Apoptosis in Mammalian Cells
|
|
- Henry Holmes
- 6 years ago
- Views:
Transcription
1 Apoptosis in Mammalian Cells
2 Apoptosis is an important factor in many human diseases Cancer malignant cells evade death by suppressing apoptosis (too little apoptosis) Stroke damaged neurons commit apoptosis, leading to more extensive damage (too much apoptosis) Autoimmune disorders immune cells survive for too long, leading to over-reactive immune response (too little apoptosis)
3 The death receptor pathway In mammals, there is a family of death ligands that bind to receptors on the cell surface, sending a pro-apoptotic signal to the cell Y Y Y Y Die!
4 Death ligand family members FasL very important in the immune system TNF (Tumor necrosis factor) controls inflammatory responses TRAIL selectively kills tumor cells; currently in clinical trials as an anti-cancer agent
5 FasL FADD FADD Bid casp8 Bax Bax IAP IAP casp3 casp3 casp9 cyto c Smac Smac
6 Tools for observing apoptosis Immunofluorescence mircroscopy Flow cytometry Live cell microscopy
7 Principles of Fluorescence Two diagrams removed for copyright reasons.
8 Immunofluorescence can detect specific proteins in cells
9 Immunofluorescence can detect specific proteins in cells Fix with formaldehyde
10 Immunofluorescence can detect specific proteins in cells Fix with formaldehyde Permeablize with detergent
11 Immunofluorescence can detect specific proteins in cells Antibodies bind to specific proteins. We can generate antibodies to nearly any protein we re interested in. We can label antibodies with fluorescent molecules. Fluorescently labeled antibodies can reveal the location of specific proteins in the cell.
12 Detecting apoptosis with immunofluorescence microscopy DNA Cleaved cytokeratin Cleaved caspase-3 Blue: DNA Green: cleaved cytok Red: cleaved casp3
13 Determining the order of apoptotic events Blue: H33342 Green: cytochromec Red: cleaved casp3
14 Quantitating apoptosis using flow cytometry Cytokeratin cleavage Green fluorescence Healthy cells Late apoptotic cells Early apoptotic cells Red fluorescence Caspase 3 cleavage
15 Combining flow cytometry with RNAi +TNF Cytokeratin cleavage No RNAi Caspase 8 RNAi Bid RNAi Caspase 3 cleavage
16 Green Fluorescent Protein a genetically encoded fluorescent tag Diagram removed for copyright reasons.
17 The fluorescent protein family Jellyfish Aequoria victoria Reef coral Green fluorescent protein Red fluorescent protein Engineered mutations Blue fluorescent protein Cyan fluorescent protein Yellow fluorescent protein
18 GFP has been engineered to make blue and yellow variants; red fluorescent proteins have been isolated from other sea creatures Two photos removed for copyright reasons.
19 GFP can be spliced into any gene DNA sequence atgactgacagtccattaccggactttga atgttcagggatcccataattagtga Unfolded protein Folded protein atgactgacagtccattaccggacttatgttcagggatcccataattagtga
20 FRET a phenomenon that occurs when 2 fluorescent molecules are very close FRET! No FRET cfp yfp cfp yfp < 6 nm > 6 nm FRET: Forster Resonance Energy Transfer
21 A FRET-based caspase activity reporter FRET! cfp DEVD yfp cfp DEVD casp3 yfp Excitation with UV light. Energy transfer from CFP to YFP. Emission of yellow light. Cleavage of substrate by caspase-3. cfp DEVD yfp Excitation with UV light. Emission of cyan light.
22 Monitoring caspase activity over time in living cells healthy cell dying cell FRET ratio
23 FRET reporters can be modified to detect different caspase activities cfp DEVD yfp Caspase-3 cfp yfp Caspase-8 IETD cfp LEHD yfp Caspase-9
24 Much of the apoptotic pathway is conserved Mammals Fas Death signals Flies Eiger Death signals FADD ciap FADD casp8 Bid Dredd Bax Bcl2 Debcl Buffy cytoc cytoc casp3 casp9 Smac Dcp Drice Dronc Rpr Grim Hid XIAP DIAP
25 But the importance of certain pathways changes Mammals Flies Fas Eiger FADD ciap FADD casp8 Bid Dredd Bax Debcl Buffy Bcl2 cytoc cytoc Rpr Grim Hid casp3 casp9 Smac Dcp Drice Dronc XIAP DIAP
26 Recent development XIAP is important in human cancer cells See Li, L. et al. A Small Molecule Smac Mimic Potentiates TRAIL- and TNF-α Mediated Cell Death. Science 305 no (2004 Sep 3):
27 Even within a species, differences are observed Fas Human Cancer cell 1 Fas Human Cancer cell 2 FADD ciap FADD ciap casp8 Bid casp8 Bid Bax Bcl2 Bax Bcl2 cytoc cytoc casp3 casp9 Smac casp3 casp9 Smac XIAP XIAP
28
29 A computational model of caspase activation
30 Studying apoptosis to learn how cells make decisions Internal state Death signals Survival signals Diagram removed for copyright reasons. Die?
