Biology 2. Lecture Material. For. Exam 1
|
|
- Janis Wright
- 6 years ago
- Views:
Transcription
1 Biology 2 Macroevolution & Systematics 1 Biology 2 Lecture Material For Exam 1 Eukaryotes Halophiles Archaea Thermophiles Univeral Ancestor Methanogens Proteobacteria Chlamydia Bacteria Spirochetes Cyanobacteria Gram + Bacteria
2 Biology 2 Macroevolution & Systematics 2 Microevolution: Biological Species: Ring Species Allopatric Speciation: Evidence of: Favorable Conditions: Sympatric Speciation: Autopolyploidy: Allopolyploidy:
3 Biology 2 Macroevolution & Systematics 3 Hybrid Zones: Reinforcement: Fusion: Stability: Adaptive Radiation: The emergence of numerous species from a common ancestor introduced into an environment, presenting a diversity of new opportunities and problems
4 Biology 2 Macroevolution & Systematics 4 Macroevolution: Gradualism: Punctuated Equilibrium: Origin of Evolutionary Novelty Exaptation (preadaptation): Macroevolution through Major Changes in the Sequences and Regulation of Developmental Genes Effects of Developmental Genes Changes in Rate and Timing Changes in Spatial Patterns The Evolution of Development Changes in Gene Sequence Changes in Gene Regulation Effects of Developmental Genes: Evo-devo Changes in Rate and Timing: Allometric Growth:
5 Biology 2 Macroevolution & Systematics 5 Changes in Rate and Timing (cont.): Heterochrony: Paedeomorphosis: Paedeogenesis: Changes in Spatial Patterns: Homeotic Genes: Hox Genes:
6 Biology 2 Macroevolution & Systematics 6 Changes in Spatial Patterns (cont.): Homeobox: DNA, around 180 base pairs long, found within genes that are involved in the regulation of patterns of anatomical development. The Evolution of Genes Changes in Gene Sequences Changes in Gene Regulation
7 Biology 2 Macroevolution & Systematics 7 Evolutionary Trends: Species Selection (Steven Stanley): Size: Toe Reduction: Tooth shape/size: SYSTEMATICS: Comparing the genes or genomes of two species is the most direct measure of inheritance from shared ancestors. Comparisons can be made by using three methods: DNA-DNA hybridization, restriction maps, and DNA sequencing. Use the information to determine where species A through F belong in the phylogenetic tree. The information below is comparing the number of differences between an amino acid sequence from a blood protein found in rodents. (Assumption: The larger the number, the longer they have been separated from their common ancestor) A B C D E F A B C D E F
8 Biology 2 Macroevolution & Systematics 8 PHYLOGENETIC GROUPINGS: Monophyletic: Paraphyletic: Polyphyletic: Use the diagram below to identify whether the grouping is monophyletic, paraphyletic or polyphyletic. A B C D E F G H 1. A and B 2. A, B and C 3. D, E, and F 4. E, F, G and H 5. F, G, and H 6. E, F, and G SIMILARITIES Homology: Analogy: Molecular Homeoplasy:
9 Biology 2 Macroevolution & Systematics 9 ONTOGENY RECAPITULATES PHYLOGENY (Ernst Haekel) SYSTEMATICS: Classical Evolutionary (Linnaean) Systematics: Cladistics: Assumptions: Synapomorphies: Shared derived characters Plesiomorphies: Shared ancestral (primitive) characters
10 Biology 2 Macroevolution & Systematics 10 Parsimony:
11 Biology 2 Macroevolution & Systematics 11 Cladistic taxonomy and classical evolutionary taxonomy are different methods of interpreting phylogenetic data and classifying organisms. Read each statement below and check whether it relates to the cladistic approach, the classical approach, or both. Cladistic Classical 1. Method of classifying organisms and reconstructing phylogeny 2. Concerned only with the order of branching lineages 3. Produces cladograms 4. Concerned with branching and degree of divergence 5. Differentiates between primitive and derived characters 6. Puts lizards and crocodiles in one class, birds in another 7. Becoming more popular with researchers 8. Says birds are closer to crocodiles than to other reptiles 9. Uses anatomy and molecular biology to determine relationship 10. Places humans in the same family as some other apes 11. Places humans in their own family, separate from apes 12. The approach used 15 years ago 13. Considered to be more objective approach 14. Involves subjective judgements about divergence
