Roland Brosch! Institut Pasteur! Evolution of the Mycobacterium tuberculosis complex!
|
|
|
- Dayna Gilbert
- 6 years ago
- Views:
Transcription
1 Evolution of the Mycobacterium tuberculosis complex! or what have we learned on this subject since the publication of the! M. tuberculosis H37Rv genome! Roland Brosch! Integrated! Mycobacterial! Pathogenomics! Institut Pasteur!
2 mycobacteria M. fortuitum ATCC49403! M. fortuitum! M. senegalense! M. fortuitum ATCC49404! M. peregrinum! M. aichiense! M. gilvum! M. mucogenicum! M. mucogenicum! Mycobacterium M. neoaurum! M. diernhofer! M. obuense! M. chubuense! M. aurum! M. fallax! M. chelonae! M. abscessus! M. chitae! M. confluentis! M. madagascariense! M. vaccae! M. phlei! MCRO17! M. flavescens! M. smegmatis! MCRO10! M. chromogenicum! MCRO7! M. thermoresistible! M. gadium! Slow growing mycobacteria!
3 M. fortuitum! M. peregrinum! M. triviale! M. simiae! M. genavense! MCRO18! MCRO19! M. interjectum! M. intermedium! M. terrae! M. hiberniae! M. nonchromogenicum! MCRO6! M. cookii! M. celatum! M. xenopi! M. shimoidei! M. asiaticum! M. gordonae! M. marinum! M. ulcerans! M. tuberculosis Complex! M. leprae! M. szulgai! M. malmoense! M. haemophilum! M. gastri/ kansasii! M. scrofulaceum! M. paraffinicum! M. intracellulare! M. avium! slowly growing mycobacteria.! fish pathog & human opportun. pathogen! aquatic mycobacterium,! etiological agent of Buruli ulcer! aquatic mycobacterium,! produces mycolactone! M. tuberculosis! M. canettii! M. africanum! M. microti! M. pinnipedii! M. bovis! M. bov. BCG! etiological agent of leprosy! reductive evolution! 16S rrna tree - Springer et al., J. Clin. Microbiol., (1996)! Johneʼs disease
4 What are the molecular determinants for the evolutionary success of M. tuberculosis as a human pathogen?!
5 Genome of M. tuberculosis H37Rv!!!!!! 4,4 Mb GC 65.6% 4000 genes! genes for aerobic, micro-aerophilic and anaerobic! abundance of genes involved in lipid metabolism! eukaryotic like Serine/Threonine Protein Kinases! 1998 novel gene/protein families e.g. PE/PPE, ESAT-6,! Cole ST, Brosch R, Parkhill J, et al.,! (1998), Nature 393, !
6 Comparative genomics between different species! To extract the biological information from genome sequence data! M. tuberculosis H37Rv! Comparison! M. marinum! Based 16S rrna genetically similar! other species! allows insights into the more distant events!
7 Genome of M. marinum! genome size! G+C! 6.6 Mb! 65.7 %! (M. tub.)! (4.4 Mb)! (65.6 %)! protein encoding genes! orthologs in both genoms! 5424! (3,974)! 3066! Pseudogenes! 65! (17)! 2008 Stinear et al., (2008), Genome Res.!
8 Identification of ~ 600 M. tuberculosis - specific CDS! Mycobacterial core genome (not including M. leprae) ~ 2500 genes At least 80 regions containing 600 genes seem to have been gained by the ancestor of M. tuberculosis through horizontal gene transfer during its more distant evolution (soil?) Stinear et al., (2008), Genome Res.!
9 M. tuberculosis-specific CDS Many encode known virulence factors sulfolipid locus virs locus pilin gene fumarate reductase locus (Rv )
10 ? possible early evolution of M. tuberculosis Gordon et al., (2009), Bioessays!
11 Comparative genomics within the tubercle bacilli! Comparison! M. tuberculosis H37Rv! M. bovis BCG! genetically very similar! but attenuated! the more recent events! other tubercle bacilli! 20 Regions of Difference (RD) described! Gordon et al., 1999 Mol Micro; Behr et al., 1999 Science;!
12 Comparative genomics identifies! Regions of Difference (RD)! Example of RD9! RD region! RD flanking primers! RD flanking primers! M. canettii! M. tuberculosis! M. africanum! M. microti! M. pinnipedii! M. bovis! BCG! RD flanking primers!
13 RD9! M. tuberculosis! sigc! 2325 kb! 2329 kb! Rv2074! 2333 kb! cobl! Rv2075c! Rv2067c! blac! cobk! cobm! Rv2073c! 2325 kb! sigc! RD9 region! sequence conservation! 2329 kb! present in all tested M. tuberculosis strains! cobl! Rv2067c! blac! cobk! of the RD9 junction region! in different subspecies! AAATTACTGTGGCCCTGCGC...!.GGTGGCACGCCGGGCCGG! Rv2074! 2333 kb! Rv2075c! Rv2073c! AAATTACTGTGGCCCACGCCGGGCCGG! M. africanum! M. microti! M. bovis! BCG!
14 Comparative genomics identifies! M. tuberculosis deletion region 1 (TbD1)! TbD flanking primers! TbD region! TbD flanking primers! M. canettii! M. tuberculosis! M. africanum! M. microti! M. pinnipedii! M. bovis! BCG! TbD flanking primers! TbD1= M. tuberculosis deletion region 1!
