Apoptosis in Mammalian Cells

Size: px
Start display at page:

Download "Apoptosis in Mammalian Cells"

Transcription

1 Apoptosis in Mammalian Cells

2 Apoptosis is an important factor in many human diseases Cancer malignant cells evade death by suppressing apoptosis (too little apoptosis) Stroke damaged neurons commit apoptosis, leading to more extensive damage (too much apoptosis) Autoimmune disorders immune cells survive for too long, leading to over-reactive immune response (too little apoptosis)

3 The death receptor pathway In mammals, there is a family of death ligands that bind to receptors on the cell surface, sending a pro-apoptotic signal to the cell Y Y Y Y Die!

4 Death ligand family members FasL very important in the immune system TNF (Tumor necrosis factor) controls inflammatory responses TRAIL selectively kills tumor cells; currently in clinical trials as an anti-cancer agent

5 FasL FADD FADD Bid casp8 Bax Bax IAP IAP casp3 casp3 casp9 cyto c Smac Smac

6 Tools for observing apoptosis Immunofluorescence mircroscopy Flow cytometry Live cell microscopy

7 Principles of Fluorescence Two diagrams removed for copyright reasons.

8 Immunofluorescence can detect specific proteins in cells

9 Immunofluorescence can detect specific proteins in cells Fix with formaldehyde

10 Immunofluorescence can detect specific proteins in cells Fix with formaldehyde Permeablize with detergent

11 Immunofluorescence can detect specific proteins in cells Antibodies bind to specific proteins. We can generate antibodies to nearly any protein we re interested in. We can label antibodies with fluorescent molecules. Fluorescently labeled antibodies can reveal the location of specific proteins in the cell.

12 Detecting apoptosis with immunofluorescence microscopy DNA Cleaved cytokeratin Cleaved caspase-3 Blue: DNA Green: cleaved cytok Red: cleaved casp3

13 Determining the order of apoptotic events Blue: H33342 Green: cytochromec Red: cleaved casp3

14 Quantitating apoptosis using flow cytometry Cytokeratin cleavage Green fluorescence Healthy cells Late apoptotic cells Early apoptotic cells Red fluorescence Caspase 3 cleavage

15 Combining flow cytometry with RNAi +TNF Cytokeratin cleavage No RNAi Caspase 8 RNAi Bid RNAi Caspase 3 cleavage

16 Green Fluorescent Protein a genetically encoded fluorescent tag Diagram removed for copyright reasons.

17 The fluorescent protein family Jellyfish Aequoria victoria Reef coral Green fluorescent protein Red fluorescent protein Engineered mutations Blue fluorescent protein Cyan fluorescent protein Yellow fluorescent protein

18 GFP has been engineered to make blue and yellow variants; red fluorescent proteins have been isolated from other sea creatures Two photos removed for copyright reasons.

19 GFP can be spliced into any gene DNA sequence atgactgacagtccattaccggactttga atgttcagggatcccataattagtga Unfolded protein Folded protein atgactgacagtccattaccggacttatgttcagggatcccataattagtga

20 FRET a phenomenon that occurs when 2 fluorescent molecules are very close FRET! No FRET cfp yfp cfp yfp < 6 nm > 6 nm FRET: Forster Resonance Energy Transfer

21 A FRET-based caspase activity reporter FRET! cfp DEVD yfp cfp DEVD casp3 yfp Excitation with UV light. Energy transfer from CFP to YFP. Emission of yellow light. Cleavage of substrate by caspase-3. cfp DEVD yfp Excitation with UV light. Emission of cyan light.

22 Monitoring caspase activity over time in living cells healthy cell dying cell FRET ratio

23 FRET reporters can be modified to detect different caspase activities cfp DEVD yfp Caspase-3 cfp yfp Caspase-8 IETD cfp LEHD yfp Caspase-9

24 Much of the apoptotic pathway is conserved Mammals Fas Death signals Flies Eiger Death signals FADD ciap FADD casp8 Bid Dredd Bax Bcl2 Debcl Buffy cytoc cytoc casp3 casp9 Smac Dcp Drice Dronc Rpr Grim Hid XIAP DIAP

25 But the importance of certain pathways changes Mammals Flies Fas Eiger FADD ciap FADD casp8 Bid Dredd Bax Debcl Buffy Bcl2 cytoc cytoc Rpr Grim Hid casp3 casp9 Smac Dcp Drice Dronc XIAP DIAP

26 Recent development XIAP is important in human cancer cells See Li, L. et al. A Small Molecule Smac Mimic Potentiates TRAIL- and TNF-α Mediated Cell Death. Science 305 no (2004 Sep 3):

27 Even within a species, differences are observed Fas Human Cancer cell 1 Fas Human Cancer cell 2 FADD ciap FADD ciap casp8 Bid casp8 Bid Bax Bcl2 Bax Bcl2 cytoc cytoc casp3 casp9 Smac casp3 casp9 Smac XIAP XIAP

28

29 A computational model of caspase activation

30 Studying apoptosis to learn how cells make decisions Internal state Death signals Survival signals Diagram removed for copyright reasons. Die?