31 Quantitating apoptosis using flow cytometry Effector Caspase Activity (cytokeratin cleavage) Untreated TNF treated TNF treated, Bax -/- Initiator Caspase Activity (caspase 3 cleavage)
32 The order of apoptotic events varies between human cancer cells Hct-116 HeLa Blue: H33342 Green: cleaved cytok Red: cleaved casp3
Drosophila Apoptosis and the Regulation of the Caspase Cascade
Drosophila Apoptosis and the Regulation of the Caspase Cascade Kate Stafford March 18, 2005 Abstract The caspase cascade in Drosophila is controlled primarily by DIAP1 (Drosophila inhibitor of apoptosis),
More informationApoptosis: Death Comes for the Cell
Apoptosis: Death Comes for the Cell Joe W. Ramos joeramos@hawaii.edu From Ingmar Bergman s The Seventh Seal 1 2 Mutations in proteins that regulate cell proliferation, survival and death can contribute
More informationMechanisms. Cell Death. Carol M. Troy, MD PhD August 24, 2009 PHENOMENOLOGY OF CELL DEATH I. DEVELOPMENT 8/20/2009
Mechanisms of Cell Death Carol M. Troy, MD PhD August 24, 2009 PHENOMENOLOGY OF CELL DEATH I. DEVELOPMENT A. MORPHOGENESIS: SCULPTING/SHAPING STRUCTURES CREATION OF CAVITIES AND TUBES FUSION OF TISSUE
More informationModeling a Snap-Action, Variable-Delay Switch Controlling Extrinsic Cell Death
Modeling a Snap-Action, Variable-Delay Switch Controlling Extrinsic Cell Death John G. Albeck 1[, John M. Burke 1,2[, Sabrina L. Spencer 1,3, Douglas A. Lauffenburger 2,3, Peter K. Sorger 1,2* PLoS BIOLOGY
More informationTO DIE OR TO DIFFERENTIATE: APOPTOTIC AND NON-APOPTOTIC ROLES OF DEATH MOLECULES IN DROSOPHILA MELANOGASTER
TO DIE OR TO DIFFERENTIATE: APOPTOTIC AND NON-APOPTOTIC ROLES OF DEATH MOLECULES IN DROSOPHILA MELANOGASTER Thesis by Jun Ryul Huh In Partial Fulfillment of the Requirements for the Degree of Doctor of
More informationMechanisms of Cell Death
Mechanisms of Cell Death CELL DEATH AND FORMATION OF THE SEMICIRCULAR CANALS Carol M. Troy, MD PhD August 24, 2009 FROM: Fekete et al., Development 124: 2451 (1997) PHENOMENOLOGY OF CELL DEATH I. DEVELOPMENT
More informationChang 1. Characterization of the Drosophila Ortholog of the Mammalian Anti-apoptotic Protein Aven
Chang 1 Characterization of the Drosophila Ortholog of the Mammalian Anti-apoptotic Protein Aven Joy Chang Georgetown University Senior Digital Thesis May 1, 2006 Chang 2 Table of Contents BACKGROUND 4
More informationhttp://cwp.embo.org/w09-13/index.html Roads to Ruin is s o t p o ap healthy cell autophagic cell death ne cr os is Thanks to Seamus Martin! Evolution of apoptosis signalling cascades Inhibitor Adopted
More informationApoptosis EXTRA REQUIREMETS
Apoptosis Introduction (SLIDE 1) Organisms develop from a single cell, and in doing so an anatomy has to be created. This process not only involves the creation of new cells, but also the removal of cells
More informationA. Incorrect! The Cell Cycle contains 4 distinct phases: (1) G 1, (2) S Phase, (3) G 2 and (4) M Phase.