15 Region TbD1 absent from many M. tuberculosis strains! M. bovis! M. africanum! M. microti! BCG! ancestral M. tub.! M. tuberculosis H37Rv,! M. tuberculosis CDC1551,! M. tuberculosis Beijing 210! M. tuberculosis C! M. tuberculosis F11!
16 Deletion events and the M. tuberculosis complex! most junction regions of RDs are located within genes! deletion events --> not insertion events! conserved deletions! among members of the M. tuberculosis complex! most probably occurred! in a common progenitor strain!
17 M. tuberculosis! Evolutionary pathway of the M. tuberculosis complex! Numerous sequence! polymorphisms! RD can! M. canettii! ancestral, gr.1, SE Asian! Common ancestor of the! M. tuberculosis complex! RD 9! TbD 1! RD 7! RD 8! RD 10! katg c463 CTG CGG! gyra c95 ACC AGC! e.g. gr.1, Beijing! e.g. gr.2, CDC1551! e.g. gr.3, H37Rv! modern! M. africanum! highly clonal population structure! perfect correlation of RDs with SNPs! (and resistance to pyrazinamide)! mmpl6 551 AAC AAG! oxyr n285 G A! RD mic! RD 12! RD 13! RD seal! M. microti! M. pinnipedii (seal)! oryx! no recent horizontal gene transfer! detectable! Brosch et al. 2002, PNAS 99: ! pnca c57 CAC GAC! RD 4! RD 1! RD 2! goat-m. caprae! classical! BCG Tokyo! M. bovis! Mostowy S et al. 2002, J Infect Dis 186:74-80.! RD 14! BCG Pasteur!
18 .. confirmed by genome analysis of M. bovis! M. tuberculosis H37Rv!!4,411,532 bp! M. tuberculosis CDC1551!4,403,836 bp! M. bovis AF2122/97!!4,345,492 bp! Single Nucleotide Polymorphisms! M. tub. H37Rv! 1135! M. tub. CDC1551! 2348! 2380! M. bovis!
19 M. bovis phylogeny! based on SNPs! Garcia Pelayo et al., Infect. Immun., 2009
20 M. tuberculosis! Focus on the M. tuberculosis cluster! Numerous sequence! polymorphisms! RD can! M. canettii! ancestral, gr.1, SE Asian! Common ancestor of the! M. tuberculosis complex! RD 9! TbD 1! RD 7! RD 8! RD 10! katg c463 CTG CGG! gyra c95 ACC AGC! e.g. gr.1, Beijing! e.g. gr.2, CDC1551! e.g. gr.3, H37Rv! modern! M. africanum! mmpl6 551 AAC AAG! RD mic! RD seal! M. microti! oxyr n285 G A! M. pinnipedii (seal)! RD 12! RD 13! oryx! Brosch et al. 2002, Proc Natl Acad Sci U S A. 99: ! pnca c57 CAC GAC! RD 4! RD 1! RD 2! RD 14! goat-m. caprae! classical! BCG Tokyo! BCG Pasteur! M. bovis!
21 Spoligotyping (Spacer-Oligo-Typing) Direct Repeat (DR) region in the genome of
22 Ancestral M. tub.! katg 463 group 1! region TbD1 present,! spacer 33 present! M. tub. Beijing family! katg 463 group 1! region TbD1 absent! spacers 1-34 deleted! M. tub. katg 463 group 2 or 3! region TbD1 absent! spacers deleted! M. bovis! RD7-13 deleted,! spacers deleted! after Kremer et al., J. Clin. Microb., 1998!
23 Example of strains isolated in Bangladesh! Signature! ancestral M. tub.! TbD1 present,! gr.1, katg, CTG! spacer 33 present! TbD1 absent! Delhi family,! gr.1, katg, CTG! Spacers deleted! Beijing family,! gr.1, katg, CTG! Spacers 1-34 deleted! M. tub.,! gr. 2 or 3, katg, CGG! Spacers deleted! Banu et al., J. Clin. Microb., 2004!
24 The oldest cas of human tuberculosis known in Britain (Iron age)! 2,200 years ago! --> TbD1 region deleted --> modern M. tuberculosis! Tb Tb Tayloret al., J Clin Microbiol, 2005!
25 RD-analyses (LSP) allowed to reveal stable association between strains of M. tuberculosis and their human host populations /geographical distribution Hirsh et al. 2004, PNAS! Gagneux et al. 2006, PNAS!
26 Strict correlation! of RDs and SNPs! Baker et al., 2004 Gutacker et al., 2006 Filliol et al., 2006 after Gagneux & Small., Lancet Infect Dis., 2007!
27 Broad diversity! of worldwide! M. tuberculosis! Strains! Multi-Locus-Sequence-Ananlysis! (MLST) based on 89 concatenated! gene sequences for 108 strains! after Hershberg et al., PLoS Biol., 2008!
28 M. tuberculosis! Focus on M. canetti! RD can! M. canettii! ancestral, gr.1, SE Asian! Common ancestor of the! M. tuberculosis complex! RD 9! TbD 1! RD 7! RD 8! RD 10! katg c463 CTG CGG! gyra c95 ACC AGC! e.g. gr.1, Beijing! e.g. gr.2, CDC1551! e.g. gr.3, H37Rv! modern! M. africanum! mmpl6 551 AAC AAG! RD mic! RD seal! M. microti! oxyr n285 G A! M. pinnipedii (seal)! RD 12! RD 13! oryx! Brosch et al. 2002, Proc Natl Acad Sci U S A. 99: ! pnca c57 CAC GAC! RD 4! RD 1! RD 2! RD 14! goat-m. caprae! classical! BCG Tokyo! BCG Pasteur! M. bovis!
