 4
Computational Cell Biology Lecture 4 Case Study: Basic Modeling in Gene Expression Yang Cao Department of Computer Science DNA Structure and Base Pair Gene Expression Gene is just a small part of DNA.
More informationStudent Handout 2. Human Sepiapterin Reductase mrna Gene Map A 3DMD BioInformatics Activity. Genome Sequencing. Sepiapterin Reductase
Project-Based Learning ctivity Human Sepiapterin Reductase mrn ene Map 3DMD BioInformatics ctivity 498 ---+---------+--------- ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------
More informationCHEM 3653 Exam # 1 (03/07/13)
1. Using phylogeny all living organisms can be divided into the following domains: A. Bacteria, Eukarya, and Vertebrate B. Archaea and Eukarya C. Bacteria, Eukarya, and Archaea D. Eukarya and Bacteria
More informationCHAPTER4 Translation
CHAPTER4 Translation 4.1 Outline of Translation 4.2 Genetic Code 4.3 trna and Anticodon 4.4 Ribosome 4.5 Protein Synthesis 4.6 Posttranslational Events 4.1 Outline of Translation From mrna to protein
More informationBiochemistry Prokaryotic translation
1 Description of Module Subject Name Paper Name Module Name/Title Dr. Vijaya Khader Dr. MC Varadaraj 2 1. Objectives 2. Understand the concept of genetic code 3. Understand the concept of wobble hypothesis
More information9/11/18. Molecular and Cellular Biology. 3. The Cell From Genes to Proteins. key processes
Molecular and Cellular Biology Animal Cell ((eukaryotic cell) -----> compare with prokaryotic cell) ENDOPLASMIC RETICULUM (ER) Rough ER Smooth ER Flagellum Nuclear envelope Nucleolus NUCLEUS Chromatin
More informationEnergy and Cellular Metabolism
1 Chapter 4 About This Chapter Energy and Cellular Metabolism 2 Energy in biological systems Chemical reactions Enzymes Metabolism Figure 4.1 Energy transfer in the environment Table 4.1 Properties of
More informationMolecular Genetics Principles of Gene Expression: Translation
Paper No. : 16 Module : 13 Principles of gene expression: Translation Development Team Principal Investigator: Prof. Neeta Sehgal Head, Department of Zoology, University of Delhi Paper Coordinator: Prof.
More informationTraffic data collection
Chapter 32 Traffic data coection 32.1 Overview Unike many other discipines of the engineering, the situations that are interesting to a traffic engineer cannot be reproduced in a aboratory. Even if road
More informationThe degeneracy of the genetic code and Hadamard matrices. Sergey V. Petoukhov
The degeneracy of the genetic code and Hadamard matrices Sergey V. Petoukhov Department of Biomechanics, Mechanical Engineering Research Institute of the Russian Academy of Sciences petoukhov@hotmail.com,
More informationChapter 12. Genes: Expression and Regulation
Chapter 12 Genes: Expression and Regulation 1 DNA Transcription or RNA Synthesis produces three types of RNA trna carries amino acids during protein synthesis rrna component of ribosomes mrna directs protein
More informationMARKOV CHAINS AND MARKOV DECISION THEORY. Contents
MARKOV CHAINS AND MARKOV DECISION THEORY ARINDRIMA DATTA Abstract. In this paper, we begin with a forma introduction to probabiity and expain the concept of random variabes and stochastic processes. After
More information9/2/17. Molecular and Cellular Biology. 3. The Cell From Genes to Proteins. key processes
Molecular and Cellular Biology Animal Cell ((eukaryotic cell) -----> compare with prokaryotic cell) ENDOPLASMIC RETICULUM (ER) Rough ER Smooth ER Flagellum Nuclear envelope Nucleolus NUCLEUS Chromatin
More information