31 Quantitating apoptosis using flow cytometry Effector Caspase Activity (cytokeratin cleavage) Untreated TNF treated TNF treated, Bax -/- Initiator Caspase Activity (caspase 3 cleavage)

32 The order of apoptotic events varies between human cancer cells Hct-116 HeLa Blue: H33342 Green: cleaved cytok Red: cleaved casp3

Drosophila Apoptosis and the Regulation of the Caspase Cascade

Drosophila Apoptosis and the Regulation of the Caspase Cascade Drosophila Apoptosis and the Regulation of the Caspase Cascade Kate Stafford March 18, 2005 Abstract The caspase cascade in Drosophila is controlled primarily by DIAP1 (Drosophila inhibitor of apoptosis),

More information

Apoptosis: Death Comes for the Cell

Apoptosis: Death Comes for the Cell Apoptosis: Death Comes for the Cell Joe W. Ramos joeramos@hawaii.edu From Ingmar Bergman s The Seventh Seal 1 2 Mutations in proteins that regulate cell proliferation, survival and death can contribute

More information

Mechanisms. Cell Death. Carol M. Troy, MD PhD August 24, 2009 PHENOMENOLOGY OF CELL DEATH I. DEVELOPMENT 8/20/2009

Mechanisms. Cell Death. Carol M. Troy, MD PhD August 24, 2009 PHENOMENOLOGY OF CELL DEATH I. DEVELOPMENT 8/20/2009 Mechanisms of Cell Death Carol M. Troy, MD PhD August 24, 2009 PHENOMENOLOGY OF CELL DEATH I. DEVELOPMENT A. MORPHOGENESIS: SCULPTING/SHAPING STRUCTURES CREATION OF CAVITIES AND TUBES FUSION OF TISSUE

More information

Modeling a Snap-Action, Variable-Delay Switch Controlling Extrinsic Cell Death

Modeling a Snap-Action, Variable-Delay Switch Controlling Extrinsic Cell Death Modeling a Snap-Action, Variable-Delay Switch Controlling Extrinsic Cell Death John G. Albeck 1[, John M. Burke 1,2[, Sabrina L. Spencer 1,3, Douglas A. Lauffenburger 2,3, Peter K. Sorger 1,2* PLoS BIOLOGY

More information

TO DIE OR TO DIFFERENTIATE: APOPTOTIC AND NON-APOPTOTIC ROLES OF DEATH MOLECULES IN DROSOPHILA MELANOGASTER

TO DIE OR TO DIFFERENTIATE: APOPTOTIC AND NON-APOPTOTIC ROLES OF DEATH MOLECULES IN DROSOPHILA MELANOGASTER TO DIE OR TO DIFFERENTIATE: APOPTOTIC AND NON-APOPTOTIC ROLES OF DEATH MOLECULES IN DROSOPHILA MELANOGASTER Thesis by Jun Ryul Huh In Partial Fulfillment of the Requirements for the Degree of Doctor of

More information

Mechanisms of Cell Death

Mechanisms of Cell Death Mechanisms of Cell Death CELL DEATH AND FORMATION OF THE SEMICIRCULAR CANALS Carol M. Troy, MD PhD August 24, 2009 FROM: Fekete et al., Development 124: 2451 (1997) PHENOMENOLOGY OF CELL DEATH I. DEVELOPMENT

More information

Chang 1. Characterization of the Drosophila Ortholog of the Mammalian Anti-apoptotic Protein Aven

Chang 1. Characterization of the Drosophila Ortholog of the Mammalian Anti-apoptotic Protein Aven Chang 1 Characterization of the Drosophila Ortholog of the Mammalian Anti-apoptotic Protein Aven Joy Chang Georgetown University Senior Digital Thesis May 1, 2006 Chang 2 Table of Contents BACKGROUND 4

More information

http://cwp.embo.org/w09-13/index.html Roads to Ruin is s o t p o ap healthy cell autophagic cell death ne cr os is Thanks to Seamus Martin! Evolution of apoptosis signalling cascades Inhibitor Adopted

More information

Apoptosis EXTRA REQUIREMETS

Apoptosis EXTRA REQUIREMETS Apoptosis Introduction (SLIDE 1) Organisms develop from a single cell, and in doing so an anatomy has to be created. This process not only involves the creation of new cells, but also the removal of cells

More information

A. Incorrect! The Cell Cycle contains 4 distinct phases: (1) G 1, (2) S Phase, (3) G 2 and (4) M Phase.

A. Incorrect! The Cell Cycle contains 4 distinct phases: (1) G 1, (2) S Phase, (3) G 2 and (4) M Phase. Molecular Cell Biology - Problem Drill 21: Cell Cycle and Cell Death Question No. 1 of 10 1. Which of the following statements about the cell cycle is correct? Question #1 (A) The Cell Cycle contains 3

More information

Exploring the Contextual Sensitivity of Factors that Determine Cellto-Cell Variability in Receptor-Mediated Apoptosis

Exploring the Contextual Sensitivity of Factors that Determine Cellto-Cell Variability in Receptor-Mediated Apoptosis Exploring the Contextual Sensitivity of Factors that Determine Cellto-Cell Variability in Receptor-Mediated Apoptosis The Harvard community has made this article openly available. Please share how this

More information

Cell Death & Trophic Factors II. Steven McLoon Department of Neuroscience University of Minnesota

Cell Death & Trophic Factors II. Steven McLoon Department of Neuroscience University of Minnesota Cell Death & Trophic Factors II Steven McLoon Department of Neuroscience University of Minnesota 1 Remember? Neurotrophins are cell survival factors that neurons get from their target cells! There is a

More information

Cell Survival Curves (Chap. 3)

Cell Survival Curves (Chap. 3) Cell Survival Curves (Chap. 3) Example of pedigress of EMT6 mouse cells Clone The in vitro cell survival curve Cell Survival Assay Dye exclusion assay: membrane integrity MTT assay: respiratory activity

More information

Programmed Cell Death

Programmed Cell Death Programmed Cell Death Dewajani Purnomosari Department of Histology and Cell Biology Faculty of Medicine Universitas Gadjah Mada d.purnomosari@ugm.ac.id What is apoptosis? a normal component of the development

More information

TNFα 18hr. Control. CHX 18hr. TNFα+ CHX 18hr. TNFα: 18 18hr (KDa) PARP. Cleaved. Cleaved. Cleaved. Caspase3. Pellino3 shrna. Control shrna.