29 Mycobacterium canettii and smooth tubercle bacilli! ~ 60 clinical isolates with! smooth colony morphology! Georges Canetti! Smooth tubercle bacilli! from tuberculosis patients! in Djibouti / East Africa! 14 lineages according to molecular! typing characteristics (lineages A-N)! M. tuberculosis! Synonymous SNP x higher than! in the classical M. tuberculosis complex!
30
31 In some of these strains the DR region (groups E, G, H, and I), or IS1081 are missing (groups E, F); Most of the contain ISMyca1, an IS specific of M. canettii in several copies. Almost all show the RD12can deletion
32 Minor variation of 16S rrna sequence M. tub.h37rv M. tub. E M. afr. F A B G C H D I
33 Clear evidence of horizontal transfer among smooth tubercle bacilli gyrb gyra hsp65 rpob katg soda Gutierrez et al., 2005, PLoS Pathog.!
34 High genetic diversity of M. proto-tuberculosis strains Classical Mtb complex M. proto-tuberculosis = pulmonary TB! = lymph node TB! = cutaneous TB! = lymph node TB! 4 M. proto-tuberculosis! strains presently sequenced! at the Génoscope in Evry,! in collaboration with! Philip SUPPLY, IP Lille! 1 M. canettii strain sequenced! at the Sanger Institute! Whole genome restriction profiles XbaI
35 Sequenced at the Génoscope (IPL/IPP)! Sequenced at the Sanger Institute! Phylogenetic distance! of the 14 lineages (A-N)! Classical M. tub. complex! Smooth strains! B A C, D J F L E I H G M N K 56 smooth and 10 MTBC strains, 12 House Keeping Genes! Brisse et al. unpublished
36 Genome sizes of M. prototuberculosis strains! M. prototub. A! M. canetti ! M. prototub. D! ! M. prototub. L! ! M. prototub. K! ! M. prototub. J! ! 4,481 kb! 4,448 kb! 4,437 kb! 4,525 kb! ~ 4,510 kb! M. tub. H37Rv! 4,411kb! M. africanum! 4,389 kb! M. bovis! 4,345 kb!
37 Visualisation of SNPs in M.prototub versus of M.tub. H37Rv and by ACT!
38 Visualisation of SNPs in M.prototub versus of M.tub. H37Rv and by ACT!
39 M. tuberculosis! Conclusions! M. canettii and other extant! M. prototuberculosis strains! M. prototuberculosis! Common ancestor of the! M. tuberculosis complex! The classical M. tuberculosis complex! RD 9! TbD 1! successful lineage that evolved by clonal expansion! Tubercle bacilli are much older than thought! The longer co-evolution explains the paradox between:! katg c463 CTG CGG! gyra c95 ACC AGC! RD 7! RD 8! RD 10! mmpl6 551 AAC AAG! M. tuberculosis being considered as evolutionary young! extraordinary balance of host adaptation (cavities )! Comparison of smooth & classical tubercle bacilli! RD mic! oxyr n285 G A! RD 12! RD 13! RD seal! pnca c57 CAC GAC! RD 4! RD 1! RD 2! RD 14! ancestral, SE Asian! e.g. Beijing! e.g. CDC1551! e.g. H37Rv! M. africanum! M. microti! M. pinnipedii! oryx! goat-m. caprae! classical! BCG Tokyo! BCG Pasteur! modern! M. bovis! potential to identify factors that contributed to the evolutionary succes! of M. tuberculosis!
40 Philip SUPPLY! Michael MARCEAU! Christina GUTIERREZ! Julien TAP! Sylvain BRISSE! Cecile PARMENTIER! Valerie BARBE! Sophie MANGENOT! Stéphane CRUVEILLER! Gregory SALVIGNOL! Claudine MEDIGUE! Steve GORDON! Thierry GARNIER! Stewart COLE! Stephen BENTLEY! Julian PARKHILL!
The Genus Mycobacterium Nonmedical
um- Prokaryotes (2006) 3:889 918 DOI: 10.1007/0-387-30743-5_33 CHAPTER 1.1.18 eth sun Ge lac id nme No - i retcaboc My The Genus Mycobacterium Nonmedical SYBE HARTMANS, JAN A. M. DE BONT AND ERKO STACKEBRANDT
Comprehensive Phylogenetic Analysis of Mycobacteria
Preprints of the 12th IFAC Symposium on Computer Applications in Biotechnology The International Federation of Automatic Control 16-18, 2013, December. Mumbai, India Comprehensive Phylogenetic Analysis
PALAEOMICROBIOLOGICAL EVIDENCES OF THE ORIGIN OF MYCOBACTERIUM TUBERCULOSIS. BY TITUS OLUKITBI - Ph.D. Trainee
PALAEOMICROBIOLOGICAL EVIDENCES OF THE ORIGIN OF MYCOBACTERIUM TUBERCULOSIS BY TITUS OLUKITBI - Ph.D. Trainee PART A GENERAL OVERVIEW OF MYCOBACTERIUM TUBERCULOSIS INTRODUCTION First isolated in 1882.