Molecular Cell Biology - Problem Drill 21: Cell Cycle and Cell Death Question No. 1 of 10 1. Which of the following statements about the cell cycle is correct? Question #1 (A) The Cell Cycle contains 3
More informationExploring the Contextual Sensitivity of Factors that Determine Cellto-Cell Variability in Receptor-Mediated Apoptosis
Exploring the Contextual Sensitivity of Factors that Determine Cellto-Cell Variability in Receptor-Mediated Apoptosis The Harvard community has made this article openly available. Please share how this
More informationCell Death & Trophic Factors II. Steven McLoon Department of Neuroscience University of Minnesota
Cell Death & Trophic Factors II Steven McLoon Department of Neuroscience University of Minnesota 1 Remember? Neurotrophins are cell survival factors that neurons get from their target cells! There is a
More informationCell Survival Curves (Chap. 3)
Cell Survival Curves (Chap. 3) Example of pedigress of EMT6 mouse cells Clone The in vitro cell survival curve Cell Survival Assay Dye exclusion assay: membrane integrity MTT assay: respiratory activity
More informationProgrammed Cell Death
Programmed Cell Death Dewajani Purnomosari Department of Histology and Cell Biology Faculty of Medicine Universitas Gadjah Mada d.purnomosari@ugm.ac.id What is apoptosis? a normal component of the development
More informationTNFα 18hr. Control. CHX 18hr. TNFα+ CHX 18hr. TNFα: 18 18hr (KDa) PARP. Cleaved. Cleaved. Cleaved. Caspase3. Pellino3 shrna. Control shrna.
Survival ( %) a. TNFα 18hr b. Control sirna Pellino3 sirna TNFα: 18 18hr c. Control shrna Pellino3 shrna Caspase3 Actin Control d. Control shrna Pellino3 shrna *** 100 80 60 CHX 18hr 40 TNFα+ CHX 18hr
More informationTRAIL-induced apoptosis requires Bax-dependent mitochondrial release of Smac/DIABLO
TRAIL-induced apoptosis requires Bax-dependent mitochondrial release of Smac/DIABLO Yibin Deng, Yahong Lin, and Xiangwei Wu 1 Huffington Center on Aging and Department of Molecular and Cellular Biology,
More informationApoptosis and Carcinogenesis
Death Becomes Us: Apoptosis and Carcinogenesis by Michele M. Cox Department of Biology, University of the Virgin Islands Part I What Is Cancer? Hi, Derek. Studying for your Cell and Molec final? asked
More informationThe Caspase System: a potential role in muscle proteolysis and meat quality? Tim Parr
The Caspase System: a potential role in muscle proteolysis and meat quality? Tim Parr Caroline Kemp, Ron Bardsley,, Peter Buttery Division of Nutritional Sciences, School of Biosciences, University of
More informationCell-cell communication in development Review of cell signaling, paracrine and endocrine factors, cell death pathways, juxtacrine signaling, differentiated state, the extracellular matrix, integrins, epithelial-mesenchymal
More informationMonte Carlo study elucidates the type 1/type 2 choice in apoptotic death signaling in normal and cancer cells
Cells 2013, 2, 1-x manuscripts; doi:10.3390/cells20x000x OPEN ACCESS cells ISSN 2073-4409 www.mdpi.com/journal/cells Article Monte Carlo study elucidates the type 1/type 2 choice in apoptotic death signaling
More informationProteases for Cell Suicide: Functions and Regulation of Caspases
MICROBIOLOGY AND MOLECULAR BIOLOGY REVIEWS, Dec. 2000, p. 821 846 Vol. 64, No. 4 1092-2172/00/$04.00 0 Copyright 2000, American Society for Microbiology. All Rights Reserved. Proteases for Cell Suicide:
More informationDeath signaling. Color PDF file of handouts can be found at Wu lab web-page:
Death signaling Hao Wu References 1. Wang, X. The expanding role of mitochondria in apoptosis. Genes Dev 15, 2922-2933. (2001). 2. Fesik, S. W. Insights into programmed cell death through structural biology.
More informationApoptosis: Death comes for the Cell. Apoptosis: Programmed Cell Death. Apoptosis. Necrosis
poptosis: eath comes for the Cell Mutations in proteins that regulate cell proliferation, survival and death can contribute to oncogenesis Joe W. Ramos jramos@crch.hawaii.edu From Ingmar Bergman s The
More informationApoptosis and Cancer. Carol M. Troy, MD, PhD October 26, 2016
Apoptosis and Cancer Carol M. Troy, MD, PhD October 26, 2016 PHENOMENOLOGY OF CELL DEATH -1 I. DEVELOPMENT A. MORPHOGENESIS: SCULPTING/SHAPING STRUCTURES FUSION OF TISSUE MASSES (PALATE/NEURAL TUBE) CREATION
More informationCaspase-Dependent Cell Death in Drosophila
Annu. Rev. Cell Dev. Biol. 2006. 22:623 50 First published online as a Review in Advance on July 14, 2006 The Annual Review of Cell and Developmental Biology is online at http://cellbio.annualreviews.org
More informationValidation of Petri Net Apoptosis Models Using P-Invariant Analysis
2009 IEEE International Conference on Control and Automation Christchurch, New Zealand, December 9-11, 2009 WeMT5.1 Validation of Petri Net Apoptosis Models Using P-Invariant Analysis Ian Wee Jin Low,
More informationSupplementary Figure 1. AnnexinV FITC and Sytox orange staining in wild type, Nlrp3 /, ASC / and casp1/11 / TEC treated with TNF /CHX.
