Deciphering regulatory networks by promoter sequence analysis

Size: px
Start display at page:

Download "Deciphering regulatory networks by promoter sequence analysis"

Transcription

1 Bioinformatics Workshop 2009 Interpreting Gene Lists from -omics Studies Deciphering regulatory networks by promoter sequence analysis Elodie Portales-Casamar University of British Columbia Bioinformatics Workshop - Interpreting Gene Lists from -omics Studies 1 Module #: Title of Module Bioinformatics Workshop - Interpreting Gene Lists from -omics Studies 2

2 Overview Part 1: Overview of transcription Lab 1: Promoters in Genome Browser (UCSC and PAZAR) Part 2: Prediction of transcription factor binding sites using binding profiles ( Discrimination ) Lab 2: TFBS scan (ORCAtk) Part 3: Interrogation of sets of co-expressed genes to identify mediating transcription factors Lab 3: TFBS Over-Representation (opossum) 3 Restrictions in Coverage Focus on Eukaryotic cells and PolII Promoters Principles apply to prokaryotes Will provide suggestions for similar tools for other species as requested Many of the examples drawn from the Wasserman lab s work there are equivalent tools 4

3 Part 1 Introduction to transcription in eukaryotic cells 5 Complexity in Transcription Chromatin Distal enhancer Proximal enhancer Core Promoter Distal enhancer 6

4 Studying gene expression at the bench EMSA DNase I footprinting ChIP- chip SELEX experiment Gene reporter assay Expensive and Time-Consuming!!! ww.chiponchip.org/ w w.abcam.com w w.hku.hk PAZAR and UCSC 8

5 Part 2 Prediction of TF Binding Sites Teaching a computer to find TFBS 9 TF Binding Profile Aligned binding sites TCACTATGATTCAGCAACAAA TCACAGTGAGTCGGCAAAATT TCATGCTGACTCAGCGGATCG CAACCATGACACAGCATAAAA CAGGCATGACATTGCATTTTT TAATGGTGACAAAGCAACTTT GGAGCATGACCCAGCAGAAGG CTGGGATGACATAGCATTCAT TCAGAATGACAAAGCAGAAAT TCACCGTTACTCAGCACTTTG AGGTGGTGATGTTGCATCACA CCAGGATGACTTAGCAAAAAC AGCCTGTGACTGGGCCGGGGC AGACAATGACTAAGCAGAAAT TCCCCGTGACTCAGCGCTTTG TCAGCATGACTCAGCAGTCGC CCTCCATGACAAAGCACTTTT AGCGGGTGACCAAGCCCTCAA TCAGGGTGACTCAGCAGCTTG TCTGTGTGACTCAGCTTTGGA Position Frequency Matrix (PFM) A C G T Position Specific Scoring Matrix (PSSM) A C G T A T G A T T C A G C A Score = 13.6 Binding Profile Logo 10

6 JASPAR: AN OPEN-ACCESS DATABASE OF TF BINDING PROFILES ( jaspar.genereg.net ) 11 Analysis of TFBS with Phylogenetic Footprinting Scanning a single sequence Scanning a pair orf orthologous sequences for conserved patterns in conserved sequence regions A dramatic improvement in the percentage of biologically significant detections Low specificity of profiles: too many hits great majority not biologically significant 12

7 Phylogenetic Footprinting Dramatically Reduces Spurious Hits Human Mouse Actin, alpha cardiac 13 Choosing the right species for pairwise comparison... CHICKEN MOUSE HUMAN COW HUMAN HUMAN 14

8 ORCAtk 15 TFBS Discrimination Tools Phylogenetic Footprinting Servers FOOTER CONSITE rvista ORCAtk SNPs in TFBS Analysis RAVEN Prokaryotes or Yeast PRODORIC YEASTRACT Software Packages TOUCAN Programming Tools TFBS ORCAtk 16

9 Part 3: Inferring Regulating TFs for Sets of Co-Expressed Genes 17 Two Examples of TFBS Over-Representation Foreground Foreground Background More Genes with TFBS Background More Total TFBS 18

10 Statistical Methods for Identifying Over-represented TFBS Fisher exact probability scores Based on the number of genes containing the TFBS relative to background Hypergeometric probability distribution Binomial test (Z scores) Based on the number of occurrences of the TFBS relative to background Normalized for sequence length Simple binomial distribution model 19 opossum Procedure Set of coexpressed genes Automated sequence retrieval from EnsEMBL Phylogenetic Footprinting ORCA Putative mediating transcription factors Statistical significance of binding sites Detection of transcription factor binding sites 20