chapter 5 the mammalian cell entry 1 (mce1) operon of Mycobacterium Ieprae and Mycobacterium tuberculosis
chapter 5 the mammalian cell entry 1 (mce1) operon of Mycobacterium Ieprae and Mycobacterium tuberculosis chapter 5 Harald G. Wiker, Eric Spierings, Marc A. B. Kolkman, Tom H. M. Ottenhoff, and Morten
Pathogenesis of Mycobacterium tuberculosis and its Interaction with the Host Organism. Jean Pieters John D. McKinney Editors
Current Topics in Microbiology and Immunology Jean Pieters John D. McKinney Editors Pathogenesis of Mycobacterium tuberculosis and its Interaction with the Host Organism Current Topics in Microbiology
Computational genomics-proteomics and Phylogeny analysis of twenty one mycobacterial genomes (Tuberculosis & non Tuberculosis strains)
Zakham et al. Microbial Informatics and Experimentation 2012, 2:7 RESEARCH Open Access Computational genomics-proteomics and Phylogeny analysis of twenty one mycobacterial genomes (Tuberculosis & non Tuberculosis
Comparative Genomics and Transcriptomic Analysis of. Mycobacterium Kansasii
Comparative Genomics and Transcriptomic Analysis of Mycobacterium Kansasii Thesis by Yara Alzahid In Partial Fulfilment of the Requirements For the Degree of Master of Science (MSc) King Abdullah University
The Mycobacterial Comparison Project
Chapter 4 The Mycobacterial Comparison Project 4.1 Introduction The possibility and usefulness of a central framework to incorporate data analyses and data storage facilities has been demonstrated. This
A genomic insight into evolution and virulence of Corynebacterium diphtheriae
A genomic insight into evolution and virulence of Corynebacterium diphtheriae Vartul Sangal, Ph.D. Northumbria University, Newcastle vartul.sangal@northumbria.ac.uk @VartulSangal Newcastle University 8
Nature Genetics: doi: /ng Supplementary Figure 1. Icm/Dot secretion system region I in 41 Legionella species.
Supplementary Figure 1 Icm/Dot secretion system region I in 41 Legionella species. Homologs of the effector-coding gene lega15 (orange) were found within Icm/Dot region I in 13 Legionella species. In four
Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
Microbial Taxonomy. Slowly evolving molecules (e.g., rrna) used for large-scale structure; "fast- clock" molecules for fine-structure.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
Table 1: Classification of mycobacteria associated with their growth characteristics. *: Members of the M. tuberculosis-complex.
Introduction 1 1 Introduction Mycobacteria constitute a heterologous genus comprising highly pathogenic species like the members of the Mycobacterium tuberculosis-complex as well as less pathogenic or
A Phylogenetic Analysis of the Genus Nocardia with 16s rrna Gene Sequences
INTERNATIONAL JORNAL OF SYSTEMATIC BACTERIOLOGY, Apr. 1995, p. 240245 00207713/95/$04.00+0 Copyright 0 1995, International nion of Microbiological Societies Vol. 45, No. 2 A Phylogenetic Analysis of the
Molecular phylogeny - Using molecular sequences to infer evolutionary relationships. Tore Samuelsson Feb 2016
Molecular phylogeny - Using molecular sequences to infer evolutionary relationships Tore Samuelsson Feb 2016 Molecular phylogeny is being used in the identification and characterization of new pathogens,
Genomes and Their Evolution
Chapter 21 Genomes and Their Evolution PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
Evidence That Mutation Is Universally Biased towards AT in Bacteria
Evidence That Mutation Is Universally Biased towards AT in Bacteria Ruth Hershberg*, Dmitri A. Petrov Department of Biology, Stanford University, Stanford, California, United States of America Abstract
Microbial Taxonomy. Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
Insights into horizontal acquisition patterns of dormancy and reactivation regulon genes in mycobacterial species using a partitioning-based framework
Insights into horizontal acquisition patterns of dormancy and reactivation regulon genes in mycobacterial species using a partitioning-based framework VARUN MEHRA, TARINI SHANKAR GHOSH and SHARMILA SMANDE*
Microbial Taxonomy and the Evolution of Diversity
19 Microbial Taxonomy and the Evolution of Diversity Copyright McGraw-Hill Global Education Holdings, LLC. Permission required for reproduction or display. 1 Taxonomy Introduction to Microbial Taxonomy
Comparative Sequence Analysis of Mycobacterium leprae and the New Leprosy-Causing Mycobacterium lepromatosis
JOURNAL OF BACTERIOLOGY, Oct. 2009, p. 6067 6074 Vol. 191, No. 19 0021-9193/09/$08.00 0 doi:10.1128/jb.00762-09 Copyright 2009, American Society for Microbiology. All Rights Reserved. Comparative Sequence
Differentiation of Mycobacteria on the Basis of Chemotype
JOU.NAL OF CLINICAL MICROBIOLOGY, Mar. 1993, p. 610-614 Vol. 31, No. 3 0095-1137/93/030610-05$02.00/0 Copyright X 1993, American Society for Microbiology Differentiation of Mycobacteria on the Basis of
Chemometrics. Classification of Mycobacteria by HPLC and Pattern Recognition. Application Note. Abstract
12-1214 Chemometrics Application Note Classification of Mycobacteria by HPLC and Pattern Recognition Abstract Mycobacteria include a number of respiratory and non-respiratory pathogens for humans, such
8/23/2014. Phylogeny and the Tree of Life
Phylogeny and the Tree of Life Chapter 26 Objectives Explain the following characteristics of the Linnaean system of classification: a. binomial nomenclature b. hierarchical classification List the major
Horizontal transfer and pathogenicity
Horizontal transfer and pathogenicity Victoria Moiseeva Genomics, Master on Advanced Genetics UAB, Barcelona, 2014 INDEX Horizontal Transfer Horizontal gene transfer mechanisms Detection methods of HGT
Stepping stones towards a new electronic prokaryotic taxonomy. The ultimate goal in taxonomy. Pragmatic towards diagnostics
Stepping stones towards a new electronic prokaryotic taxonomy - MLSA - Dirk Gevers Different needs for taxonomy Describe bio-diversity Understand evolution of life Epidemiology Diagnostics Biosafety...