TNFα 18hr. Control. CHX 18hr. TNFα+ CHX 18hr. TNFα: 18 18hr (KDa) PARP. Cleaved. Cleaved. Cleaved. Caspase3. Pellino3 shrna. Control shrna. Survival ( %) a. TNFα 18hr b. Control sirna Pellino3 sirna TNFα: 18 18hr c. Control shrna Pellino3 shrna Caspase3 Actin Control d. Control shrna Pellino3 shrna *** 100 80 60 CHX 18hr 40 TNFα+ CHX 18hr

More information

TRAIL-induced apoptosis requires Bax-dependent mitochondrial release of Smac/DIABLO

TRAIL-induced apoptosis requires Bax-dependent mitochondrial release of Smac/DIABLO TRAIL-induced apoptosis requires Bax-dependent mitochondrial release of Smac/DIABLO Yibin Deng, Yahong Lin, and Xiangwei Wu 1 Huffington Center on Aging and Department of Molecular and Cellular Biology,

More information

Apoptosis and Carcinogenesis

Apoptosis and Carcinogenesis Death Becomes Us: Apoptosis and Carcinogenesis by Michele M. Cox Department of Biology, University of the Virgin Islands Part I What Is Cancer? Hi, Derek. Studying for your Cell and Molec final? asked

More information

The Caspase System: a potential role in muscle proteolysis and meat quality? Tim Parr

The Caspase System: a potential role in muscle proteolysis and meat quality? Tim Parr The Caspase System: a potential role in muscle proteolysis and meat quality? Tim Parr Caroline Kemp, Ron Bardsley,, Peter Buttery Division of Nutritional Sciences, School of Biosciences, University of

More information

Cell-cell communication in development Review of cell signaling, paracrine and endocrine factors, cell death pathways, juxtacrine signaling, differentiated state, the extracellular matrix, integrins, epithelial-mesenchymal

More information

Monte Carlo study elucidates the type 1/type 2 choice in apoptotic death signaling in normal and cancer cells

Monte Carlo study elucidates the type 1/type 2 choice in apoptotic death signaling in normal and cancer cells Cells 2013, 2, 1-x manuscripts; doi:10.3390/cells20x000x OPEN ACCESS cells ISSN 2073-4409 www.mdpi.com/journal/cells Article Monte Carlo study elucidates the type 1/type 2 choice in apoptotic death signaling

More information

Proteases for Cell Suicide: Functions and Regulation of Caspases

Proteases for Cell Suicide: Functions and Regulation of Caspases MICROBIOLOGY AND MOLECULAR BIOLOGY REVIEWS, Dec. 2000, p. 821 846 Vol. 64, No. 4 1092-2172/00/$04.00 0 Copyright 2000, American Society for Microbiology. All Rights Reserved. Proteases for Cell Suicide:

More information

Death signaling. Color PDF file of handouts can be found at Wu lab web-page:

Death signaling. Color PDF file of handouts can be found at Wu lab web-page: Death signaling Hao Wu References 1. Wang, X. The expanding role of mitochondria in apoptosis. Genes Dev 15, 2922-2933. (2001). 2. Fesik, S. W. Insights into programmed cell death through structural biology.

More information

Apoptosis: Death comes for the Cell. Apoptosis: Programmed Cell Death. Apoptosis. Necrosis

Apoptosis: Death comes for the Cell. Apoptosis: Programmed Cell Death. Apoptosis. Necrosis poptosis: eath comes for the Cell Mutations in proteins that regulate cell proliferation, survival and death can contribute to oncogenesis Joe W. Ramos jramos@crch.hawaii.edu From Ingmar Bergman s The

More information

Apoptosis and Cancer. Carol M. Troy, MD, PhD October 26, 2016

Apoptosis and Cancer. Carol M. Troy, MD, PhD October 26, 2016 Apoptosis and Cancer Carol M. Troy, MD, PhD October 26, 2016 PHENOMENOLOGY OF CELL DEATH -1 I. DEVELOPMENT A. MORPHOGENESIS: SCULPTING/SHAPING STRUCTURES FUSION OF TISSUE MASSES (PALATE/NEURAL TUBE) CREATION

More information

Caspase-Dependent Cell Death in Drosophila

Caspase-Dependent Cell Death in Drosophila Annu. Rev. Cell Dev. Biol. 2006. 22:623 50 First published online as a Review in Advance on July 14, 2006 The Annual Review of Cell and Developmental Biology is online at http://cellbio.annualreviews.org

More information

Validation of Petri Net Apoptosis Models Using P-Invariant Analysis

Validation of Petri Net Apoptosis Models Using P-Invariant Analysis 2009 IEEE International Conference on Control and Automation Christchurch, New Zealand, December 9-11, 2009 WeMT5.1 Validation of Petri Net Apoptosis Models Using P-Invariant Analysis Ian Wee Jin Low,

More information

Supplementary Figure 1. AnnexinV FITC and Sytox orange staining in wild type, Nlrp3 /, ASC / and casp1/11 / TEC treated with TNF /CHX.

Supplementary Figure 1. AnnexinV FITC and Sytox orange staining in wild type, Nlrp3 /, ASC / and casp1/11 / TEC treated with TNF /CHX. Supplementary Figure 1. AnnexinV FITC and Sytox orange staining in wild type, Nlrp3 /, ASC / and casp1/11 / TEC treated with TNF /CHX. Phase contrast and widefield fluorescence microscopy (20x magnification).