11 Validation using Reference Gene Sets A. Muscle-specific (23 input; 16 analyzed) B. Liver-specific (20 input; 12 analyzed) Rank Z-score Fisher Rank Z-score Fisher SRF e-02 HNF e-08 MEF e-04 HLF e-03 c-myb_ e-03 Sox e-01 Myf e-03 FREAC e-01 TEF e-03 HNF-3beta e-02 deltaef e-02 SOX e-01 S e-01 Yin-Yang e-01 Irf e-01 S e-02 Thing1-E e-02 Irf e-01 HNF e-01 COUP-TF e-01 TFs with experimentally-verified sites in the reference sets. 21 Empirical Selection of Parameters based on Reference Studies p65 NF- _B c-rel p50 HNF-1 SRF Z-score TEF-1 MEF2 FREAC-2 Myf cebp SP1 HNF-3 _ Muscle Liver NF-_B Z-score cutoff Fisher cutoff E E E E E-01 Fisher p-value 22

12 Structurally-related TFs with Indistinguishable TFBS Most structurally related TFs bind to highly similar patterns Zn-finger is a big exception 23 opossum Server 24

13 TFBS Over-representation Analysis Tools o P O S S U M : h t t p : / / w w w. c i s r e g. c a / o P O S S U M T F M - E x p l o r e r : h ttp :/ / b i o i n f o. lifl.fr/ T F M E / fo rm A s a p : h ttp :/ / a s a p. b i n f. k u. d k / A s a p / H o m e.h t m l 25 REFLECTIONS Part 2 Futility Theorem Essentially predictions of individual TFBS have no relationship to an in vivo function Successful bioinformatics methods for site discrimination incorporate additional information (clusters, conservation) Part 3 TFBS over-representation is a powerful new means to identify TFs likely to contribute to observed patterns of co-expression Generally best performance has been with data directly linked to a transcription factor Statistical significance is extremely sensitive to gene set size TFs in the same structural family tend to have similar binding preferences 26

14 The end More tomorrow in the lab 27 Part 4: de novo Discovery of TF Binding Sites (Gibbs sampling method) 28

15 Gibbs Sampling (grossly over-simplified) ttcgctcc cgatacgc tgctacct tgacttcc agacctca ctgtagtg acgcatct A C G T Pattern Discovery Gibbs sampling is guaranteed to return an optimal pattern if repeated sufficiently often Procedure is fast, so running many 1000s of times is feasible Unfortunately, we have a problem what if the mediating TFBS are not strongly overrepresented relative to other patterns 30

16 Applied Pattern Discovery is Acutely Sensitive to Noise PATTERN SIMILARITY vs. TRUE MEF2 PROFILE Pink line is negative control with no Mef2 sites included True Mef2 Binding Sites SEQUENCE LENGTH 31 Four Approaches to Improve Sensitivity Better background models -Higher-order properties of DNA Phylogenetic Footprinting Human:Mouse comparison eliminates ~75% of sequence Regulatory Modules Architectural rules Limit the types of binding profiles allowed TFBS patterns are NOT random 32

17 Pattern Discovery Summary Pattern discovery methods can recover overrepresented patterns in the promoters of coexpressed genes Methods are acutely sensitive to noise, indicating that the signal we seek is weak TFs tolerate great variability between binding sites As for pattern discrimination, supplementary information/approaches are required to overcome the noise 33

Intro Gene regulation Synteny The End. Today. Gene regulation Synteny Good bye!

Intro Gene regulation Synteny The End. Today. Gene regulation Synteny Good bye! Today Gene regulation Synteny Good bye! Gene regulation What governs gene transcription? Genes active under different circumstances. Gene regulation What governs gene transcription? Genes active under

More information

XIII International PhD Workshop OWD 2011, October 2011

XIII International PhD Workshop OWD 2011, October 2011 XIII International PhD Workshop OWD 2011, 22 25 October 2011 Structure of the promoter region in NF-kappaB dependent genes in view of NF-kappaB transcription factors family Marta Iwanaszko, Silesian University

More information

Discovering MultipleLevels of Regulatory Networks

Discovering MultipleLevels of Regulatory Networks Discovering MultipleLevels of Regulatory Networks IAS EXTENDED WORKSHOP ON GENOMES, CELLS, AND MATHEMATICS Hong Kong, July 25, 2018 Gary D. Stormo Department of Genetics Outline of the talk 1. Transcriptional

More information

Transcription Regulation and Gene Expression in Eukaryotes FS08 Pharmacenter/Biocenter Auditorium 1 Wednesdays 16h15-18h00.