Extensive genomic diversity among Mycobacterium marinum strains revealed by whole genome sequencing
www.nature.com/scientificreports Received: 26 arch 2018 Accepted: 25 July 2018 Published: xx xx xxxx OPEN Extensive genomic diversity among ycobacterium marinum strains revealed by whole genome sequencing
Microbial Diversity. Yuzhen Ye I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University
Microbial Diversity Yuzhen Ye (yye@indiana.edu) I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University Contents Microbial diversity Morphological, structural,
The Prokaryotic World
The Prokaryotic World A. An overview of prokaryotic life There is no doubt that prokaryotes are everywhere. By everywhere, I mean living in every geographic region, in extremes of environmental conditions,
Genetic Drift in Human Evolution
Genetic Drift in Human Evolution (Part 2 of 2) 1 Ecology and Evolutionary Biology Center for Computational Molecular Biology Brown University Outline Introduction to genetic drift Modeling genetic drift
How the host sees and responds to pathogens
How the host sees and responds to pathogens David A. Relman, Stanford University IOM Forum on Microbial Threats March 17, 2005 Issues Pathogens and commensals: conserved patterns and pathways Sources of
Computational Identification of Rho-Independent Terminators in the Genomes of Mycobacterium Tuberculosis
Thai Journal of Mathematics Volume 6 (2008) Number 1 : 225 238 www.math.science.cmu.ac.th/thaijournal Computational Identification of Rho-Independent Terminators in the Genomes of Mycobacterium Tuberculosis
The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome
Dr. Dirk Gevers 1,2 1 Laboratorium voor Microbiologie 2 Bioinformatics & Evolutionary Genomics The bacterial species in the genomic era CTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAG GTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGG
Comparative genomics: Overview & Tools + MUMmer algorithm
Comparative genomics: Overview & Tools + MUMmer algorithm Urmila Kulkarni-Kale Bioinformatics Centre University of Pune, Pune 411 007. urmila@bioinfo.ernet.in Genome sequence: Fact file 1995: The first
GENERAL INTRODUCTION 1
GENERAL INTRODUCTION 1 Chapter 1 Tuberculosis Tuberculosis (TB) is an airborne infectious disease that has plagued mankind for thousands of years. TB is caused by a group of closely related bacterial species
is that biomedically relevant traits, such as host range nonsynonymous single nucleotide polymorphisms (SNPs),
Copyright 2002 by the Genetics Society of America Genome-Wide Analysis of Synonymous Single Nucleotide Polymorphisms in Mycobacterium tuberculosis Complex Organisms: Resolution of Genetic Relationships
Estimation of gene insertion/deletion rates with missing data
Genetics: Early Online, published on August 26, 2016 as 10.1534/genetics.116.191973 Estimation of gene insertion/deletion rates with missing data Utkarsh J. Dang 1,2, Alison M. Devault 3, Tatum D. Mortimer
Microbiology Helmut Pospiech
Microbiology http://researchmagazine.uga.edu/summer2002/bacteria.htm 05.04.2018 Helmut Pospiech The Species Concept in Microbiology No universally accepted concept of species for prokaryotes Current definition
Evolution and pathogenicity in the deadly chytrid pathogen of amphibians. Erica Bree Rosenblum UC Berkeley
Evolution and pathogenicity in the deadly chytrid pathogen of amphibians Erica Bree Rosenblum UC Berkeley Emerging infectious disease Emerging infectious disease EID events have risen significantly over
Chapters 25 and 26. Searching for Homology. Phylogeny
Chapters 25 and 26 The Origin of Life as we know it. Phylogeny traces evolutionary history of taxa Systematics- analyzes relationships (modern and past) of organisms Figure 25.1 A gallery of fossils The
COMPARATIVE GENOMIC ANALYSIS OF MYCOBACTERIA (ACTINOBACTERIA): REDUNDANCY IN FUNCTION AMONG SERINE THREONINE PROTEIN KINASES
G.J.B.B., VOL.2 (3) 2013: 393-398 ISSN 2278 9103 COMPARATIVE GENOMIC ANALYSIS OF MYCOBACTERIA (ACTINOBACTERIA): REDUNDANCY IN FUNCTION AMONG SERINE THREONINE PROTEIN KINASES Harini Laxminarayan 1* & Sujatha
Growth of Mycobacterium tuberculosis in a Defined Medium Is Very Restricted by Acid ph and Mg 2 Levels
INFECTION AND IMMUNITY, Aug. 2000, p. 4518 4522 Vol. 68, No. 8 0019-9567/00/$04.00 0 Copyright 2000, American Society for Microbiology. All Rights Reserved. Growth of Mycobacterium tuberculosis in a Defined
Chapter 26: Phylogeny and the Tree of Life Phylogenies Show Evolutionary Relationships
Chapter 26: Phylogeny and the Tree of Life You Must Know The taxonomic categories and how they indicate relatedness. How systematics is used to develop phylogenetic trees. How to construct a phylogenetic
Host-pathogen association analysis of tuberculosis patients via Unified Biclustering Framework
Host-pathogen association analysis of tuberculosis patients via Unified Biclustering Framework Cagri Ozcaglar 1, Bülent Yener 1, and Kristin P. Bennett 1,2 1 Computer Science Department, Rensselaer Polytechnic
Bio 1B Lecture Outline (please print and bring along) Fall, 2007
Bio 1B Lecture Outline (please print and bring along) Fall, 2007 B.D. Mishler, Dept. of Integrative Biology 2-6810, bmishler@berkeley.edu Evolution lecture #5 -- Molecular genetics and molecular evolution
MiGA: The Microbial Genome Atlas
December 12 th 2017 MiGA: The Microbial Genome Atlas Jim Cole Center for Microbial Ecology Dept. of Plant, Soil & Microbial Sciences Michigan State University East Lansing, Michigan U.S.A. Where I m From
What examples can you think of?