Supplementary Figure 1. AnnexinV FITC and Sytox orange staining in wild type, Nlrp3 /, ASC / and casp1/11 / TEC treated with TNF /CHX. Phase contrast and widefield fluorescence microscopy (20x magnification).
More informationC. elegans apoptosis pathway CED-4 APAF-1. Ced-1 Ced-2 Ced-5 Ced-6 Ced-7 Ced-10 Ced-12 PSR Lrp CrkII Dock180 Gulp ABC-1 Rac Elmo PSR
C. elegans apoptosis pathway EGL-1 BH3 CED-9 BCL2 CED-4 APAF-1 CED-3 CASPASE-9 Effector caspases Subtrates cleavage CELL DEATH Phagocytosis Ced-1 Ced-2 Ced-5 Ced-6 Ced-7 Ced-10 Ced-12 PSR Lrp CrkII Dock180
More informationSupplementary Materials
Electronic Supplementary Material (ESI) for Integrative Biology. This journal is The Royal Society of Chemistry 2015 Predicting genetic interactions from Boolean models of biological networks Supplementary
More informationDeath Ligand- Death Receptor. Annexin V. Fas PI MKK7 PIP3. pro-caspase-3. Granzyme B. Caspase Activation. Bid. Bcl-2 Caspase-3 Caspase-12
International Corporation life. science. discovery. { Apoptosis Apoptosis Kits International Corporation Apoptosis Signal Cascade and Detection Kits Annexin V Kits MEBCYTO Apoptosis Kit Annexin V Apoptosis
More informationChapter 3: Novel Regulators of the C. elegans Caspase CED-3
53 Chapter 3: Novel Regulators of the C. elegans Caspase CED-3 3.1 Abstract The hallmark of apoptosis is the presence of activated caspases, a conserved family of cysteine proteases. Proper regulation
More informationChemical aspects of the cell. Compounds that induce cell proliferation, differentiation and death
Chemical aspects of the cell Compounds that induce cell proliferation, differentiation and death Cell proliferation The cell cycle Chapter 17 Molecular Biology of the Cell 2 Cell cycle Chapter 17 Molecular
More informationMechanism of Dronc activation in Drosophila cells
Research Article 5035 Mechanism of Dronc activation in Drosophila cells Israel Muro*, Kristin Monser* and Rollie J. Clem Molecular, Cellular, and Developmental Biology Program, Division of Biology, Ackert
More informationBio-Plex Pro RBM Apoptosis Assays
Acute Phase Apoptosis Cancer Cardiovascular Disease Cytokines Chemokines, Growth Factors Diabetes Gene Expression Genotyping Immunoglobulin Isotyping MicroRNA Expression Bio-Plex Pro RBM Apoptosis Assays
More informationInteractions of DNR1 with the apoptotic machinery of Drosophila melanogaster
Research Article 1189 Interactions of DNR1 with the apoptotic machinery of Drosophila melanogaster David A. Primrose, Sidharth Chaudhry, A. George D. Johnson, Adam Hrdlicka, Anja Schindler, Dave Tran and
More informationQuantitative Analysis of Pathways Controlling Extrinsic Apoptosis in Single Cells
Article Quantitative Analysis of Pathways Controlling Extrinsic Apoptosis in Single Cells John G. Albeck, 1 John M. Burke, 1,2 Bree B. Aldridge, 1,2 Mingsheng Zhang, 1 Douglas A. Lauffenburger, 2 and Peter
More informationProteome-wide High Throughput Cell Based Assay for Apoptotic Genes
John Kenten, Doug Woods, Pankaj Oberoi, Laura Schaefer, Jonathan Reeves, Hans A. Biebuyck and Jacob N. Wohlstadter 9238 Gaither Road, Gaithersburg, MD 2877. Phone: 24.631.2522 Fax: 24.632.2219. Website:
More informationA Stable Simplification of a Fas-signaling Pathway Model for Apoptosis
A Stable Simplification of a Fas-signaling Pathway Model for Apoptosis Ya-Jing Huang Zhou Pei-Yuan Center for Appl. Math. Tsinghua Univ., Beijing 84, China Email: huangyj9@mails.tsinghua.edu.cn Wen-An
More informationSupporting Information
Supporting Information Cao et al. 10.1073/pnas.1306220110 Gram - bacteria Hemolymph Cytoplasm PGRP-LC TAK1 signalosome Imd dfadd Dredd Dnr1 Ikk signalosome P Relish Nucleus AMP and effector genes Fig.