More information

C. elegans apoptosis pathway CED-4 APAF-1. Ced-1 Ced-2 Ced-5 Ced-6 Ced-7 Ced-10 Ced-12 PSR Lrp CrkII Dock180 Gulp ABC-1 Rac Elmo PSR

C. elegans apoptosis pathway CED-4 APAF-1. Ced-1 Ced-2 Ced-5 Ced-6 Ced-7 Ced-10 Ced-12 PSR Lrp CrkII Dock180 Gulp ABC-1 Rac Elmo PSR C. elegans apoptosis pathway EGL-1 BH3 CED-9 BCL2 CED-4 APAF-1 CED-3 CASPASE-9 Effector caspases Subtrates cleavage CELL DEATH Phagocytosis Ced-1 Ced-2 Ced-5 Ced-6 Ced-7 Ced-10 Ced-12 PSR Lrp CrkII Dock180

More information

Supplementary Materials

Supplementary Materials Electronic Supplementary Material (ESI) for Integrative Biology. This journal is The Royal Society of Chemistry 2015 Predicting genetic interactions from Boolean models of biological networks Supplementary

More information

Death Ligand- Death Receptor. Annexin V. Fas PI MKK7 PIP3. pro-caspase-3. Granzyme B. Caspase Activation. Bid. Bcl-2 Caspase-3 Caspase-12

Death Ligand- Death Receptor. Annexin V. Fas PI MKK7 PIP3. pro-caspase-3. Granzyme B. Caspase Activation. Bid. Bcl-2 Caspase-3 Caspase-12 International Corporation life. science. discovery. { Apoptosis Apoptosis Kits International Corporation Apoptosis Signal Cascade and Detection Kits Annexin V Kits MEBCYTO Apoptosis Kit Annexin V Apoptosis

More information

Chapter 3: Novel Regulators of the C. elegans Caspase CED-3

Chapter 3: Novel Regulators of the C. elegans Caspase CED-3 53 Chapter 3: Novel Regulators of the C. elegans Caspase CED-3 3.1 Abstract The hallmark of apoptosis is the presence of activated caspases, a conserved family of cysteine proteases. Proper regulation

More information

Chemical aspects of the cell. Compounds that induce cell proliferation, differentiation and death

Chemical aspects of the cell. Compounds that induce cell proliferation, differentiation and death Chemical aspects of the cell Compounds that induce cell proliferation, differentiation and death Cell proliferation The cell cycle Chapter 17 Molecular Biology of the Cell 2 Cell cycle Chapter 17 Molecular

More information

Mechanism of Dronc activation in Drosophila cells

Mechanism of Dronc activation in Drosophila cells Research Article 5035 Mechanism of Dronc activation in Drosophila cells Israel Muro*, Kristin Monser* and Rollie J. Clem Molecular, Cellular, and Developmental Biology Program, Division of Biology, Ackert

More information

Bio-Plex Pro RBM Apoptosis Assays

Bio-Plex Pro RBM Apoptosis Assays Acute Phase Apoptosis Cancer Cardiovascular Disease Cytokines Chemokines, Growth Factors Diabetes Gene Expression Genotyping Immunoglobulin Isotyping MicroRNA Expression Bio-Plex Pro RBM Apoptosis Assays

More information

Interactions of DNR1 with the apoptotic machinery of Drosophila melanogaster

Interactions of DNR1 with the apoptotic machinery of Drosophila melanogaster Research Article 1189 Interactions of DNR1 with the apoptotic machinery of Drosophila melanogaster David A. Primrose, Sidharth Chaudhry, A. George D. Johnson, Adam Hrdlicka, Anja Schindler, Dave Tran and

More information

Quantitative Analysis of Pathways Controlling Extrinsic Apoptosis in Single Cells

Quantitative Analysis of Pathways Controlling Extrinsic Apoptosis in Single Cells Article Quantitative Analysis of Pathways Controlling Extrinsic Apoptosis in Single Cells John G. Albeck, 1 John M. Burke, 1,2 Bree B. Aldridge, 1,2 Mingsheng Zhang, 1 Douglas A. Lauffenburger, 2 and Peter

More information

Proteome-wide High Throughput Cell Based Assay for Apoptotic Genes

Proteome-wide High Throughput Cell Based Assay for Apoptotic Genes John Kenten, Doug Woods, Pankaj Oberoi, Laura Schaefer, Jonathan Reeves, Hans A. Biebuyck and Jacob N. Wohlstadter 9238 Gaither Road, Gaithersburg, MD 2877. Phone: 24.631.2522 Fax: 24.632.2219. Website:

More information

A Stable Simplification of a Fas-signaling Pathway Model for Apoptosis

A Stable Simplification of a Fas-signaling Pathway Model for Apoptosis A Stable Simplification of a Fas-signaling Pathway Model for Apoptosis Ya-Jing Huang Zhou Pei-Yuan Center for Appl. Math. Tsinghua Univ., Beijing 84, China Email: huangyj9@mails.tsinghua.edu.cn Wen-An

More information

Supporting Information

Supporting Information Supporting Information Cao et al. 10.1073/pnas.1306220110 Gram - bacteria Hemolymph Cytoplasm PGRP-LC TAK1 signalosome Imd dfadd Dredd Dnr1 Ikk signalosome P Relish Nucleus AMP and effector genes Fig.

More information

CASPASES AND CASPASE REGULATORS IN LEPIDOPTERA AND DIPTERA WILLIAM BARTON BRYANT. B.S., Middle Tennessee State University, 2002

CASPASES AND CASPASE REGULATORS IN LEPIDOPTERA AND DIPTERA WILLIAM BARTON BRYANT. B.S., Middle Tennessee State University, 2002 CASPASES AND CASPASE REGULATORS IN LEPIDOPTERA AND DIPTERA by WILLIAM BARTON BRYANT B.S., Middle Tennessee State University, 2002 AN ABSTRACT OF A DISSERTATION submitted in partial fulfillment of the requirements

More information

Zool 3200: Cell Biology Exam 5 4/27/15

Zool 3200: Cell Biology Exam 5 4/27/15 Name: Trask Zool 3200: Cell Biology Exam 5 4/27/15 Answer each of the following short answer questions in the space provided, giving explanations when asked to do so. Circle the correct answer or answers

More information

ON/OFF and Beyond - A Boolean Model of Apoptosis

ON/OFF and Beyond - A Boolean Model of Apoptosis Rebekka Schlatter 1 *, Kathrin Schmich 2, Ima Avalos Vizcarra 1,3, Peter Scheurich 4, Thomas Sauter 5, Christoph Borner 6, Michael Ederer 1,7, Irmgard Merfort 2, Oliver Sawodny 1 1 Institute for System

More information

Chapter 4: A Deficiency Screen to Isolate Novel Regulators of DIAP1

Chapter 4: A Deficiency Screen to Isolate Novel Regulators of DIAP1 70 Chapter 4: A Deficiency Screen to Isolate Novel Regulators of DIAP1 4.1 Abstract DIAP1, a ubiquitin E3 ligase, is the key Drosophila regulator of the family of cysteine proteases known as caspases.