What examples can you think of? Geocentrism Alchemy Heliocentrism: Copernicus, Kepler, Newton, Galileo Nature of the chemical bond (Rutherford, Pauling ) Aristotelian view of the biosphere Woese/Pace (subject
Phylogeny and systematics. Why are these disciplines important in evolutionary biology and how are they related to each other?
Phylogeny and systematics Why are these disciplines important in evolutionary biology and how are they related to each other? Phylogeny and systematics Phylogeny: the evolutionary history of a species
Introduction to polyphasic taxonomy
Introduction to polyphasic taxonomy Peter Vandamme EUROBILOFILMS - Third European Congress on Microbial Biofilms Ghent, Belgium, 9-12 September 2013 http://www.lm.ugent.be/ Content The observation of diversity:
Concepts and Methods in Molecular Divergence Time Estimation
Concepts and Methods in Molecular Divergence Time Estimation 26 November 2012 Prashant P. Sharma American Museum of Natural History Overview 1. Why do we date trees? 2. The molecular clock 3. Local clocks
Understanding relationship between homologous sequences
Molecular Evolution Molecular Evolution How and when were genes and proteins created? How old is a gene? How can we calculate the age of a gene? How did the gene evolve to the present form? What selective
This is a repository copy of Microbiology: Mind the gaps in cellular evolution.
This is a repository copy of Microbiology: Mind the gaps in cellular evolution. White Rose Research Online URL for this paper: http://eprints.whiterose.ac.uk/114978/ Version: Accepted Version Article:
Lecture 11 Friday, October 21, 2011
Lecture 11 Friday, October 21, 2011 Phylogenetic tree (phylogeny) Darwin and classification: In the Origin, Darwin said that descent from a common ancestral species could explain why the Linnaean system
Outline Classes of diversity measures. Species Divergence and the Measurement of Microbial Diversity. How do we describe and compare diversity?
Species Divergence and the Measurement of Microbial Diversity Cathy Lozupone University of Colorado, Boulder. Washington University, St Louis. Outline Classes of diversity measures α vs β diversity Quantitative
Origins of Life. Fundamental Properties of Life. Conditions on Early Earth. Evolution of Cells. The Tree of Life
The Tree of Life Chapter 26 Origins of Life The Earth formed as a hot mass of molten rock about 4.5 billion years ago (BYA) -As it cooled, chemically-rich oceans were formed from water condensation Life
Drosophila melanogaster and D. simulans, two fruit fly species that are nearly
Comparative Genomics: Human versus chimpanzee 1. Introduction The chimpanzee is the closest living relative to humans. The two species are nearly identical in DNA sequence (>98% identity), yet vastly different
Fitness constraints on horizontal gene transfer
Fitness constraints on horizontal gene transfer Dan I Andersson University of Uppsala, Department of Medical Biochemistry and Microbiology, Uppsala, Sweden GMM 3, 30 Aug--2 Sep, Oslo, Norway Acknowledgements:
Massive gene acquisitions in Mycobacterium indicus pranii provide a perspective on mycobacterial evolution
10832 10850 Nucleic Acids Research, 2012, Vol. 40, No. 21 Published online 10 September 2012 doi:10.1093/nar/gks793 Massive gene acquisitions in Mycobacterium indicus pranii provide a perspective on mycobacterial
Mycobacterium interjectum, a New Species Isolated from a
JOURNAL OF CLINICAL MICROBIOLOGY, Dec. 1993, p. 383-389 95-1137/93/12383-7$2./ Copyright 1993, American Society for Microbiology Vol. 31, No. 12 Mycobacterium interjectum, a New Species Isolated from a
Leber s Hereditary Optic Neuropathy
Leber s Hereditary Optic Neuropathy Dear Editor: It is well known that the majority of Leber s hereditary optic neuropathy (LHON) cases was caused by 3 mtdna primary mutations (m.3460g A, m.11778g A, and
Genomic expression catalogue of a global collection of BCG vaccine strains. show evidence for highly diverged metabolic and cell-wall adaptations.