Transcription Regulation and Gene Expression in Eukaryotes FS08 Pharmacenter/Biocenter Auditorium 1 Wednesdays 16h15-18h00. Transcription Regulation and Gene Expression in Eukaryotes FS08 Pharmacenter/Biocenter Auditorium 1 Wednesdays 16h15-18h00. Promoters and Enhancers Systematic discovery of transcriptional regulatory motifs

More information

Introduction to Bioinformatics

Introduction to Bioinformatics CSCI8980: Applied Machine Learning in Computational Biology Introduction to Bioinformatics Rui Kuang Department of Computer Science and Engineering University of Minnesota kuang@cs.umn.edu History of Bioinformatics

More information

Measuring TF-DNA interactions

Measuring TF-DNA interactions Measuring TF-DNA interactions How is Biological Complexity Achieved? Mediated by Transcription Factors (TFs) 2 Regulation of Gene Expression by Transcription Factors TF trans-acting factors TF TF TF TF

More information

Similarity of position frequency matrices for transcription factor binding sites

Similarity of position frequency matrices for transcription factor binding sites BIOINFORMATICS ORIGINAL PAPER Vol. 21 no. 3 2005, pages 307 313 doi:10.1093/bioinformatics/bth480 Similarity of position frequency matrices for transcription factor binding sites Dustin E. Schones 1,2,,

More information

Alignment. Peak Detection

Alignment. Peak Detection ChIP seq ChIP Seq Hongkai Ji et al. Nature Biotechnology 26: 1293-1300. 2008 ChIP Seq Analysis Alignment Peak Detection Annotation Visualization Sequence Analysis Motif Analysis Alignment ELAND Bowtie

More information

Chapter 15 Active Reading Guide Regulation of Gene Expression

Chapter 15 Active Reading Guide Regulation of Gene Expression Name: AP Biology Mr. Croft Chapter 15 Active Reading Guide Regulation of Gene Expression The overview for Chapter 15 introduces the idea that while all cells of an organism have all genes in the genome,

More information

Computational methods for predicting protein-protein interactions

Computational methods for predicting protein-protein interactions Computational methods for predicting protein-protein interactions Tomi Peltola T-61.6070 Special course in bioinformatics I 3.4.2008 Outline Biological background Protein-protein interactions Computational

More information

Evolutionary analysis of the well characterized endo16 promoter reveals substantial variation within functional sites

Evolutionary analysis of the well characterized endo16 promoter reveals substantial variation within functional sites Evolutionary analysis of the well characterized endo16 promoter reveals substantial variation within functional sites Paper by: James P. Balhoff and Gregory A. Wray Presentation by: Stephanie Lucas Reviewed

More information

Gene Regula*on, ChIP- X and DNA Mo*fs. Statistics in Genomics Hongkai Ji

Gene Regula*on, ChIP- X and DNA Mo*fs. Statistics in Genomics Hongkai Ji Gene Regula*on, ChIP- X and DNA Mo*fs Statistics in Genomics Hongkai Ji (hji@jhsph.edu) Genetic information is stored in DNA TCAGTTGGAGCTGCTCCCCCACGGCCTCTCCTCACATTCCACGTCCTGTAGCTCTATGACCTCCACCTTTGAGTCCCTCCTC

More information

Networks & pathways. Hedi Peterson MTAT Bioinformatics

Networks & pathways. Hedi Peterson MTAT Bioinformatics Networks & pathways Hedi Peterson (peterson@quretec.com) MTAT.03.239 Bioinformatics 03.11.2010 Networks are graphs Nodes Edges Edges Directed, undirected, weighted Nodes Genes Proteins Metabolites Enzymes

More information

Example of Function Prediction

Example of Function Prediction Find similar genes Example of Function Prediction Suggesting functions of newly identified genes It was known that mutations of NF1 are associated with inherited disease neurofibromatosis 1; but little

More information

Graph Alignment and Biological Networks

Graph Alignment and Biological Networks Graph Alignment and Biological Networks Johannes Berg http://www.uni-koeln.de/ berg Institute for Theoretical Physics University of Cologne Germany p.1/12 Networks in molecular biology New large-scale

More information

Chapter 8. Regulatory Motif Discovery: from Decoding to Meta-Analysis. 1 Introduction. Qing Zhou Mayetri Gupta

Chapter 8. Regulatory Motif Discovery: from Decoding to Meta-Analysis. 1 Introduction. Qing Zhou Mayetri Gupta Chapter 8 Regulatory Motif Discovery: from Decoding to Meta-Analysis Qing Zhou Mayetri Gupta Abstract Gene transcription is regulated by interactions between transcription factors and their target binding