More informationCASPASES AND CASPASE REGULATORS IN LEPIDOPTERA AND DIPTERA WILLIAM BARTON BRYANT. B.S., Middle Tennessee State University, 2002
CASPASES AND CASPASE REGULATORS IN LEPIDOPTERA AND DIPTERA by WILLIAM BARTON BRYANT B.S., Middle Tennessee State University, 2002 AN ABSTRACT OF A DISSERTATION submitted in partial fulfillment of the requirements
More informationZool 3200: Cell Biology Exam 5 4/27/15
Name: Trask Zool 3200: Cell Biology Exam 5 4/27/15 Answer each of the following short answer questions in the space provided, giving explanations when asked to do so. Circle the correct answer or answers
More informationON/OFF and Beyond - A Boolean Model of Apoptosis
Rebekka Schlatter 1 *, Kathrin Schmich 2, Ima Avalos Vizcarra 1,3, Peter Scheurich 4, Thomas Sauter 5, Christoph Borner 6, Michael Ederer 1,7, Irmgard Merfort 2, Oliver Sawodny 1 1 Institute for System
More informationChapter 4: A Deficiency Screen to Isolate Novel Regulators of DIAP1
70 Chapter 4: A Deficiency Screen to Isolate Novel Regulators of DIAP1 4.1 Abstract DIAP1, a ubiquitin E3 ligase, is the key Drosophila regulator of the family of cysteine proteases known as caspases.
More informationRegulation of the Drosophila Initiator Caspase Dronc through Ubiquitylation
University of Massachusetts Medical School escholarship@umms GSBS Dissertations and Theses Graduate School of Biomedical Sciences 1-17-2017 Regulation of the Drosophila Initiator Caspase Dronc through
More informationSystematic in vivo RNAi analysis of putative components of the Drosophila cell death machinery Introduction UNCORRECTED PROOF
(2006) 00, 1 12 & 2006 Nature Publishing Group All rights reserved 1350-9047/06 $30.00 www.nature.com/cdd Systematic in vivo RNAi analysis of putative components of the Drosophila cell death machinery
More informationEvidence for a Novel, Caspase-8-Independent, Fas Death Domain-Mediated Apoptotic Pathway
JournalofBiomedicineandBiotechnology 24:1 (24) 41 51 PII. S111724343841 http://jbb.hindawi.com RESEARCH ARTICLE Evidence for a Novel, Caspase-8-Independent, Fas Death Domain-Mediated Apoptotic Pathway
More informationIAPs. Structure of BIR2 Zn finger domain from XIAP
IAPs The only known endogenous caspase inhibitors are members of a second family of proteins identified by apoptosis research, the IAP (inhibitor of apoptosis proteins) family. IAPs were originally described
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2362 Figure S1 CYLD and CASPASE 8 genes are co-regulated. Analysis of gene expression across 79 tissues was carried out as described previously [Ref: PMID: 18636086]. Briefly, microarray
More informationMechanisms of Cell Death
Mechanisms of Cell Death Etiology of cell death Major Factors Accidental Genetic Necrosis Apoptosis Necrosis: The sum of the morphologic changes that follow cell death in a living tissue or organ Apoptosis:
More informationDrosophila IAP1-mediated ubiquitylation controls activation of the initiator caspase DRONC independent of protein degradation
University of Massachusetts Medical School escholarship@umms Molecular, Cell and Cancer Biology Publications Molecular, Cell and Cancer Biology 9-1-2011 Drosophila IAP1-mediated ubiquitylation controls
More informationMechanisms of Cell Death
Mechanisms of Cell Death Etiology of cell death Major Factors Accidental Genetic Necrosis Apoptosis Necrosis: The sum of the morphologic changes that follow cell death in a living tissue or organ Apoptosis:
More informationFor the rapid, sensitive and accurate measurement of Caspase 3 Activity in cell and tissue lysates
ab39383 Caspase 3 Assay Kit (Fluorometric) Instructions for Use For the rapid, sensitive and accurate measurement of Caspase 3 Activity in cell and tissue lysates This product is for research use only
More informationP systems based Modelling of Cellular Signalling Pathways
P systems based Modelling of Cellular Signalling Pathways Mario J. Pérez-Jiménez Research Group on Natural Computing Dpt. of Computer Science and Artificial Intelligence, University of Sevilla Avda. Reina
More informationMassive loss of neurons in embryos occurs during normal development (!)
Types of Cell Death Apoptosis (Programmed Cell Death) : Cell-Autonomous Stereotypic Rapid Clean (dead cells eaten) Necrosis : Not Self-Initiated Not Stereotypic Can Be Slow Messy (injury can spread) Apoptosis
More informationAPOPTOSIS REGULATOR BCL-2
Papers on Anthropology Apoptosis regulator XXII, 2013, BCL-2 pp. 63 67 P. Hussar, M. Žuravskaja, M. Kärner APOPTOSIS REGULATOR BCL-2 Piret Hussar 1, Maria Žuravskaja 2, Martin Kärner 2 1 Institute of Anatomy,
More informationThis is an open access publisher version of an article that appears in:
This is an open access publisher version of an article that appears in: JOURNAL OF CELL BIOLOGY The internet address for this paper is: https://publications.icr.ac.uk/5622/ Published text: PS Ribeiro,
More informationJournal Club & MSc Seminar
IN THE NAME OF GOD Journal Club & MSc Seminar The relationship between apoptosis and microorganisms Superviser: Dr. Presented by: Mehri Sadeghi MSc Medical Microbiology What is it? Why is it important?