Genomic expression catalogue of a global collection of BCG vaccine strains show evidence for highly diverged metabolic and cell-wall adaptations. Abdallah M. Abdallah 1 *, Grant A. Hill-Cawthorne 1,2,
CRISPR-SeroSeq: A Developing Technique for Salmonella Subtyping
Department of Biological Sciences Seminar Blog Seminar Date: 3/23/18 Speaker: Dr. Nikki Shariat, Gettysburg College Title: Probing Salmonella population diversity using CRISPRs CRISPR-SeroSeq: A Developing
Computational approaches for functional genomics
Computational approaches for functional genomics Kalin Vetsigian October 31, 2001 The rapidly increasing number of completely sequenced genomes have stimulated the development of new methods for finding
Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha
Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha Plasmids 1. Extrachromosomal DNA, usually circular-parasite 2. Usually encode ancillary
Introduction to Bioinformatics Integrated Science, 11/9/05
1 Introduction to Bioinformatics Integrated Science, 11/9/05 Morris Levy Biological Sciences Research: Evolutionary Ecology, Plant- Fungal Pathogen Interactions Coordinator: BIOL 495S/CS490B/STAT490B Introduction
Chapter 19. Microbial Taxonomy
Chapter 19 Microbial Taxonomy 12-17-2008 Taxonomy science of biological classification consists of three separate but interrelated parts classification arrangement of organisms into groups (taxa; s.,taxon)
Chapter 26 Phylogeny and the Tree of Life
Chapter 26 Phylogeny and the Tree of Life Chapter focus Shifting from the process of how evolution works to the pattern evolution produces over time. Phylogeny Phylon = tribe, geny = genesis or origin
Lecture Notes: BIOL2007 Molecular Evolution
Lecture Notes: BIOL2007 Molecular Evolution Kanchon Dasmahapatra (k.dasmahapatra@ucl.ac.uk) Introduction By now we all are familiar and understand, or think we understand, how evolution works on traits
SPECIES OF ARCHAEA ARE MORE CLOSELY RELATED TO EUKARYOTES THAN ARE SPECIES OF PROKARYOTES.
THE TERMS RUN AND TUMBLE ARE GENERALLY ASSOCIATED WITH A) cell wall fluidity. B) cell membrane structures. C) taxic movements of the cell. D) clustering properties of certain rod-shaped bacteria. A MAJOR
Genome reduction in prokaryotic obligatory intracellular parasites of humans: a comparative analysis
International Journal of Systematic and Evolutionary Microbiology (2004), 54, 1937 1941 DOI 10.1099/ijs.0.63090-0 Genome reduction in prokaryotic obligatory intracellular parasites of humans: a comparative
In silico analysis of subcellular localization of putative proteins of Mycobacterium tuberculosis H37Rv strain
ISPUB.COM The Internet Journal of Health Volume 7 Number 1 In silico analysis of subcellular localization of putative proteins of Mycobacterium tuberculosis H37Rv P Somvanshi, V Singh, P Seth Citation
Taxonomy. Content. How to determine & classify a species. Phylogeny and evolution
Taxonomy Content Why Taxonomy? How to determine & classify a species Domains versus Kingdoms Phylogeny and evolution Why Taxonomy? Classification Arrangement in groups or taxa (taxon = group) Nomenclature
Supplementary Information for Hurst et al.: Causes of trends of amino acid gain and loss
Supplementary Information for Hurst et al.: Causes of trends of amino acid gain and loss Methods Identification of orthologues, alignment and evolutionary distances A preliminary set of orthologues was
Warm-Up- Review Natural Selection and Reproduction for quiz today!!!! Notes on Evidence of Evolution Work on Vocabulary and Lab
Date: Agenda Warm-Up- Review Natural Selection and Reproduction for quiz today!!!! Notes on Evidence of Evolution Work on Vocabulary and Lab Ask questions based on 5.1 and 5.2 Quiz on 5.1 and 5.2 How
UoN, CAS, DBSC BIOL102 lecture notes by: Dr. Mustafa A. Mansi. The Phylogenetic Systematics (Phylogeny and Systematics)
- Phylogeny? - Systematics? The Phylogenetic Systematics (Phylogeny and Systematics) - Phylogenetic systematics? Connection between phylogeny and classification. - Phylogenetic systematics informs the
SWEEPFINDER2: Increased sensitivity, robustness, and flexibility
SWEEPFINDER2: Increased sensitivity, robustness, and flexibility Michael DeGiorgio 1,*, Christian D. Huber 2, Melissa J. Hubisz 3, Ines Hellmann 4, and Rasmus Nielsen 5 1 Department of Biology, Pennsylvania
Modeling Bacterial Evolution with Comparative-Genome-Based Marker Systems: Application to Mycobacterium tuberculosis Evolution and Pathogenesis
JOURNAL OF BACTERIOLOGY, June 2003, p. 3392 3399 Vol. 185, No. 11 0021-9193/03/$08.00 0 DOI: 10.1128/JB.185.11.3392 3399.2003 Copyright 2003, American Society for Microbiology. All Rights Reserved. Modeling
Outline. I. Methods. II. Preliminary Results. A. Phylogeny Methods B. Whole Genome Methods C. Horizontal Gene Transfer
Comparative Genomics Preliminary Results April 4, 2016 Juan Castro, Aroon Chande, Cheng Chen, Evan Clayton, Hector Espitia, Alli Gombolay, Walker Gussler, Ken Lee, Tyrone Lee, Hari Prasanna, Carlos Ruiz,