12 Biology 2 Macroevolution & Systematics 12 Cladogram In cladistics, similar characteristics that come from a common ancestor are used to divide organisms into groups. A cladogram will begin by grouping organisms based on a characteristic displayed by all the members of the group. Subsequently, the larger group, or clade, will contain increasingly smaller groups (clades) that share the traits of the clades before them, but also exhibit distinct changes as the organism evolves. Draw a cladogram of the organisms below. (a 0 means the organism lacks that characteristic and a 1 means the organism has that characteristic present) Characteristics: no (0), yes (1) 1 is eukaryotic 2 is multicellular 3 has segmented body 4 has jaws 5 has limbs 6 has hair 7 has placenta
13 Biology 2 Macroevolution & Systematics 13 Cladistic Analysis of a DNA Sequence The study group below is an example of three species of chameleons, two from Madagascar and one for Equatorial Guinea. The outgroup is a lizard that is a distant relative of chameleons. The question is are the two Madagascan species (genus: Brookesia) really more closely related to each other over one being more closely related to the Equatorial Guinea species (Chamaeleo). The information below is from a piece of mitochondrial DNA sequence which encodes an amino acid of a protein called NADH dehydrogenase subuit 2. Uromastyx B. theili B. brygooi C. feae AAACCTTAAAAGACACCACAACCATATGAACAACAACACCAACAATCAGCACACTAC AAACACTACAAAATATAACAACTGCATGAACAACATCAACCACAGCAAACATTTTAC AAACACTACAAGACATAACAACAGCATGAACTACTTCAACAACAGCAAATATTACAC AAACCCTACGAGACGCAACAACAATATGATCCACTTCCCCCACAACAAACACAATTT Possible Cladograms B. theili 1. B. brygooi Number of changes C. feae 2. B. brygooi C. feae Number of changes B. theili 3. B. theili C. feae Number of changes B. brygooi
14 Biology 2 Macroevolution & Systematics 14 BACTERIA LECTURE Bacteria Characteristics: Nucleoid Region: No Membrane-bound Organelles: Ribosomes: Plasma Membrane: Cell Wall: Capsule: Flagella: Fimbriae: Pili: Asexual Reproduction:
15 Biology 2 Macroevolution & Systematics 15 Genetic Recombination: Transformation: Transduction: Conjugation: Classification: Shape Gram stain reaction Oxygen requirements Feeding strategies
16 Biology 2 Macroevolution & Systematics 16 Shapes: Gram-Stain: Gram Positive: Gram Negative: Oxygen Requirements: Obligate aerobes: Obligate anaerobes: Facultative anaerobes:
17 Biology 2 Macroevolution & Systematics 17 Feeding Strategies: Feeding Strategy Photoautotrophs Chemoautotrophs Photoheterotrophs Chemoheterotrophs Energy Source Carbon Source Nitrogen Metabolism: Heterocysts: Classification: Bacteria Archaea
18 Biology 2 Macroevolution & Systematics 18 Classification: Group: Proteobacteria Examples: Salmonella Characteristics: Shape: Gram Stain: Oxygen Requirement: Others: Group: Chlamydias Group: Spirochetes E. Coli Chlamydia Treponema pallidum Borrelia burgdorferi Shape: Gram Stain: Oxygen Requirement: Others: Shape: Gram Stain: Oxygen Requirement: Others: Shape: Gram Stain: Oxygen Requirement: Others: Shape: Gram Stain: Oxygen Requirement: Others
19 Biology 2 Macroevolution & Systematics 19 Group: Cyanobacteria Oscillatoria Shape: Gram Stain: Oxygen Requirement: Others: Group: Grampositive bacteria Clostridium Shape: Gram Stain: Oxygen Requirement: Others: Bacillus Anthracis Streptococcus Shape: Gram Stain: Oxygen Requirement: Others: Shape: Gram Stain: Oxygen Requirement: Others: Staphylococcus Shape: Gram Stain: Oxygen Requirement: Others: Domain: Archaea Methanogens Halophiles Thermophiles
20 Biology 2 Macroevolution & Systematics 20 Pathogens: Koch s Postulates: Bioremediation: Virus Structure: Viral Replication:
21 Biology 2 Macroevolution & Systematics 21 Virus Genome Structure: Bacteriophages: Lytic and Lysogenic Cycles: HIV Complex: Treatment:
22 Biology 2 Macroevolution & Systematics 22 Protista Lecture Characteristics: Protozoa: Algae: Fungi-like Origin of Eukaryotes Autogeneous: Endosymbiotic: Secondary Endosymbiosis:
23 Biology 2 Macroevolution & Systematics 23 Phylogeny of Eukarya: LUCA: MESS: Classification: Alveolata Stramenopila Rhizaria Amoebozoans Opisthokonts
24 Biology 2 Macroevolution & Systematics 24 Classification of Protista Supergroup: Excavata S. Characteristics: Clade2 Diplomonads C2. Characteristics Parabasalids Clade2 C2. Characteristics Clade3 C3. Characteristics Euglenozoans Euglenids Kinetoplastids
25 Biology 2 Macroevolution & Systematics 25 Supergroup: SAR S. Characteristics: Clade1 C1. Characteristics Clade2 C2. Characteristics: Alveolates Dinoflagellates Apicomplexans Ciliates Stramenopila Diatoms (Bacillariophyta) Golden Algae (Chrysophyta) Brown Algae (Phaeophyta) Oomycetes