More information

Transcrip:on factor binding mo:fs

Transcrip:on factor binding mo:fs Transcrip:on factor binding mo:fs BMMB- 597D Lecture 29 Shaun Mahony Transcrip.on factor binding sites Short: Typically between 6 20bp long Degenerate: TFs have favorite binding sequences but don t require

More information

Geert Geeven. April 14, 2010

Geert Geeven. April 14, 2010 iction of Gene Regulatory Interactions NDNS+ Workshop April 14, 2010 Today s talk - Outline Outline Biological Background Construction of Predictors The main aim of my project is to better understand the

More information

Tiffany Samaroo MB&B 452a December 8, Take Home Final. Topic 1

Tiffany Samaroo MB&B 452a December 8, Take Home Final. Topic 1 Tiffany Samaroo MB&B 452a December 8, 2003 Take Home Final Topic 1 Prior to 1970, protein and DNA sequence alignment was limited to visual comparison. This was a very tedious process; even proteins with

More information

Bioinformatics. Dept. of Computational Biology & Bioinformatics

Bioinformatics. Dept. of Computational Biology & Bioinformatics Bioinformatics Dept. of Computational Biology & Bioinformatics 3 Bioinformatics - play with sequences & structures Dept. of Computational Biology & Bioinformatics 4 ORGANIZATION OF LIFE ROLE OF BIOINFORMATICS

More information

CISC 636 Computational Biology & Bioinformatics (Fall 2016)

CISC 636 Computational Biology & Bioinformatics (Fall 2016) CISC 636 Computational Biology & Bioinformatics (Fall 2016) Predicting Protein-Protein Interactions CISC636, F16, Lec22, Liao 1 Background Proteins do not function as isolated entities. Protein-Protein

More information

L3.1: Circuits: Introduction to Transcription Networks. Cellular Design Principles Prof. Jenna Rickus

L3.1: Circuits: Introduction to Transcription Networks. Cellular Design Principles Prof. Jenna Rickus L3.1: Circuits: Introduction to Transcription Networks Cellular Design Principles Prof. Jenna Rickus In this lecture Cognitive problem of the Cell Introduce transcription networks Key processing network

More information

Introduction to Bioinformatics Online Course: IBT

Introduction to Bioinformatics Online Course: IBT Introduction to Bioinformatics Online Course: IBT Multiple Sequence Alignment Building Multiple Sequence Alignment Lec1 Building a Multiple Sequence Alignment Learning Outcomes 1- Understanding Why multiple

More information

Procedure to Create NCBI KOGS

Procedure to Create NCBI KOGS Procedure to Create NCBI KOGS full details in: Tatusov et al (2003) BMC Bioinformatics 4:41. 1. Detect and mask typical repetitive domains Reason: masking prevents spurious lumping of non-orthologs based

More information

Modeling Motifs Collecting Data (Measuring and Modeling Specificity of Protein-DNA Interactions)

Modeling Motifs Collecting Data (Measuring and Modeling Specificity of Protein-DNA Interactions) Modeling Motifs Collecting Data (Measuring and Modeling Specificity of Protein-DNA Interactions) Computational Genomics Course Cold Spring Harbor Labs Oct 31, 2016 Gary D. Stormo Department of Genetics

More information

De novo identification of motifs in one species. Modified from Serafim Batzoglou s lecture notes

De novo identification of motifs in one species. Modified from Serafim Batzoglou s lecture notes De novo identification of motifs in one species Modified from Serafim Batzoglou s lecture notes Finding Regulatory Motifs... Given a collection of genes that may be regulated by the same transcription

More information

Ch. 9 Multiple Sequence Alignment (MSA)

Ch. 9 Multiple Sequence Alignment (MSA) Ch. 9 Multiple Sequence Alignment (MSA) - gather seqs. to make MSA - doing MSA with ClustalW - doing MSA with Tcoffee - comparing seqs. that cannot align Introduction - from pairwise alignment to MSA -

More information

Transcription Regulation And Gene Expression in Eukaryotes UPSTREAM TRANSCRIPTION FACTORS

Transcription Regulation And Gene Expression in Eukaryotes UPSTREAM TRANSCRIPTION FACTORS Transcription Regulation And Gene Expression in Eukaryotes UPSTREAM TRANSCRIPTION FACTORS RG. Clerc March 26. 2008 UPSTREAM TRANSCRIPTION FACTORS Experimental approaches DNA binding domains (DBD) Transcription