More information

Regulation of the Drosophila Initiator Caspase Dronc through Ubiquitylation

Regulation of the Drosophila Initiator Caspase Dronc through Ubiquitylation University of Massachusetts Medical School escholarship@umms GSBS Dissertations and Theses Graduate School of Biomedical Sciences 1-17-2017 Regulation of the Drosophila Initiator Caspase Dronc through

More information

Systematic in vivo RNAi analysis of putative components of the Drosophila cell death machinery Introduction UNCORRECTED PROOF

Systematic in vivo RNAi analysis of putative components of the Drosophila cell death machinery Introduction UNCORRECTED PROOF (2006) 00, 1 12 & 2006 Nature Publishing Group All rights reserved 1350-9047/06 $30.00 www.nature.com/cdd Systematic in vivo RNAi analysis of putative components of the Drosophila cell death machinery

More information

Evidence for a Novel, Caspase-8-Independent, Fas Death Domain-Mediated Apoptotic Pathway

Evidence for a Novel, Caspase-8-Independent, Fas Death Domain-Mediated Apoptotic Pathway JournalofBiomedicineandBiotechnology 24:1 (24) 41 51 PII. S111724343841 http://jbb.hindawi.com RESEARCH ARTICLE Evidence for a Novel, Caspase-8-Independent, Fas Death Domain-Mediated Apoptotic Pathway

More information

IAPs. Structure of BIR2 Zn finger domain from XIAP

IAPs. Structure of BIR2 Zn finger domain from XIAP IAPs The only known endogenous caspase inhibitors are members of a second family of proteins identified by apoptosis research, the IAP (inhibitor of apoptosis proteins) family. IAPs were originally described

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2362 Figure S1 CYLD and CASPASE 8 genes are co-regulated. Analysis of gene expression across 79 tissues was carried out as described previously [Ref: PMID: 18636086]. Briefly, microarray

More information

Mechanisms of Cell Death

Mechanisms of Cell Death Mechanisms of Cell Death Etiology of cell death Major Factors Accidental Genetic Necrosis Apoptosis Necrosis: The sum of the morphologic changes that follow cell death in a living tissue or organ Apoptosis:

More information

Drosophila IAP1-mediated ubiquitylation controls activation of the initiator caspase DRONC independent of protein degradation

Drosophila IAP1-mediated ubiquitylation controls activation of the initiator caspase DRONC independent of protein degradation University of Massachusetts Medical School escholarship@umms Molecular, Cell and Cancer Biology Publications Molecular, Cell and Cancer Biology 9-1-2011 Drosophila IAP1-mediated ubiquitylation controls

More information

Mechanisms of Cell Death

Mechanisms of Cell Death Mechanisms of Cell Death Etiology of cell death Major Factors Accidental Genetic Necrosis Apoptosis Necrosis: The sum of the morphologic changes that follow cell death in a living tissue or organ Apoptosis:

More information

For the rapid, sensitive and accurate measurement of Caspase 3 Activity in cell and tissue lysates

For the rapid, sensitive and accurate measurement of Caspase 3 Activity in cell and tissue lysates ab39383 Caspase 3 Assay Kit (Fluorometric) Instructions for Use For the rapid, sensitive and accurate measurement of Caspase 3 Activity in cell and tissue lysates This product is for research use only

More information

P systems based Modelling of Cellular Signalling Pathways

P systems based Modelling of Cellular Signalling Pathways P systems based Modelling of Cellular Signalling Pathways Mario J. Pérez-Jiménez Research Group on Natural Computing Dpt. of Computer Science and Artificial Intelligence, University of Sevilla Avda. Reina

More information

Massive loss of neurons in embryos occurs during normal development (!)

Massive loss of neurons in embryos occurs during normal development (!) Types of Cell Death Apoptosis (Programmed Cell Death) : Cell-Autonomous Stereotypic Rapid Clean (dead cells eaten) Necrosis : Not Self-Initiated Not Stereotypic Can Be Slow Messy (injury can spread) Apoptosis

More information

APOPTOSIS REGULATOR BCL-2

APOPTOSIS REGULATOR BCL-2 Papers on Anthropology Apoptosis regulator XXII, 2013, BCL-2 pp. 63 67 P. Hussar, M. Žuravskaja, M. Kärner APOPTOSIS REGULATOR BCL-2 Piret Hussar 1, Maria Žuravskaja 2, Martin Kärner 2 1 Institute of Anatomy,

More information

This is an open access publisher version of an article that appears in:

This is an open access publisher version of an article that appears in: This is an open access publisher version of an article that appears in: JOURNAL OF CELL BIOLOGY The internet address for this paper is: https://publications.icr.ac.uk/5622/ Published text: PS Ribeiro,

More information

Journal Club & MSc Seminar

Journal Club & MSc Seminar IN THE NAME OF GOD Journal Club & MSc Seminar The relationship between apoptosis and microorganisms Superviser: Dr. Presented by: Mehri Sadeghi MSc Medical Microbiology What is it? Why is it important?