26 Biology 2 Macroevolution & Systematics 26 Supergroup: SAR S. Characteristics: Rhizaria Clade2 C2. Characteristics: Foraminiferans Radiolarians Supergroup: Archaeplastida S. Characteristics Clade2 Red Algae (Rhodophyta) C2. Characteriscs: Chlorophytes Charophytes
27 Biology 2 Macroevolution & Systematics 27 Supergroup: Unikonta S. Characteristics: Clade1 C1. Characteristics Clade2 C2. Characteristics: Amoebozoans Slime Molds Clade3 Plasmodial C3 Characteristics Cellular Gymnamoebas Entamoebas Opisthokonts Nucleariids Choanoflagellates
28 Biology 2 Macroevolution & Systematics 28 FUNGI LECTURE Evolution: General Characteristics: Animal-like Characteristics:
29 Biology 2 Macroevolution & Systematics 29 Fungal Reproduction: Asexual: Sexual: Plasmogamy: Karyogamy: Syngamy: Fungal Classification: Division: Chytrids:
30 Biology 2 Macroevolution & Systematics 30 Division: Zygomycota:
31 Biology 2 Macroevolution & Systematics 31 Division: Glomeromycota Arbuscular Mycorrhizae Division: Ascomycota
32 Biology 2 Macroevolution & Systematics 32 Division: Basidiomycota Microsporidia Lichens: Ecological Impacts:
Biology 2. Lecture Material. For. Macroevolution. Systematics
Biology 2 Macroevolution & Systematics 1 Biology 2 Lecture Material For Macroevolution & Systematics Biology 2 Macroevolution & Systematics 2 Microevolution: Biological Species: Two Patterns of Evolutionary
More informationUnit 8: Prokaryotes, Protists, & Fungi Guided Reading Questions (60 pts total)
AP Biology Biology, Campbell and Reece, 10th Edition Adapted from chapter reading guides originally created by Lynn Miriello Name: Chapter 27 Bacteria and Archaea Unit 8: Prokaryotes, Protists, & Fungi
More informationCharacteristics. Nucleoid Region single circular chromosome plasmids mesosome
Prokaryotes Characteristics Nucleoid Region single circular chromosome plasmids mesosome No membranebound organelles Ribosomes (70S) Plasma membrane Cell wall peptidoglycan Capsule glycocalyx Flagella
More informationBiology 2. Lab Packet. For. Practical 1
Biology 2: LAB PRACTICUM 1 1 Biology 2 Lab Packet For Practical 1 Diplomonads Excavata Parabaslids Euglenozoans Dinoflagellates Alveolates Apicomplexans Ciliates Chromalveo Diatoms Golden Algae Stramenopiles
More informationLab tomorrow.
Lab tomorrow https://pages.stolaf.edu/angell/readings/ Unit 1 A. The early life and the Diversification of Prokaryotes (Ch24) B. Origin and Diversification of Eukaryotes (Ch25) C. Broad Patterns of Evolution
More informationProtists 9/11/2017. Endosymbiosis
Protists Chapter 28 Most eukaryotes are single-celled organisms Protists are eukaryotes Eukaryotic cells have organelles and are more complex than prokaryotic cells Most protists are unicellular, but there
More informationBiological Diversity Lab #1 : Domains Eubacteria and Archaea and Protista
Biological Diversity Lab #1 : Domains Eubacteria and Archaea and Protista Refer to the AP Biology book, Helms Labs 22 and be sure to site other resources used complete this lab in your lab journal. Be
More informationBiology 2. Lab Packet. For. Practical 1
Biology 2: LAB PRACTICUM 1 1 Biology 2 Lab Packet For Practical 1 Biology 2: LAB PRACTICUM 1 2 CLASSIFICATION: Domain: Bacteria Group: Proteobacteria Group: Chlamydias Group: Spirochetes Group: Cyanobacteria
More informationPractice Test for Exam 1
Practice Test for Exam 1 1. An explanation for natural phenomena that is well supported by many reliable observations describes which of the following? a. Fact b. Hypothesis c. Law d. Scientific theory
More informationThe Prokaryotic World
The Prokaryotic World A. An overview of prokaryotic life There is no doubt that prokaryotes are everywhere. By everywhere, I mean living in every geographic region, in extremes of environmental conditions,
More informationBIOLOGY - CLUTCH CH.29 - PROTISTS.
!! www.clutchprep.com Eukrayotic cells are large, have a nucleus, contain membrane-bound organelles, and use a cytoskeleton The nucleus is the synapomorphy that unifies eukaryotes Endosymbiotic theory
More informationOrigins of Eukaryotic Diversity Protists Diversity
Origins of Eukaryotic Diversity Protists Diversity For Lecture, Make sure you know the Water Molds (Oomycota) names and characteris6cs of the taxa at the levels indicated by the red arrows. Characteristics
More informationBio 2 Plant and Animal Biology
Bio 2 Plant and Animal Biology Evolution Evolution as the explanation for life s unity and diversity Darwinian Revolution Two main Points Descent with Modification Natural Selection Biological Species
More informationPROTISTA. The paraphyletic, nonfungi, + Even MORE new words to remember!