More information

Computation-Based Discovery of Cis-Regulatory. Modules by Hidden Markov Model

Computation-Based Discovery of Cis-Regulatory. Modules by Hidden Markov Model Computation-Based Discovery of Cis-Regulatory Modules by Hidden Markov Model Jing Wu and Jun Xie Department of Statistics Purdue University 150 N. University Street West Lafayette, IN 47907 Tel: 765-494-6032

More information

Computational Genomics. Uses of evolutionary theory

Computational Genomics. Uses of evolutionary theory Computational Genomics 10-810/02 810/02-710, Spring 2009 Model-based Comparative Genomics Eric Xing Lecture 14, March 2, 2009 Reading: class assignment Eric Xing @ CMU, 2005-2009 1 Uses of evolutionary

More information

Quantitative Bioinformatics

Quantitative Bioinformatics Chapter 9 Class Notes Signals in DNA 9.1. The Biological Problem: since proteins cannot read, how do they recognize nucleotides such as A, C, G, T? Although only approximate, proteins actually recognize

More information

Transcrip)on Regula)on And Gene Expression in Eukaryotes Cycle G2 (lecture 13709) FS 2014 P Ma?hias & RG Clerc

Transcrip)on Regula)on And Gene Expression in Eukaryotes Cycle G2 (lecture 13709) FS 2014 P Ma?hias & RG Clerc Transcrip)on Regula)on And Gene Expression in Eukaryotes Cycle G2 (lecture 13709) FS 2014 P Ma?hias & RG Clerc P. Ma?hias, March 5th, 2014 The Basics of Transcrip-on (2) General Transcrip-on Factors: TBP/TFIID

More information

Quantitative Measurement of Genome-wide Protein Domain Co-occurrence of Transcription Factors

Quantitative Measurement of Genome-wide Protein Domain Co-occurrence of Transcription Factors Quantitative Measurement of Genome-wide Protein Domain Co-occurrence of Transcription Factors Arli Parikesit, Peter F. Stadler, Sonja J. Prohaska Bioinformatics Group Institute of Computer Science University

More information

Kernels for gene regulatory regions

Kernels for gene regulatory regions Kernels for gene regulatory regions Jean-Philippe Vert Geostatistics Center Ecole des Mines de Paris - ParisTech Jean-Philippe.Vert@ensmp.fr Robert Thurman Division of Medical Genetics University of Washington

More information

Whole Genome Alignments and Synteny Maps

Whole Genome Alignments and Synteny Maps Whole Genome Alignments and Synteny Maps IINTRODUCTION It was not until closely related organism genomes have been sequenced that people start to think about aligning genomes and chromosomes instead of

More information

Written Exam 15 December Course name: Introduction to Systems Biology Course no

Written Exam 15 December Course name: Introduction to Systems Biology Course no Technical University of Denmark Written Exam 15 December 2008 Course name: Introduction to Systems Biology Course no. 27041 Aids allowed: Open book exam Provide your answers and calculations on separate

More information

Ensembl focuses on metazoan (animal) genomes. The genomes currently available at the Ensembl site are:

Ensembl focuses on metazoan (animal) genomes. The genomes currently available at the Ensembl site are: Comparative genomics and proteomics Species available Ensembl focuses on metazoan (animal) genomes. The genomes currently available at the Ensembl site are: Vertebrates: human, chimpanzee, mouse, rat,

More information

RNA Synthesis and Processing

RNA Synthesis and Processing RNA Synthesis and Processing Introduction Regulation of gene expression allows cells to adapt to environmental changes and is responsible for the distinct activities of the differentiated cell types that

More information

Similarity Analysis between Transcription Factor Binding Sites by Bayesian Hypothesis Test *

Similarity Analysis between Transcription Factor Binding Sites by Bayesian Hypothesis Test * JOURNAL OF INFORMATION SCIENCE AND ENGINEERING 27, 855-868 (20) Similarity Analysis between Transcription Factor Binding Sites by Bayesian Hypothesis Test * QIAN LIU +, SAN-YANG LIU AND LI-FANG LIU + Department

More information

Multivariate point process models

Multivariate point process models Faculty of Science Multivariate point process models Niels Richard Hansen Department of Mathematical Sciences January 8, 200 Slide /20 Ideas and outline General aim: To build and implement a flexible (non-parametric),

More information

Network Biology-part II

Network Biology-part II Network Biology-part II Jun Zhu, Ph. D. Professor of Genomics and Genetic Sciences Icahn Institute of Genomics and Multi-scale Biology The Tisch Cancer Institute Icahn Medical School at Mount Sinai New

More information

A Database of human biological pathways

A Database of human biological pathways A Database of human biological pathways Steve Jupe - sjupe@ebi.ac.uk 1 Rationale Journal information Nature 407(6805):770-6.The Biochemistry of Apoptosis. Caspase-8 is the key initiator caspase in the

More information

Proteomics. Yeast two hybrid. Proteomics - PAGE techniques. Data obtained. What is it?