More informationFRET 1 FRET CFP YFP. , resonance energy transfer, FRET), , CFP, (green fluorescent protein, GFP) ). GFP ]. GFP GFP, YFP. , GFP , CFP.
980 Prog Biochem Biophys FRET 2 3 33 (, 510631) FRET 2,, 2,, 2 (fluorescence resonance energy transfer, FRET),, 2, ( FRET), 2, Q6 ( ) GFP CFP YFP : CFP : ( fluorescence YFP, resonance energy transfer,
More informationCaspase 3 (active) Red Staining Kit
ab65617 Caspase 3 (active) Red Staining Kit Instructions for Use For the rapid, sensitive and accurate detection of activated Caspase 3 in living cells. This product is for research use only and is not
More informationDirect Interaction between Survivin and Smac/DIABLO Is Essential for the Anti-apoptotic Activity of Survivin during Taxol-induced Apoptosis*
THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 278, No. 25, Issue of June 20, pp. 23130 23140, 2003 2003 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Direct Interaction
More information12/5/2014. The cell cycle and cell death. The cell cycle: cells duplicate their contents and divide
The cell cycle and cell death The cell cycle: cells duplicate their contents and divide 1 The cell cycle may be divided into 4 phases Eucaryotic cell division: Mitosis (nuclear division) Cytokinesis (cell
More informationLooking for LOV: Location of LOV1 function in Nicotiana benthamiana cells
Looking for LOV: Location of LOV1 function in Nicotiana benthamiana cells By: Patrick Rutledge 1 Dr. Jennifer Lorang 2,3, Dr. Marc Curtis 2,3, Dr. Thomas Wolpert 2,3 BioResource Research 1, Botany and
More informationTriethylene Glycol Dimethacrylate Induction of Apoptotic Proteins in Pulp Fibroblasts
Ó Operative Dentistry, 2014, 39-1, E1-E8 Triethylene Glycol Dimethacrylate Induction of Apoptotic Proteins in Pulp Fibroblasts G Batarseh LJ Windsor NY Labban Y Liu K Gregson Clinical Relevance Pulp exposed
More informationBio 3411, Fall 2006, Lecture 19-Cell Death.
Types of Cell Death Questions : Apoptosis (Programmed Cell Death) : Cell-Autonomous Stereotypic Rapid Clean (dead cells eaten) Necrosis : Not Self-Initiated Not Stereotypic Can Be Slow Messy (injury can
More informationFor the rapid, sensitive and accurate measurement of Caspase 9 activity in cell and tissue lysates
ab65607 Caspase 9 Assay Kit (Fluorometric) Instructions for Use For the rapid, sensitive and accurate measurement of Caspase 9 activity in cell and tissue lysates This product is for research use only
More informationCo-localization, FRET
Co-localization, FRET Last class FRAP Diffusion This class Co-localization Correlation FRET Co-localization Can you infer function of protein from it s intracellular location How do you measure if two
More informationNucView TM 488 Caspase-3 Assay Kit for Live Cells
NucView TM 488 Caspase-3 Assay Kit for Live Cells Catalog Number: 30029 (100-500 assays) Contact Information Address: Biotium, Inc. 3423 Investment Blvd. Suite 8 Hayward, CA 94545 USA Telephone: (510)
More informationFluorescence Workshop UMN Physics June 8-10, 2006 Basic Spectroscopic Principles Joachim Mueller
Fluorescence Workshop UMN Physics June 8-10, 2006 Basic Spectroscopic Principles Joachim Mueller Fluorescence, Light, Absorption, Jablonski Diagram, and Beer-Law First stab at a definition: What is fluorescence?