PROTISTA The paraphyletic, nonfungi, non-animal, nonplant Eucarya + Even MORE new words to remember! Key Points Origin of eukaryotes via symbiosis Origin of classification based on functional (ecological)
More informationHierarchies can be represented as trees:
Diversity of Life Classification - an organized scheme for grouping organisms - a tool for communication - Hierarchical - a series of successive and inclusive rankings Domain - the highest rank - contains
More information8/23/2014. Phylogeny and the Tree of Life
Phylogeny and the Tree of Life Chapter 26 Objectives Explain the following characteristics of the Linnaean system of classification: a. binomial nomenclature b. hierarchical classification List the major
More informationPhylogeny and the Tree of Life
Chapter 26 Phylogeny and the Tree of Life PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationPhylogeny and the Tree of Life
Chapter 26 Phylogeny and the Tree of Life PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationFinishing Chapters 15 and 16. For Next Week
Finishing Chapters 15 and 16 For Next Week Lab Invertebrate questions due at 8:40 AM Bring dissecting kit and gloves to lab Lecture Assignment: Collect 5 branches from trees, put in plastic bags For each,
More informationUnit 9: Evolution Guided Reading Questions (80 pts total)
Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Unit 9: Evolution Guided Reading Questions (80 pts total) Chapter 22 Descent
More informationOutline. Classification of Living Things
Outline Classification of Living Things Chapter 20 Mader: Biology 8th Ed. Taxonomy Binomial System Species Identification Classification Categories Phylogenetic Trees Tracing Phylogeny Cladistic Systematics
More informationSPECIATION. REPRODUCTIVE BARRIERS PREZYGOTIC: Barriers that prevent fertilization. Habitat isolation Populations can t get together
SPECIATION Origin of new species=speciation -Process by which one species splits into two or more species, accounts for both the unity and diversity of life SPECIES BIOLOGICAL CONCEPT Population or groups
More informationSymbiosis. Symbiosis is a close association between of two or more organisms. Endosymbiosis living within another
PROTISTS Protists constitute several kingdoms within the domain Eukarya Protists obtain their nutrition in a variety of ways Algae are autotrophic protists Protozoans are heterotrophic protists Fungus
More informationChapter 27: Evolutionary Genetics
Chapter 27: Evolutionary Genetics Student Learning Objectives Upon completion of this chapter you should be able to: 1. Understand what the term species means to biology. 2. Recognize the various patterns
More informationPhylogeny and the Tree of Life
LECTURE PRESENTATIONS For CAMPBELL BIOLOGY, NINTH EDITION Jane B. Reece, Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Robert B. Jackson Chapter 26 Phylogeny and the Tree of Life
More informationOrigins of Eukaryotic Diversity Protists Diversity
Origins of Eukaryotic Diversity Protists Diversity Euglenas Kinetoplastids Water Molds (Oomycota) For Lecture & Lab, make sure to know the supergroup and the most specific clade or group and characteris
More informationCLASSIFICATION. Why Classify? 2/18/2013. History of Taxonomy Biodiversity: variety of organisms at all levels from populations to ecosystems.
Why Classify? Classification has been around ever since people paid attention to organisms. CLASSIFICATION One primeval system was based on harmful and non-harmful organisms. Life is easier when we organize
More information1. General Features of Protists
Chapter 28: Protists 1. General Features of Protists 2. Survey of the Protista A. The Excavata B. The SAR Clade C. The Archaeplastida D. The Unikonta 1. General Features of Protists All Protists are Eukaryotes
More informationChapter 21 PROKARYOTES AND VIRUSES
Chapter 21 PROKARYOTES AND VIRUSES Bozeman Video classification of life http://www.youtube.com/watch?v=tyl_8gv 7RiE Impacts, Issues: West Nile Virus Takes Off Alexander the Great, 336 B.C., conquered a
More informationChapter 16. The Origin and Evolution of Microbial Life: Prokaryotes and Protists. Lecture by Joan Sharp
Chapter 16 The Origin and Evolution of Microbial Life: Prokaryotes and Protists PowerPoint Lectures for Biology: Concepts & Connections, Sixth Edition Campbell, Reece, Taylor, Simon, and Dickey Lecture
More informationProtists. There are NO typical protists. Protist General Characteristics - usually single cell - eukaryotic - paraphyletic group
There are NO typical protists. Protist General Characteristics - usually single cell - eukaryotic - paraphyletic group Traditional Classification There are three divisions of the Kingdom Protista: Protozoa,
More informationBiology 211 Exam 1 Review!