Proteomics. Yeast two hybrid. Proteomics - PAGE techniques. Data obtained. What is it? Proteomics What is it? Reveal protein interactions Protein profiling in a sample Yeast two hybrid screening High throughput 2D PAGE Automatic analysis of 2D Page Yeast two hybrid Use two mating strains

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary information S1 (box). Supplementary Methods description. Prokaryotic Genome Database Archaeal and bacterial genome sequences were downloaded from the NCBI FTP site (ftp://ftp.ncbi.nlm.nih.gov/genomes/all/)

More information

Synteny Portal Documentation

Synteny Portal Documentation Synteny Portal Documentation Synteny Portal is a web application portal for visualizing, browsing, searching and building synteny blocks. Synteny Portal provides four main web applications: SynCircos,

More information

Few selected Human Transcription Factors Sequence Analysis and their Phylogenetic Relationship

Few selected Human Transcription Factors Sequence Analysis and their Phylogenetic Relationship International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 6 Number 6 (2017) pp. 776-785 Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2017.606.091

More information

QB LECTURE #4: Motif Finding

QB LECTURE #4: Motif Finding QB LECTURE #4: Motif Finding Adam Siepel Nov. 20, 2015 2 Plan for Today Probability models for binding sites Scoring and detecting binding sites De novo motif finding 3 Transcription Initiation Chromatin

More information

Biology. Biology. Slide 1 of 26. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 26. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 26 Fruit fly chromosome 12-5 Gene Regulation Mouse chromosomes Fruit fly embryo Mouse embryo Adult fruit fly Adult mouse 2 of 26 Gene Regulation: An Example Gene Regulation: An Example

More information

identifiers matched to homologous genes. Probeset annotation files for each array platform were used to

identifiers matched to homologous genes. Probeset annotation files for each array platform were used to SUPPLEMENTARY METHODS Data combination and normalization Prior to data analysis we first had to appropriately combine all 1617 arrays such that probeset identifiers matched to homologous genes. Probeset

More information

Bioinformatics Exercises

Bioinformatics Exercises Bioinformatics Exercises AP Biology Teachers Workshop Susan Cates, Ph.D. Evolution of Species Phylogenetic Trees show the relatedness of organisms Common Ancestor (Root of the tree) 1 Rooted vs. Unrooted

More information

GLOBEX Bioinformatics (Summer 2015) Genetic networks and gene expression data

GLOBEX Bioinformatics (Summer 2015) Genetic networks and gene expression data GLOBEX Bioinformatics (Summer 2015) Genetic networks and gene expression data 1 Gene Networks Definition: A gene network is a set of molecular components, such as genes and proteins, and interactions between

More information

Position-specific scoring matrices (PSSM)

Position-specific scoring matrices (PSSM) Regulatory Sequence nalysis Position-specific scoring matrices (PSSM) Jacques van Helden Jacques.van-Helden@univ-amu.fr Université d ix-marseille, France Technological dvances for Genomics and Clinics

More information

3.B.1 Gene Regulation. Gene regulation results in differential gene expression, leading to cell specialization.

3.B.1 Gene Regulation. Gene regulation results in differential gene expression, leading to cell specialization. 3.B.1 Gene Regulation Gene regulation results in differential gene expression, leading to cell specialization. We will focus on gene regulation in prokaryotes first. Gene regulation accounts for some of

More information

Chapter 7: Regulatory Networks

Chapter 7: Regulatory Networks Chapter 7: Regulatory Networks 7.2 Analyzing Regulation Prof. Yechiam Yemini (YY) Computer Science Department Columbia University The Challenge How do we discover regulatory mechanisms? Complexity: hundreds

More information

10-810: Advanced Algorithms and Models for Computational Biology. microrna and Whole Genome Comparison

10-810: Advanced Algorithms and Models for Computational Biology. microrna and Whole Genome Comparison 10-810: Advanced Algorithms and Models for Computational Biology microrna and Whole Genome Comparison Central Dogma: 90s Transcription factors DNA transcription mrna translation Proteins Central Dogma:

More information

BLAST. Varieties of BLAST

BLAST. Varieties of BLAST BLAST Basic Local Alignment Search Tool (1990) Altschul, Gish, Miller, Myers, & Lipman Uses short-cuts or heuristics to improve search speed Like speed-reading, does not examine every nucleotide of database