More informationModels for Prediction, Explanation and Control: Recursive Bayesian Networks
Models for Prediction, Explanation and Control: Recursive Bayesian Networks Lorenzo Casini, Phyllis McKay Illari, Federica Russo, Jon Williamson University of Kent Draft of January 17, 2011 Abstract The
More informationA MATHEMATICAL MODEL FOR DYNAMIC SIMULATION OF APOPTOSIS PATHWAYS
A MATHEMATICAL MODEL FOR DYNAMIC SIMULATION OF APOPTOSIS PATHWAYS Paolo Massari Department of Information Engineering Bioengineering University of Padova April 2014 Advisor: Gianna Maria Toolo Coadvisor:
More informationS Phase Coupled E2f1 Destruction Ensures Homeostasis in Proliferating Tissues
S Phase Coupled E2f1 Destruction Ensures Homeostasis in Proliferating Tissues Jean M. Davidson 1, Robert J. Duronio 1,2,3 * 1 Department of Biology, The University of North Carolina at Chapel Hill, Chapel
More informationreturn in class, or Rm B
Last lectures: Genetic Switches and Oscillators PS #2 due today bf before 3PM return in class, or Rm. 68 371B Naturally occurring: lambda lysis-lysogeny decision lactose operon in E. coli Engineered: genetic
More informationRole of Mitochondrial Remodeling in Programmed Cell Death in
Developmental Cell, Vol. 12 Supplementary Data Role of Mitochondrial Remodeling in Programmed Cell Death in Drosophila melanogaster Gaurav Goyal, Brennan Fell, Apurva Sarin, Richard J. Youle, V. Sriram.
More informationNOPO modulates Egr-induced JNK-independent cell death in Drosophila
ORIGINAL ARTICLE Cell Research (2012) 22:425-431. 2012 IBCB, SIBS, CAS All rights reserved 1001-0602/12 $ 32.00 www.nature.com/cr npg NOPO modulates Egr-induced JNK-independent cell death in Drosophila
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11419 Supplementary Figure 1 Schematic representation of innate immune signaling pathways induced by intracellular Salmonella in cultured macrophages. a, During the infection Salmonella
More informationAnalysis of retinoblastoma protein function in the regulation of apoptosis
Analysis of retinoblastoma protein function in the regulation of apoptosis Analyse der Funktion des Retinoblastoma-Proteins in der Apoptose-Regulation Dissertation zur Erlangung des akademischen Grades
More informationA JNK-Dependent Pathway Is Required for TNF -Induced Apoptosis
Cell, Vol. 115, 61 70, October 3, 2003, Copyright 2003 by Cell Press A JNK-Dependent Pathway Is Required for TNF -Induced Apoptosis Yibin Deng, 1 Xiaoyang Ren, 1 Lin Yang, Yahong Lin, and Xiangwei Wu*
More informationRichik N. Ghosh, Linnette Grove, and Oleg Lapets ASSAY and Drug Development Technologies 2004, 2:
1 3/1/2005 A Quantitative Cell-Based High-Content Screening Assay for the Epidermal Growth Factor Receptor-Specific Activation of Mitogen-Activated Protein Kinase Richik N. Ghosh, Linnette Grove, and Oleg
More informationNon-linear dimensionality reduction analysis of the apoptosis signalling network. College of Science and Engineering School of Informatics
Non-linear dimensionality reduction analysis of the apoptosis signalling network Sergii Ivakhno Thesis College of Science and Engineering School of Informatics Masters of Science August 2007 The University
More informationHOXA5-Induced Apoptosis in Breast Cancer Cells Is Mediated by Caspases 2 and 8
HOXA5-Induced Apoptosis in Breast Cancer Cells Is Mediated by Caspases 2 and 8 Hexin Chen, Seung Chung and Saraswati Sukumar Mol. Cell. Biol. 2004, 24(2):924. DOI: 10.1128/MCB.24.2.924-935.2004. REFERENCES
More informationCellular Mechanisms Controlling Caspase Activation and Function. Amanda B. Parrish, Christopher D. Freel, and Sally Kornbluth
Cellular Mechanisms Controlling Caspase Activation and Function Amanda B. Parrish, Christopher D. Freel, and Sally Kornbluth Department of Pharmacology and Cancer Biology, Duke University School of Medicine,
More informationab39700 Caspase 8 Assay Kit (Colorimetric)
Version 5 Last updated 18 November 2016 ab39700 Caspase 8 Assay Kit (Colorimetric) For the rapid, sensitive and accurate measurement of caspase 8 activity in cell lysates. This product is for research
More informationCaspase 8 (active) Red Staining Kit
ab65618 Caspase 8 (active) Red Staining Kit Instructions for Use For the rapid, sensitive and accurate detection of activated Caspase 8 in living cells This product is for research use only and is not
More informationA structural view of mitochondria-mediated apoptosis
A structural view of mitochondria-mediated apoptosis Yigong Shi Mitochondria-mediated apoptosis plays a central role in animal development and tissue homeostasis, and its alteration results in a range
More informationAP Biology Gene Regulation and Development Review