Biology 211 Exam 1 Review Scientific Method: 1. List the five characteristics of science. 2. Complete the following table. Term Hypothesis Facts Theory Chapter 1 Definition 3. Name and describe are the
More informationChapter 26 Phylogeny and the Tree of Life
Chapter 26 Phylogeny and the Tree of Life Biologists estimate that there are about 5 to 100 million species of organisms living on Earth today. Evidence from morphological, biochemical, and gene sequence
More information9/8/2017. Bacteria and Archaea. Three domain system: The present tree of life. Structural and functional adaptations contribute to prokaryotic success
5 m 2 m 9/8/2017 Three domain system: The present tree of life Bacteria and Archaea Chapter 27 Structural and functional adaptations contribute to prokaryotic success Unicellular Small Variety of shapes
More information9/24/2013. Bacteria and Archaea. Masters of Adaptation. Archaea. Three domain system: The present tree of life
200 m 2. 300 m 2 m 1 m Bacteria and Archaea Three domain system: The present tree of life Chapter 27 Masters of Adaptation Structural and functional adaptations contribute to prokaryotic success Unicellular
More informationChapter 18 Systematics: Seeking Order Amidst Diversity
Chapter 18 Systematics: Seeking Order Amidst Diversity Bird Diversity in Indonesia Chapter 18 At a Glance 18.1 How Are Organisms Named and Classified? 18.2 What Are the Domains of Life? 18.1 How Are Organisms
More informationUnit 7: Evolution Guided Reading Questions (80 pts total)
AP Biology Biology, Campbell and Reece, 10th Edition Adapted from chapter reading guides originally created by Lynn Miriello Name: Unit 7: Evolution Guided Reading Questions (80 pts total) Chapter 22 Descent
More informationProtists. Protists. Protist Feeding Strategies. Protist Body Plans. Endosymbiosis. Protist Reproduction 3/3/2011. Eukaryotes Not a monophyletic group
Protists Protists Eukaryotes Not a monophyletic group Paraphyletic March 3 rd, 2011 Still use the term protist All eukaryotes except Plants, Fungi, Animals Most unicellular Some colonial Some multicelled
More informationPhylogeny 9/8/2014. Evolutionary Relationships. Data Supporting Phylogeny. Chapter 26
Phylogeny Chapter 26 Taxonomy Taxonomy: ordered division of organisms into categories based on a set of characteristics used to assess similarities and differences Carolus Linnaeus developed binomial nomenclature,
More information2014 Pearson Education, Inc. 1
1 4.5 bya 3.5 2.5 1.5 500 mya 1.8 bya 1.5 bya 1.3 bya 1.2 bya 750 mya 635 mya 600 mya 0.5 cm 550 mya 535 mya 1 cm 20 µm (a) A 1.8-billionyear-old fossil eukaryote (b) Tappania, a 1.5-billion-year-old fossil
More informationProkaryotes 1. General Characteristics and structures The prokaryotic Cells contain a single circular chromosome, ribosomes (70S), and a cell wall
Prokaryotes 1. General Characteristics and structures The prokaryotic Cells contain a single circular chromosome, ribosomes (70S), and a cell wall made up of peptidoglycan. They have no membrane bound
More informationBiology 211 (2) Week 1 KEY!
Biology 211 (2) Week 1 KEY Chapter 1 KEY FIGURES: 1.2, 1.3, 1.4, 1.5, 1.6, 1.7 VOCABULARY: Adaptation: a trait that increases the fitness Cells: a developed, system bound with a thin outer layer made of
More informationChapter 26: Phylogeny and the Tree of Life
Chapter 26: Phylogeny and the Tree of Life 1. Key Concepts Pertaining to Phylogeny 2. Determining Phylogenies 3. Evolutionary History Revealed in Genomes 1. Key Concepts Pertaining to Phylogeny PHYLOGENY
More informationChapter 19: Taxonomy, Systematics, and Phylogeny
Chapter 19: Taxonomy, Systematics, and Phylogeny AP Curriculum Alignment Chapter 19 expands on the topics of phylogenies and cladograms, which are important to Big Idea 1. In order for students to understand
More informationPhylogeny and the Tree of Life
Chapter 26 Phylogeny and the Tree of Life PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationChapter 26: Phylogeny and the Tree of Life Phylogenies Show Evolutionary Relationships
Chapter 26: Phylogeny and the Tree of Life You Must Know The taxonomic categories and how they indicate relatedness. How systematics is used to develop phylogenetic trees. How to construct a phylogenetic
More informationOutline. Viruses, Bacteria, and Archaea. Viruses Structure Classification Reproduction Prokaryotes Structure Reproduction Nutrition Bacteria Archaea
Viruses, Bacteria, and Archaea Chapter 21 Viruses Structure Classification Reproduction Prokaryotes Structure Reproduction Nutrition Bacteria Archaea Outline The Viruses The Viruses Viruses are noncellular
More informationPhylogeny and the Tree of Life
LECTURE PRESENTATIONS For CAMPBELL BIOLOGY, NINTH EDITION Jane B. Reece, Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Robert B. Jackson Chapter 26 Phylogeny and the Tree of Life
More informationKey Points PROTISTA. Functional arrangements. General. All of these groups are polyphyletic 9/18/14
PROTISTA The paraphyletic, nonfungi, non-animal, nonplant Eucarya + Even MORE new words to remember! Key Points Origin of eukaryotes via symbiosis Origin of classification based on functional (ecological)
More informationCreating a Dichotomous Key
Dichotomous Keys A tool used that allows users to determine the identity of unknown species Keys consist of a series of choices, where the user selects from a series of connected pairs Each pair of choices
More informationPhylogeny and systematics. Why are these disciplines important in evolutionary biology and how are they related to each other?