More information

PhyloGibbs: A Gibbs Sampling Motif Finder That Incorporates Phylogeny

PhyloGibbs: A Gibbs Sampling Motif Finder That Incorporates Phylogeny PhyloGibbs: A Gibbs Sampling Motif Finder That Incorporates Phylogeny Rahul Siddharthan 1,2, Eric D. Siggia 1, Erik van Nimwegen 1,3* 1 Center for Studies in Physics and Biology, The Rockefeller University,

More information

Genome 541 Introduction to Computational Molecular Biology. Max Libbrecht

Genome 541 Introduction to Computational Molecular Biology. Max Libbrecht Genome 541 Introduction to Computational Molecular Biology Max Libbrecht Genome 541 units Max Libbrecht: Gene regulation and epigenomics Postdoc, Bill Noble s lab Yi Yin: Bayesian statistics Postdoc, Jay

More information

Comparative Network Analysis

Comparative Network Analysis Comparative Network Analysis BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2016 Anthony Gitter gitter@biostat.wisc.edu These slides, excluding third-party material, are licensed under CC BY-NC 4.0 by

More information

Genome Annotation. Bioinformatics and Computational Biology. Genome sequencing Assembly. Gene prediction. Protein targeting.

Genome Annotation. Bioinformatics and Computational Biology. Genome sequencing Assembly. Gene prediction. Protein targeting. Genome Annotation Bioinformatics and Computational Biology Genome Annotation Frank Oliver Glöckner 1 Genome Analysis Roadmap Genome sequencing Assembly Gene prediction Protein targeting trna prediction

More information

Inferring Protein-Signaling Networks

Inferring Protein-Signaling Networks Inferring Protein-Signaling Networks Lectures 14 Nov 14, 2011 CSE 527 Computational Biology, Fall 2011 Instructor: Su-In Lee TA: Christopher Miles Monday & Wednesday 12:00-1:20 Johnson Hall (JHN) 022 1

More information

Whole Genome Human/Mouse Phylogenetic Footprinting of Potential Transcription Regulatory Signals. E. Cheremushkin, A. Kel

Whole Genome Human/Mouse Phylogenetic Footprinting of Potential Transcription Regulatory Signals. E. Cheremushkin, A. Kel Whole Genome Human/Mouse Phylogenetic Footprinting of Potential Transcription Regulatory Signals E. Cheremushkin, A. Kel Pacific Symposium on Biocomputing 8:9-30(003) WHOLE GEN OM E HU M A N / M OU S E

More information

Fundamentally different strategies for transcriptional regulation are revealed by information-theoretical analysis of binding motifs

Fundamentally different strategies for transcriptional regulation are revealed by information-theoretical analysis of binding motifs Fundamentally different strategies for transcriptional regulation are revealed by information-theoretical analysis of binding motifs Zeba Wunderlich 1* and Leonid A. Mirny 1,2 1 Biophysics Program, Harvard

More information

Practical considerations of working with sequencing data

Practical considerations of working with sequencing data Practical considerations of working with sequencing data File Types Fastq ->aligner -> reference(genome) coordinates Coordinate files SAM/BAM most complete, contains all of the info in fastq and more!

More information

The Eukaryotic Genome and Its Expression. The Eukaryotic Genome and Its Expression. A. The Eukaryotic Genome. Lecture Series 11

The Eukaryotic Genome and Its Expression. The Eukaryotic Genome and Its Expression. A. The Eukaryotic Genome. Lecture Series 11 The Eukaryotic Genome and Its Expression Lecture Series 11 The Eukaryotic Genome and Its Expression A. The Eukaryotic Genome B. Repetitive Sequences (rem: teleomeres) C. The Structures of Protein-Coding

More information

12-5 Gene Regulation

12-5 Gene Regulation 12-5 Gene Regulation Fruit fly chromosome 12-5 Gene Regulation Mouse chromosomes Fruit fly embryo Mouse embryo Adult fruit fly Adult mouse 1 of 26 12-5 Gene Regulation Gene Regulation: An Example Gene

More information

CSCE555 Bioinformatics. Protein Function Annotation

CSCE555 Bioinformatics. Protein Function Annotation CSCE555 Bioinformatics Protein Function Annotation Why we need to do function annotation? Fig from: Network-based prediction of protein function. Molecular Systems Biology 3:88. 2007 What s function? The

More information

Bioinformatics Chapter 1. Introduction

Bioinformatics Chapter 1. Introduction Bioinformatics Chapter 1. Introduction Outline! Biological Data in Digital Symbol Sequences! Genomes Diversity, Size, and Structure! Proteins and Proteomes! On the Information Content of Biological Sequences!