More information

FRET 1 FRET CFP YFP. , resonance energy transfer, FRET), , CFP, (green fluorescent protein, GFP) ). GFP ]. GFP GFP, YFP. , GFP , CFP.

FRET 1 FRET CFP YFP. , resonance energy transfer, FRET), , CFP, (green fluorescent protein, GFP) ). GFP ]. GFP GFP, YFP. , GFP , CFP. 980 Prog Biochem Biophys FRET 2 3 33 (, 510631) FRET 2,, 2,, 2 (fluorescence resonance energy transfer, FRET),, 2, ( FRET), 2, Q6 ( ) GFP CFP YFP : CFP : ( fluorescence YFP, resonance energy transfer,

More information

Caspase 3 (active) Red Staining Kit

Caspase 3 (active) Red Staining Kit ab65617 Caspase 3 (active) Red Staining Kit Instructions for Use For the rapid, sensitive and accurate detection of activated Caspase 3 in living cells. This product is for research use only and is not

More information

Direct Interaction between Survivin and Smac/DIABLO Is Essential for the Anti-apoptotic Activity of Survivin during Taxol-induced Apoptosis*

Direct Interaction between Survivin and Smac/DIABLO Is Essential for the Anti-apoptotic Activity of Survivin during Taxol-induced Apoptosis* THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 278, No. 25, Issue of June 20, pp. 23130 23140, 2003 2003 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Direct Interaction

More information

12/5/2014. The cell cycle and cell death. The cell cycle: cells duplicate their contents and divide

12/5/2014. The cell cycle and cell death. The cell cycle: cells duplicate their contents and divide The cell cycle and cell death The cell cycle: cells duplicate their contents and divide 1 The cell cycle may be divided into 4 phases Eucaryotic cell division: Mitosis (nuclear division) Cytokinesis (cell

More information

Looking for LOV: Location of LOV1 function in Nicotiana benthamiana cells

Looking for LOV: Location of LOV1 function in Nicotiana benthamiana cells Looking for LOV: Location of LOV1 function in Nicotiana benthamiana cells By: Patrick Rutledge 1 Dr. Jennifer Lorang 2,3, Dr. Marc Curtis 2,3, Dr. Thomas Wolpert 2,3 BioResource Research 1, Botany and

More information

Triethylene Glycol Dimethacrylate Induction of Apoptotic Proteins in Pulp Fibroblasts

Triethylene Glycol Dimethacrylate Induction of Apoptotic Proteins in Pulp Fibroblasts Ó Operative Dentistry, 2014, 39-1, E1-E8 Triethylene Glycol Dimethacrylate Induction of Apoptotic Proteins in Pulp Fibroblasts G Batarseh LJ Windsor NY Labban Y Liu K Gregson Clinical Relevance Pulp exposed

More information

Bio 3411, Fall 2006, Lecture 19-Cell Death.

Bio 3411, Fall 2006, Lecture 19-Cell Death. Types of Cell Death Questions : Apoptosis (Programmed Cell Death) : Cell-Autonomous Stereotypic Rapid Clean (dead cells eaten) Necrosis : Not Self-Initiated Not Stereotypic Can Be Slow Messy (injury can

More information

For the rapid, sensitive and accurate measurement of Caspase 9 activity in cell and tissue lysates

For the rapid, sensitive and accurate measurement of Caspase 9 activity in cell and tissue lysates ab65607 Caspase 9 Assay Kit (Fluorometric) Instructions for Use For the rapid, sensitive and accurate measurement of Caspase 9 activity in cell and tissue lysates This product is for research use only

More information

Co-localization, FRET

Co-localization, FRET Co-localization, FRET Last class FRAP Diffusion This class Co-localization Correlation FRET Co-localization Can you infer function of protein from it s intracellular location How do you measure if two

More information

NucView TM 488 Caspase-3 Assay Kit for Live Cells

NucView TM 488 Caspase-3 Assay Kit for Live Cells NucView TM 488 Caspase-3 Assay Kit for Live Cells Catalog Number: 30029 (100-500 assays) Contact Information Address: Biotium, Inc. 3423 Investment Blvd. Suite 8 Hayward, CA 94545 USA Telephone: (510)

More information

Fluorescence Workshop UMN Physics June 8-10, 2006 Basic Spectroscopic Principles Joachim Mueller

Fluorescence Workshop UMN Physics June 8-10, 2006 Basic Spectroscopic Principles Joachim Mueller Fluorescence Workshop UMN Physics June 8-10, 2006 Basic Spectroscopic Principles Joachim Mueller Fluorescence, Light, Absorption, Jablonski Diagram, and Beer-Law First stab at a definition: What is fluorescence?

More information

Models for Prediction, Explanation and Control: Recursive Bayesian Networks

Models for Prediction, Explanation and Control: Recursive Bayesian Networks Models for Prediction, Explanation and Control: Recursive Bayesian Networks Lorenzo Casini, Phyllis McKay Illari, Federica Russo, Jon Williamson University of Kent Draft of January 17, 2011 Abstract The

More information

A MATHEMATICAL MODEL FOR DYNAMIC SIMULATION OF APOPTOSIS PATHWAYS

A MATHEMATICAL MODEL FOR DYNAMIC SIMULATION OF APOPTOSIS PATHWAYS A MATHEMATICAL MODEL FOR DYNAMIC SIMULATION OF APOPTOSIS PATHWAYS Paolo Massari Department of Information Engineering Bioengineering University of Padova April 2014 Advisor: Gianna Maria Toolo Coadvisor:

More information

S Phase Coupled E2f1 Destruction Ensures Homeostasis in Proliferating Tissues

S Phase Coupled E2f1 Destruction Ensures Homeostasis in Proliferating Tissues S Phase Coupled E2f1 Destruction Ensures Homeostasis in Proliferating Tissues Jean M. Davidson 1, Robert J. Duronio 1,2,3 * 1 Department of Biology, The University of North Carolina at Chapel Hill, Chapel

More information

return in class, or Rm B

return in class, or Rm B Last lectures: Genetic Switches and Oscillators PS #2 due today bf before 3PM return in class, or Rm. 68 371B Naturally occurring: lambda lysis-lysogeny decision lactose operon in E. coli Engineered: genetic

More information

Role of Mitochondrial Remodeling in Programmed Cell Death in

Role of Mitochondrial Remodeling in Programmed Cell Death in Developmental Cell, Vol. 12 Supplementary Data Role of Mitochondrial Remodeling in Programmed Cell Death in Drosophila melanogaster Gaurav Goyal, Brennan Fell, Apurva Sarin, Richard J. Youle, V. Sriram.