Phylogeny and systematics Why are these disciplines important in evolutionary biology and how are they related to each other? Phylogeny and systematics Phylogeny: the evolutionary history of a species
More informationOrigins of Life. Fundamental Properties of Life. Conditions on Early Earth. Evolution of Cells. The Tree of Life
The Tree of Life Chapter 26 Origins of Life The Earth formed as a hot mass of molten rock about 4.5 billion years ago (BYA) -As it cooled, chemically-rich oceans were formed from water condensation Life
More informationFig. 26.7a. Biodiversity. 1. Course Outline Outcomes Instructors Text Grading. 2. Course Syllabus. Fig. 26.7b Table
Fig. 26.7a Biodiversity 1. Course Outline Outcomes Instructors Text Grading 2. Course Syllabus Fig. 26.7b Table 26.2-1 1 Table 26.2-2 Outline: Systematics and the Phylogenetic Revolution I. Naming and
More informationAP: CHAPTER 18: the Genetics of VIRUSES p What makes microbes good models to study molecular mechanisms? 4. What is a bacteriophage?
AP: CHAPTER 18: the Genetics of VIRUSES p328-340 1. What makes microbes good models to study molecular mechanisms? Name Per 2. How were viruses first discovered? 3. What are the two basic components of
More informationKingdom Monera(Archaebacteria & Eubacteria)
Kingdom Monera(Archaebacteria & All bacteria are prokaryotes Characteristics: 1. No nucleus Eubacteria) 2. No membrane bound organelles 3. Smaller & less ribosomes 4. Most are smaller than eukaryotes 5.
More informationKingdom Monera Bacteria
Kingdom Monera Bacteria Common bacteria Prokaryotes Strep throat Anthrax Chlamydia E. coli Meningitis Salmonella Micrococcus(intestinal) Streptococcus mutans Haemophilusinfluenzae Cellphonious bacterious
More informationBIOLOGICAL SCIENCE. Lecture Presentation by Cindy S. Malone, PhD, California State University Northridge. FIFTH EDITION Freeman Quillin Allison
BIOLOGICAL SCIENCE FIFTH EDITION Freeman Quillin Allison 1 Lecture Presentation by Cindy S. Malone, PhD, California State University Northridge Roadmap 1 Key themes to structure your thinking about Biology
More informationChapter 22: Descent with Modification 1. BRIEFLY summarize the main points that Darwin made in The Origin of Species.
AP Biology Chapter Packet 7- Evolution Name Chapter 22: Descent with Modification 1. BRIEFLY summarize the main points that Darwin made in The Origin of Species. 2. Define the following terms: a. Natural
More informationA. Correct! Taxonomy is the science of classification. B. Incorrect! Taxonomy is the science of classification.
DAT - Problem Drill 07: Diversity of Life Question No. 1 of 10 Instructions: (1) Read the problem and answer choices carefully, (2) Work the problems on paper as 1. What is taxonomy? Question #01 (A) Taxonomy
More informationBiology Curriculum Pacing Guide MONTGOMERY COUNTY PUBLIC SCHOOLS
MONTGOMERY COUNTY PUBLIC SCHOOLS Biology Curriculum Pacing Guide 1 st 9 Weeks SOL Objectives Vocabulary 7 Days 14 Days BIO.1 The student will demonstrate an understanding of scientific reasoning, logic,
More informationProtists: Molds Lecture 3 Spring 2014
Meet the Protists 1 Protists: Molds Lecture 3 Spring 2014 Domain Eukarya What unites them as a group? The Origin of Eukaryotic Cells Evolution of the endomembrane system Which organelles are included in
More informationProtists: Molds Lecture 3 Spring 2014
Protists: Molds Lecture 3 Spring 2014 Meet the Protists 1 Domain Eukarya What unites them as a group? The Origin of Eukaryotic Cells 2 Evolution of the endomembrane system Which organelles are included
More informationPHYLOGENY AND SYSTEMATICS
AP BIOLOGY EVOLUTION/HEREDITY UNIT Unit 1 Part 11 Chapter 26 Activity #15 NAME DATE PERIOD PHYLOGENY AND SYSTEMATICS PHYLOGENY Evolutionary history of species or group of related species SYSTEMATICS Study
More informationThe History of Life on Earth
LECTURE PRESENTATIONS For CAMPBELL BIOLOGY, NINTH EDITION Jane B. Reece, Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Robert B. Jackson Chapter 25 The History of Life on Earth
More informationESS 345 Ichthyology. Systematic Ichthyology Part II Not in Book
ESS 345 Ichthyology Systematic Ichthyology Part II Not in Book Thought for today: Now, here, you see, it takes all the running you can do, to keep in the same place. If you want to get somewhere else,
More informationPhylogeny CAMPBELL BIOLOGY IN FOCUS SECOND EDITION URRY CAIN WASSERMAN MINORSKY REECE
CAMPBELL BIOLOGY IN FOCUS URRY CAIN WASSERMAN MINORSKY REECE 20 Phylogeny Lecture Presentations by Kathleen Fitzpatrick and Nicole Tunbridge, Simon Fraser University SECOND EDITION Investigating the Evolutionary
More informationPhylogeny & Systematics: The Tree of Life
Phylogeny & Systematics: The Tree of Life An unexpected family tree. What are the evolutionary relationships among a human, a mushroom, and a tulip? Molecular systematics has revealed that despite appearances
More information20 Phylogeny CAMPBELL BIOLOGY IN FOCUS. Urry Cain Wasserman Minorsky Jackson Reece. Lecture Presentations by Kathleen Fitzpatrick and Nicole Tunbridge
CAMPBELL BIOLOGY IN FOCUS Urry Cain Wasserman Minorsky Jackson Reece 20 Phylogeny Lecture Presentations by Kathleen Fitzpatrick and Nicole Tunbridge Overview: Investigating the Evolutionary History of
More informationClassifying Prokaryotes: Eubacteria Plasma Membrane. Ribosomes. Plasmid (DNA) Capsule. Cytoplasm. Outer Membrane DNA. Flagellum.