AP Biology Gene Regulation and Development Review 1. What does the regulatory gene code for? 2. Is the repressor by default active/inactive? 3. What changes the repressor activity? 4. What does repressor
More informationJCB Article. The role of cytochrome c in caspase activation in Drosophila melanogaster cells
JCB Article The role of cytochrome c in caspase activation in Drosophila melanogaster cells Loretta Dorstyn, 1 Stuart Read, 1 Dimitrios Cakouros, 1 Jun R. Huh, 2 Bruce A. Hay, 2 and Sharad Kumar 1 1 Hanson
More informationTRADD mediates the tumor necrosis factor-induced apoptosis of L929 cells in the absence of RIP3
www.nature.com/scientificreports Received: 14 June 2017 Accepted: 9 November 2017 Published: xx xx xxxx OPEN TRADD mediates the tumor necrosis factor-induced apoptosis of L929 cells in the absence of RIP3
More informationMultiple Choice Review- Eukaryotic Gene Expression
Multiple Choice Review- Eukaryotic Gene Expression 1. Which of the following is the Central Dogma of cell biology? a. DNA Nucleic Acid Protein Amino Acid b. Prokaryote Bacteria - Eukaryote c. Atom Molecule
More informationKyung-Won LEE, a,b Hyun-Ju JUNG, c Hee-Juhn PARK, c Deog-Gon KIM, d Jin-Yong LEE, d and Kyung-Tae LEE*,a,b
854 Biol. Pharm. Bull. 28(5) 854 859 (2005) Vol. 28, No. 5 b -D-Xylopyranosyl-(1 3)-b -D-glucuronopyranosyl Echinocystic Acid Isolated from the Roots of Codonopsis lanceolata Induces Caspase-Dependent
More informationTypes of biological networks. I. Intra-cellurar networks
Types of biological networks I. Intra-cellurar networks 1 Some intra-cellular networks: 1. Metabolic networks 2. Transcriptional regulation networks 3. Cell signalling networks 4. Protein-protein interaction
More informationReceived 5 February 2007/Accepted 11 June 2007
JOURNAL OF VIROLOGY, Sept. 2007, p. 9319 9330 Vol. 81, No. 17 0022-538X/07/$08.00 0 doi:10.1128/jvi.00247-07 Copyright 2007, American Society for Microbiology. All Rights Reserved. Baculovirus Caspase
More informationSupplemental Figures S1 S5
Beyond reduction of atherosclerosis: PON2 provides apoptosis resistance and stabilizes tumor cells Ines Witte (1), Sebastian Altenhöfer (1), Petra Wilgenbus (1), Julianna Amort (1), Albrecht M. Clement
More informationThe Drosophila Caspase DRONC Cleaves following Glutamate or Aspartate and Is Regulated by DIAP1, HID, and GRIM*
THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 275, No. 35, Issue of September 1, pp. 27084 27093, 2000 2000 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. The Drosophila
More informationTranslation Part 2 of Protein Synthesis
Translation Part 2 of Protein Synthesis IN: How is transcription like making a jello mold? (be specific) What process does this diagram represent? A. Mutation B. Replication C.Transcription D.Translation
More informationFor the rapid, sensitive and accurate detection of active Caspase 9 in living cells
ab65615 Caspase 9 (active) FITC Staining Kit Instructions for Use For the rapid, sensitive and accurate detection of active Caspase 9 in living cells This product is for research use only and is not intended
More informationDrosophila Bruce Can Potently Suppress Rpr- and Grim-Dependent but Not Hid-Dependent Cell Death
Current Biology, Vol. 12, 1164 1168, July 9, 2002, 2002 Elsevier Science Ltd. All rights reserved. PII S0960-9822(02)00935-1 Drosophila Bruce Can Potently Suppress Rpr- and Grim-Dependent but Not Hid-Dependent
More informationApoptosis Detection Using the BD Accuri C6 Flow Cytometer
Apoptosis Detection Using the BD Accuri C6 Flow Cytometer Stacey Roys, Marketing Applications Specialist, BD Biosciences Cyndy Lane, Senior Product Manager, BD Biosciences 23-14519-00 Outline What is apoptosis?
More informationCharacterization of head involution defective (hid) as a pro-apoptotic gene in Megasalia scalaris
University of Tennessee, Knoxville Trace: Tennessee Research and Creative Exchange University of Tennessee Honors Thesis Projects University of Tennessee Honors Program 5-2015 Characterization of head
More informationSig2GRN: A Software Tool Linking Signaling Pathway with Gene Regulatory Network for Dynamic Simulation
Sig2GRN: A Software Tool Linking Signaling Pathway with Gene Regulatory Network for Dynamic Simulation Authors: Fan Zhang, Runsheng Liu and Jie Zheng Presented by: Fan Wu School of Computer Science and
More informationUnraveling Apoptosis Signalling using Linear Control Methods: Linking the Loop Gain to Reverting the Decision to Undergo Apoptosis
Preprints of the 9th International Symposium on Advanced Control of Chemical Processes The International Federation of Automatic Control TuPoster.3 Unraveling Apoptosis Signalling using Linear Control
More information