More information

NOPO modulates Egr-induced JNK-independent cell death in Drosophila

NOPO modulates Egr-induced JNK-independent cell death in Drosophila ORIGINAL ARTICLE Cell Research (2012) 22:425-431. 2012 IBCB, SIBS, CAS All rights reserved 1001-0602/12 $ 32.00 www.nature.com/cr npg NOPO modulates Egr-induced JNK-independent cell death in Drosophila

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11419 Supplementary Figure 1 Schematic representation of innate immune signaling pathways induced by intracellular Salmonella in cultured macrophages. a, During the infection Salmonella

More information

Analysis of retinoblastoma protein function in the regulation of apoptosis

Analysis of retinoblastoma protein function in the regulation of apoptosis Analysis of retinoblastoma protein function in the regulation of apoptosis Analyse der Funktion des Retinoblastoma-Proteins in der Apoptose-Regulation Dissertation zur Erlangung des akademischen Grades

More information

A JNK-Dependent Pathway Is Required for TNF -Induced Apoptosis

A JNK-Dependent Pathway Is Required for TNF -Induced Apoptosis Cell, Vol. 115, 61 70, October 3, 2003, Copyright 2003 by Cell Press A JNK-Dependent Pathway Is Required for TNF -Induced Apoptosis Yibin Deng, 1 Xiaoyang Ren, 1 Lin Yang, Yahong Lin, and Xiangwei Wu*

More information

Richik N. Ghosh, Linnette Grove, and Oleg Lapets ASSAY and Drug Development Technologies 2004, 2:

Richik N. Ghosh, Linnette Grove, and Oleg Lapets ASSAY and Drug Development Technologies 2004, 2: 1 3/1/2005 A Quantitative Cell-Based High-Content Screening Assay for the Epidermal Growth Factor Receptor-Specific Activation of Mitogen-Activated Protein Kinase Richik N. Ghosh, Linnette Grove, and Oleg

More information

Non-linear dimensionality reduction analysis of the apoptosis signalling network. College of Science and Engineering School of Informatics

Non-linear dimensionality reduction analysis of the apoptosis signalling network. College of Science and Engineering School of Informatics Non-linear dimensionality reduction analysis of the apoptosis signalling network Sergii Ivakhno Thesis College of Science and Engineering School of Informatics Masters of Science August 2007 The University

More information

HOXA5-Induced Apoptosis in Breast Cancer Cells Is Mediated by Caspases 2 and 8

HOXA5-Induced Apoptosis in Breast Cancer Cells Is Mediated by Caspases 2 and 8 HOXA5-Induced Apoptosis in Breast Cancer Cells Is Mediated by Caspases 2 and 8 Hexin Chen, Seung Chung and Saraswati Sukumar Mol. Cell. Biol. 2004, 24(2):924. DOI: 10.1128/MCB.24.2.924-935.2004. REFERENCES

More information

Cellular Mechanisms Controlling Caspase Activation and Function. Amanda B. Parrish, Christopher D. Freel, and Sally Kornbluth

Cellular Mechanisms Controlling Caspase Activation and Function. Amanda B. Parrish, Christopher D. Freel, and Sally Kornbluth Cellular Mechanisms Controlling Caspase Activation and Function Amanda B. Parrish, Christopher D. Freel, and Sally Kornbluth Department of Pharmacology and Cancer Biology, Duke University School of Medicine,

More information

ab39700 Caspase 8 Assay Kit (Colorimetric)

ab39700 Caspase 8 Assay Kit (Colorimetric) Version 5 Last updated 18 November 2016 ab39700 Caspase 8 Assay Kit (Colorimetric) For the rapid, sensitive and accurate measurement of caspase 8 activity in cell lysates. This product is for research

More information

Caspase 8 (active) Red Staining Kit

Caspase 8 (active) Red Staining Kit ab65618 Caspase 8 (active) Red Staining Kit Instructions for Use For the rapid, sensitive and accurate detection of activated Caspase 8 in living cells This product is for research use only and is not

More information

A structural view of mitochondria-mediated apoptosis

A structural view of mitochondria-mediated apoptosis A structural view of mitochondria-mediated apoptosis Yigong Shi Mitochondria-mediated apoptosis plays a central role in animal development and tissue homeostasis, and its alteration results in a range

More information

AP Biology Gene Regulation and Development Review

AP Biology Gene Regulation and Development Review AP Biology Gene Regulation and Development Review 1. What does the regulatory gene code for? 2. Is the repressor by default active/inactive? 3. What changes the repressor activity? 4. What does repressor

More information

JCB Article. The role of cytochrome c in caspase activation in Drosophila melanogaster cells

JCB Article. The role of cytochrome c in caspase activation in Drosophila melanogaster cells JCB Article The role of cytochrome c in caspase activation in Drosophila melanogaster cells Loretta Dorstyn, 1 Stuart Read, 1 Dimitrios Cakouros, 1 Jun R. Huh, 2 Bruce A. Hay, 2 and Sharad Kumar 1 1 Hanson