Bacteria The yellow band surrounding this hot spring is sulfur, a waste product of extremophilic prokaryotes, probably of the Domain Archaea, Kingdom Archaebacteria. Bacteria are prokaryotic cells (no
More informationProkaryotes. Chapter 27. PowerPoint Lectures for Biology, Seventh Edition. Lectures by Chris Romero. Neil Campbell and Jane Reece
Chapter 27 Prokaryotes PowerPoint Lectures for Biology, Seventh Edition Neil Campbell and Jane Reece Lectures by Chris Romero Overview: They re (Almost) Everywhere! Most prokaryotes are microscopic But
More informationOn the slides and live specimens find the (and know the function of) nucleus paramylon bodies cytopharynx flagellum eyespot
Biology 3B Laboratory Protist Diversity Objectives Learn the basic characteristics that define organisms classified within the Protist taxon To learn the anatomy, life cycles and identification of representative
More informationBIOLOGY. Phylogeny and the Tree of Life CAMPBELL. Reece Urry Cain Wasserman Minorsky Jackson
CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 26 Phylogeny and the Tree of Life Lecture Presentation by Nicole Tunbridge and Kathleen Fitzpatrick Concept 26.1: Phylogenies show
More informationProkaryotes (Domains Bacteria & Archaea) KEY POINTS
Prokaryotes (Domains Bacteria & Archaea) KEY POINTS 1. Decomposers: recycle organic and inorganic molecules in environment; makes them available to other organisms. 2. Essential components of symbioses.
More informationAP Biology Exam #7 (PRACTICE) Subunit #7: Diversity of Life
AP Biology Exam #7 (PRACTICE) Subunit #7: Diversity of Life Multiple Choice Questions: Choose the best answer then bubble your answer on your scantron sheet. 1. Armadillos and spiny anteaters are not related.
More informationPearson Education, Inc.
1 4.5 bya 3.5 1.5 2.5 500 mya 1.8 bya 1.5 bya 1.3 bya 1.2 bya 550 750 mya 635 mya 600 mya mya 0.5 cm 535 mya 1 cm (a) A 1.8-billionyear-old fossil (b) Tappania, a 1.5-billion-year-old fossil that may represent
More informationNumber of Species. Taxonomy and Animal Phylogeny. Approx. 1.5 million species known. Taxonomy = Systematics = Phylogeny. Miller and Harley Chap.
Taxonomy and Animal Phylogeny Miller and Harley Chap. 7 Number of Species Approx. 1.5 million species known Taxonomy = Systematics = Phylogeny 1 Taxonomic Hierarchy Carolus Linnaeus (1707-1778) Kingdom
More informationSection 19 1 Bacteria (pages )
Chapter 19 Bacteria and Viruses Section 19 1 Bacteria (pages 471 477) How do the two groups of prokaryotes differ? What factors are used to identify prokaryotes? What is the importance of bacteria? 13.
More informationUnit 2 Biodiversity Ch. 4 Patterns of Life
Unit 2 Biodiversity Ch. 4 Patterns of Life Name: 4.1 Characteristics of Life In order to be considered living, an organism must possess the following Six (6) characteristics: 1. Living things are organized
More informationScientific names allow scientists to talk about particular species without confusion
Unit 9 Test Review KEY a. Explain the history, purpose, and methods of taxonomy What is taxonomy? the science of naming and classifying organisms Who came up with it? Linnaeus Why do we use taxonomy? Scientific
More informationBio 2 Plant & Animal Biology. Dr. Tim Revell
Bio 2 Plant & Animal Biology Dr. Tim Revell Welcome to Bio 2! Plant and Animal Interactions Second Semester Majors Course A course on Taxonomy, Evolution, Biodiversity, Ecology, Conservation, Comparative
More informationIntro to Prokaryotes Lecture 1 Spring 2014
Intro to Prokaryotes Lecture 1 Spring 2014 Meet the Prokaryotes 1 Meet the Prokaryotes 2 Meet the Prokaryotes 3 Why study prokaryotes? Deep Time 4 Fig. 25.7 Fossilized stromatolite (above) and living stromatolite
More informationVocabulary- Bacteria (34 words)
Biology II BACTERIA Vocabulary- Bacteria (34 words) 1. Prokaryote 21. phototroph 2. Peptidoglycan 22. chemotroph 3. Methanogen 23. obligate anaerobe 4. Halophile 24. facultative anaerobe 5. Thermoacidophile
More informationName: Class: Date: ID: A
Class: _ Date: _ Ch 17 Practice test 1. A segment of DNA that stores genetic information is called a(n) a. amino acid. b. gene. c. protein. d. intron. 2. In which of the following processes does change
More informationContinued from Chapter 26.