A. Incorrect! In the binomial naming convention the Kingdom is not part of the name.
Microbiology Problem Drill 08: Classification of Microorganisms No. 1 of 10 1. In the binomial system of naming which term is always written in lowercase? (A) Kingdom (B) Domain (C) Genus (D) Specific
Human Evolution
http://www.pwasoh.com.co Human Evolution Cantius, ca 55 mya The continent-hopping habits of early primates have long puzzled scientists, and several scenarios have been proposed to explain how the first
BINF6201/8201. Molecular phylogenetic methods
BINF60/80 Molecular phylogenetic methods 0-7-06 Phylogenetics Ø According to the evolutionary theory, all life forms on this planet are related to one another by descent. Ø Traditionally, phylogenetics
Human Evolution. Darwinius masillae. Ida Primate fossil from. in Germany Ca.47 M years old. Cantius, ca 55 mya
http://www.pwasoh.com Human Evolution Cantius, ca 55 mya The continent-hopping habits of early primates have long puzzled scientists, and several scenarios have been proposed to explain how the first true
How to Use This Presentation
How to Use This Presentation To View the presentation as a slideshow with effects select View on the menu bar and click on Slide Show. To advance through the presentation, click the right-arrow key or
I519 Introduction to Bioinformatics, Genome Comparison. Yuzhen Ye School of Informatics & Computing, IUB
I519 Introduction to Bioinformatics, 2015 Genome Comparison Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Whole genome comparison/alignment Build better phylogenies Identify polymorphism
Outline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/8/16
Genome Evolution Outline 1. What: Patterns of Genome Evolution Carol Eunmi Lee Evolution 410 University of Wisconsin 2. Why? Evolution of Genome Complexity and the interaction between Natural Selection
Homology and Information Gathering and Domain Annotation for Proteins
Homology and Information Gathering and Domain Annotation for Proteins Outline Homology Information Gathering for Proteins Domain Annotation for Proteins Examples and exercises The concept of homology The
Biology 211 (2) Week 1 KEY!
Biology 211 (2) Week 1 KEY Chapter 1 KEY FIGURES: 1.2, 1.3, 1.4, 1.5, 1.6, 1.7 VOCABULARY: Adaptation: a trait that increases the fitness Cells: a developed, system bound with a thin outer layer made of
Microbiota: Its Evolution and Essence. Hsin-Jung Joyce Wu "Microbiota and man: the story about us
Microbiota: Its Evolution and Essence Overview q Define microbiota q Learn the tool q Ecological and evolutionary forces in shaping gut microbiota q Gut microbiota versus free-living microbe communities
Alternative tools for phylogeny. Identification of unique core sequences
Alternative tools for phylogeny Identification of unique core sequences Workshop on Whole Genome Sequencing and Analysis, 19-21 Mar. 2018 Learning objective: After this lecture you should be able to account
Practical Bioinformatics
5/2/2017 Dictionaries d i c t i o n a r y = { A : T, T : A, G : C, C : G } d i c t i o n a r y [ G ] d i c t i o n a r y [ N ] = N d i c t i o n a r y. h a s k e y ( C ) Dictionaries g e n e t i c C o
The Division between Fast- and Slow-Growing Species Corresponds to Natural Relationships among the Mycobacteria
JOURNL OF BTERIOLOGY, Jan. 1990, p. 116-124 Vol. 172, No. 1 0021-9193/90/010116-09$02.00/0 opyright X 1990, merican Society for Microbiology The Division between Fast- and Slow-Growing Species orresponds
SCIENTIFIC EVIDENCE TO SUPPORT THE THEORY OF EVOLUTION. Using Anatomy, Embryology, Biochemistry, and Paleontology
SCIENTIFIC EVIDENCE TO SUPPORT THE THEORY OF EVOLUTION Using Anatomy, Embryology, Biochemistry, and Paleontology Scientific Fields Different fields of science have contributed evidence for the theory of
MOLECULAR PHYLOGENY AND GENETIC DIVERSITY ANALYSIS. Masatoshi Nei"
MOLECULAR PHYLOGENY AND GENETIC DIVERSITY ANALYSIS Masatoshi Nei" Abstract: Phylogenetic trees: Recent advances in statistical methods for phylogenetic reconstruction and genetic diversity analysis were
Phylogeny and the Tree of Life
Chapter 26 Phylogeny and the Tree of Life PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
Bioinformatics Study On Mirror DNA In Mycobacterium Tuberculosis Using Fast Parallel Complement Blast Strategy.
INTERNATIONAL JOURNAL OF SCIENTIFIC & TECHNOLOGY RESEARCH VOLUME 4, ISSUE 2, DECEMBER 205 ISSN 2277-866 Bioinformatics Study On Mirror DNA In Mycobacterium Tuberculosis Using Fast Parallel Complement Blast
Strategies Used by Pathogenic and Nonpathogenic Mycobacteria To Synthesize rrna
JOURNAL OF BACTERIOLOGY, Nov. 1997, p. 6949 6958 Vol. 179, No. 22 0021-9193/97/$04.00 0 Copyright 1997, American Society for Microbiology Strategies Used by Pathogenic and Nonpathogenic Mycobacteria To
Chapter 16: Reconstructing and Using Phylogenies
Chapter Review 1. Use the phylogenetic tree shown at the right to complete the following. a. Explain how many clades are indicated: Three: (1) chimpanzee/human, (2) chimpanzee/ human/gorilla, and (3)chimpanzee/human/
The invention of the microscope has opened to us a world of extraordinary numbers. A singular drop of pond water reveals countless life forms
Biology Chapter 19 Notes - Bacteria and Viruses The invention of the microscope has opened to us a world of extraordinary numbers. A singular drop of pond water reveals countless life forms I. Classifying
11/5/2018. Update on Modern Bacterial Taxonomy for Bench Microbiologists. Why is Taxonomy Important? Bacterial Taxonomy for Clinical Microbiologists
Update on Modern Bacterial Taxonomy for Bench Microbiologists J. Michael Janda Kern County Public Health Laboratory Bakersfield CA The Name Game Which Ones Different? Why is Taxonomy Important? Bacterial
Rapid speciation following recent host shift in the plant pathogenic fungus Rhynchosporium
Rapid speciation following recent host shift in the plant pathogenic fungus Rhynchosporium Tiziana Vonlanthen, Laurin Müller 27.10.15 1 Second paper: Origin and Domestication of the Fungal Wheat Pathogen