More information

TRADD mediates the tumor necrosis factor-induced apoptosis of L929 cells in the absence of RIP3

TRADD mediates the tumor necrosis factor-induced apoptosis of L929 cells in the absence of RIP3 www.nature.com/scientificreports Received: 14 June 2017 Accepted: 9 November 2017 Published: xx xx xxxx OPEN TRADD mediates the tumor necrosis factor-induced apoptosis of L929 cells in the absence of RIP3

More information

Multiple Choice Review- Eukaryotic Gene Expression

Multiple Choice Review- Eukaryotic Gene Expression Multiple Choice Review- Eukaryotic Gene Expression 1. Which of the following is the Central Dogma of cell biology? a. DNA Nucleic Acid Protein Amino Acid b. Prokaryote Bacteria - Eukaryote c. Atom Molecule

More information

Kyung-Won LEE, a,b Hyun-Ju JUNG, c Hee-Juhn PARK, c Deog-Gon KIM, d Jin-Yong LEE, d and Kyung-Tae LEE*,a,b

Kyung-Won LEE, a,b Hyun-Ju JUNG, c Hee-Juhn PARK, c Deog-Gon KIM, d Jin-Yong LEE, d and Kyung-Tae LEE*,a,b 854 Biol. Pharm. Bull. 28(5) 854 859 (2005) Vol. 28, No. 5 b -D-Xylopyranosyl-(1 3)-b -D-glucuronopyranosyl Echinocystic Acid Isolated from the Roots of Codonopsis lanceolata Induces Caspase-Dependent

More information

Types of biological networks. I. Intra-cellurar networks

Types of biological networks. I. Intra-cellurar networks Types of biological networks I. Intra-cellurar networks 1 Some intra-cellular networks: 1. Metabolic networks 2. Transcriptional regulation networks 3. Cell signalling networks 4. Protein-protein interaction

More information

Received 5 February 2007/Accepted 11 June 2007

Received 5 February 2007/Accepted 11 June 2007 JOURNAL OF VIROLOGY, Sept. 2007, p. 9319 9330 Vol. 81, No. 17 0022-538X/07/$08.00 0 doi:10.1128/jvi.00247-07 Copyright 2007, American Society for Microbiology. All Rights Reserved. Baculovirus Caspase

More information

Supplemental Figures S1 S5

Supplemental Figures S1 S5 Beyond reduction of atherosclerosis: PON2 provides apoptosis resistance and stabilizes tumor cells Ines Witte (1), Sebastian Altenhöfer (1), Petra Wilgenbus (1), Julianna Amort (1), Albrecht M. Clement

More information

The Drosophila Caspase DRONC Cleaves following Glutamate or Aspartate and Is Regulated by DIAP1, HID, and GRIM*

The Drosophila Caspase DRONC Cleaves following Glutamate or Aspartate and Is Regulated by DIAP1, HID, and GRIM* THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 275, No. 35, Issue of September 1, pp. 27084 27093, 2000 2000 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. The Drosophila

More information

Translation Part 2 of Protein Synthesis

Translation Part 2 of Protein Synthesis Translation Part 2 of Protein Synthesis IN: How is transcription like making a jello mold? (be specific) What process does this diagram represent? A. Mutation B. Replication C.Transcription D.Translation

More information

For the rapid, sensitive and accurate detection of active Caspase 9 in living cells

For the rapid, sensitive and accurate detection of active Caspase 9 in living cells ab65615 Caspase 9 (active) FITC Staining Kit Instructions for Use For the rapid, sensitive and accurate detection of active Caspase 9 in living cells This product is for research use only and is not intended

More information

Drosophila Bruce Can Potently Suppress Rpr- and Grim-Dependent but Not Hid-Dependent Cell Death

Drosophila Bruce Can Potently Suppress Rpr- and Grim-Dependent but Not Hid-Dependent Cell Death Current Biology, Vol. 12, 1164 1168, July 9, 2002, 2002 Elsevier Science Ltd. All rights reserved. PII S0960-9822(02)00935-1 Drosophila Bruce Can Potently Suppress Rpr- and Grim-Dependent but Not Hid-Dependent

More information

Apoptosis Detection Using the BD Accuri C6 Flow Cytometer

Apoptosis Detection Using the BD Accuri C6 Flow Cytometer Apoptosis Detection Using the BD Accuri C6 Flow Cytometer Stacey Roys, Marketing Applications Specialist, BD Biosciences Cyndy Lane, Senior Product Manager, BD Biosciences 23-14519-00 Outline What is apoptosis?

More information

Characterization of head involution defective (hid) as a pro-apoptotic gene in Megasalia scalaris

Characterization of head involution defective (hid) as a pro-apoptotic gene in Megasalia scalaris University of Tennessee, Knoxville Trace: Tennessee Research and Creative Exchange University of Tennessee Honors Thesis Projects University of Tennessee Honors Program 5-2015 Characterization of head

More information

Sig2GRN: A Software Tool Linking Signaling Pathway with Gene Regulatory Network for Dynamic Simulation

Sig2GRN: A Software Tool Linking Signaling Pathway with Gene Regulatory Network for Dynamic Simulation Sig2GRN: A Software Tool Linking Signaling Pathway with Gene Regulatory Network for Dynamic Simulation Authors: Fan Zhang, Runsheng Liu and Jie Zheng Presented by: Fan Wu School of Computer Science and

More information

Unraveling Apoptosis Signalling using Linear Control Methods: Linking the Loop Gain to Reverting the Decision to Undergo Apoptosis

Unraveling Apoptosis Signalling using Linear Control Methods: Linking the Loop Gain to Reverting the Decision to Undergo Apoptosis Preprints of the 9th International Symposium on Advanced Control of Chemical Processes The International Federation of Automatic Control TuPoster.3 Unraveling Apoptosis Signalling using Linear Control

More information