Changing understanding Continued from Chapter 26. Based on phylogenetic research Two kingdoms to five kingdoms to three domains Three domain system: The present tree of life Animation: Classification Schemes
More informationReproduction- passing genetic information to the next generation
166 166 Essential Question: How has biological evolution led to the diversity of life? B-5 Natural Selection Traits that make an organism more or less likely to survive in an environment and reproduce
More informationAmoeba hunts and kills paramecia and stentor. Eukaryotic photosynthetic cells
Amoeba hunts and kills paramecia and stentor Eukaryotic photosynthetic cells 1 Eukaryotic organelles are odd in many ways Organelles: membrane bound compartments in a cell Nucleus, chloroplasts, and mitochondria
More informationChapter 27: Bacteria and Archaea
Name Period Overview 1. The chapter opens with amazing tales of life at the extreme edge. What are the masters of adaptation? Describe the one case you thought most dramatic. Concept 27.1 Structural and
More informationBacteria & Archaea. Ms.Tanyaratana Dumkua Biology Department, MahidolWittayanusorn school
Bacteria & Archaea Ms.Tanyaratana Dumkua Biology Department, MahidolWittayanusorn school What is the bacteria? http://www.unc.edu/depts/tcf/mycoplasma.gif http://gsbs.utmb.edu/microbook/images/fig37_1.jpg
More informationChapter 21: Protist Evolution and Diversity
Chapter 21: Protist Evolution and Diversity AP Curriculum Alignment Big Idea 1, which includes the concept that mutually beneficial associations among ancient bacteria gave rise to eukaryotic cells, is
More informationOverview: Masters of Adaptation. Prokaryotes thrive almost everywhere, including places too acidic, salty, cold, or hot for most other organisms
Chapter 27 Bacteria and Archaea Overview: Masters of Adaptation Prokaryotes thrive almost everywhere, including places too acidic, salty, cold, or hot for most other organisms They have an astonishing
More informationEukaryotic photosynthetic cells
Amoeba hunts and kills paramecia and stentor Eukaryotic photosynthetic cells Eukaryotic organelles are odd in many ways Organelles: membrane bound compartments in a cell Nucleus, chloroplasts, and mitochondria
More informationMacroevolution Part I: Phylogenies
Macroevolution Part I: Phylogenies Taxonomy Classification originated with Carolus Linnaeus in the 18 th century. Based on structural (outward and inward) similarities Hierarchal scheme, the largest most
More informationProtists. Chapter 28. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 28 Protists PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Overview:
More informationLecture 11 Friday, October 21, 2011
Lecture 11 Friday, October 21, 2011 Phylogenetic tree (phylogeny) Darwin and classification: In the Origin, Darwin said that descent from a common ancestral species could explain why the Linnaean system
More informationChapter 17. Organizing Life's Diversity
Chapter 17 Organizing Life's Diversity Key Concepts: Chapter 17 1. List the 3 domains and the 6 kingdoms. 2. Our current system of classification was originally based on structures; scientists now base
More informationBacteria, Protists, Fungi, Plants, Animals: Phylogeny and Diversity
Bacteria, Protists, Fungi, Plants, Animals: Phylogeny and Diversity 1/8/2006 Phylogeny 2 1/8/2006 Phylogeny 3 Proteobacteria Chlamydias Spirochetes Cyanobacteria Gram positive bacteria Korarchaeotes Euryarchaeotes,
More informationProtists The Simplest Eukaryotes. Chapter 22 Part 1
Protists The Simplest Eukaryotes Chapter 22 Part 1 Impacts, Issues The Malaria Menace Plasmodium, a single-celled protist, causes malaria but also manipulates its mosquito and human hosts to maximize its
More informationUoN, CAS, DBSC BIOL102 lecture notes by: Dr. Mustafa A. Mansi. The Phylogenetic Systematics (Phylogeny and Systematics)
- Phylogeny? - Systematics? The Phylogenetic Systematics (Phylogeny and Systematics) - Phylogenetic systematics? Connection between phylogeny and classification. - Phylogenetic systematics informs the
More informationUnit 5. Organisms C H A P T E R 1 5. Bacteria: Unicellular R E A D P
Unit 5 Bacteria: Unicellular Organisms C H A P T E R 1 5 R E A D P. 2 9 3-305 Bacterial Cell Structure: Prokaryotic Single cellular no membrane bound organelles primitive Parts of Bacteria 1. Cell membrane
More informationPhylogeny & Systematics
Phylogeny & Systematics Phylogeny & Systematics An unexpected family tree. What are the evolutionary relationships among a human, a mushroom, and a tulip? Molecular systematics has revealed that despite
More information