More information

Transcription factors (TFs) regulate genes by binding to their

Transcription factors (TFs) regulate genes by binding to their CisModule: De novo discovery of cis-regulatory modules by hierarchical mixture modeling Qing Zhou* and Wing H. Wong* *Department of Statistics, Harvard University, 1 Oxford Street, Cambridge, MA 02138;

More information

Big Idea 3: Living systems store, retrieve, transmit and respond to information essential to life processes. Tuesday, December 27, 16

Big Idea 3: Living systems store, retrieve, transmit and respond to information essential to life processes. Tuesday, December 27, 16 Big Idea 3: Living systems store, retrieve, transmit and respond to information essential to life processes. Enduring understanding 3.B: Expression of genetic information involves cellular and molecular

More information

Genome 541 Gene regulation and epigenomics Lecture 2 Transcription factor binding using functional genomics

Genome 541 Gene regulation and epigenomics Lecture 2 Transcription factor binding using functional genomics Genome 541 Gene regulation and epigenomics Lecture 2 Transcription factor binding using functional genomics I believe it is helpful to number your slides for easy reference. It's been a while since I took

More information

Introduction to Bioinformatics. Shifra Ben-Dor Irit Orr

Introduction to Bioinformatics. Shifra Ben-Dor Irit Orr Introduction to Bioinformatics Shifra Ben-Dor Irit Orr Lecture Outline: Technical Course Items Introduction to Bioinformatics Introduction to Databases This week and next week What is bioinformatics? A

More information

Towards Reverse Engineering of Genetic Regulatory Networks

Towards Reverse Engineering of Genetic Regulatory Networks Towards Reverse Engineering of Genetic Regulatory Networks Zelmina Lubovac, Björn Olsson [zelmina,bjorne]@ida.his.se Department of Computer Science, University of Skövde, Box 408, SE-541 28 Skövde, Sweden

More information

Bioinformatics 2. Yeast two hybrid. Proteomics. Proteomics

Bioinformatics 2. Yeast two hybrid. Proteomics. Proteomics GENOME Bioinformatics 2 Proteomics protein-gene PROTEOME protein-protein METABOLISM Slide from http://www.nd.edu/~networks/ Citrate Cycle Bio-chemical reactions What is it? Proteomics Reveal protein Protein

More information

Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday

Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday 1. What is the Central Dogma? 2. How does prokaryotic DNA compare to eukaryotic DNA? 3. How is DNA

More information

Gene Regulation and Expression

Gene Regulation and Expression THINK ABOUT IT Think of a library filled with how-to books. Would you ever need to use all of those books at the same time? Of course not. Now picture a tiny bacterium that contains more than 4000 genes.

More information

CMPS 6630: Introduction to Computational Biology and Bioinformatics. Structure Comparison

CMPS 6630: Introduction to Computational Biology and Bioinformatics. Structure Comparison CMPS 6630: Introduction to Computational Biology and Bioinformatics Structure Comparison Protein Structure Comparison Motivation Understand sequence and structure variability Understand Domain architecture

More information

Understanding Science Through the Lens of Computation. Richard M. Karp Nov. 3, 2007

Understanding Science Through the Lens of Computation. Richard M. Karp Nov. 3, 2007 Understanding Science Through the Lens of Computation Richard M. Karp Nov. 3, 2007 The Computational Lens Exposes the computational nature of natural processes and provides a language for their description.

More information

Transcription Factor Binding Site Positioning in Yeast: Proximal Promoter Motifs Characterize TATA-Less Promoters

Transcription Factor Binding Site Positioning in Yeast: Proximal Promoter Motifs Characterize TATA-Less Promoters Transcription Factor Binding Site Positioning in Yeast: Proximal Promoter Motifs Characterize TATA-Less Promoters Ionas Erb 1, Erik van Nimwegen 2 * 1 Bioinformatics and Genomics program, Center for Genomic

More information

Clustering and Network

Clustering and Network Clustering and Network Jing-Dong Jackie Han jdhan@picb.ac.cn http://www.picb.ac.cn/~jdhan Copy Right: Jing-Dong Jackie Han What is clustering? A way of grouping together data samples that are similar in

More information

Identifying Signaling Pathways

Identifying Signaling Pathways These slides, excluding third-party material, are licensed under CC BY-NC 4.0 by Anthony Gitter, Mark Craven, Colin Dewey Identifying Signaling Pathways BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2018

More information

S1 Gene ontology (GO) analysis of the network alignment results

S1 Gene ontology (GO) analysis of the network alignment results 1 Supplementary Material for Effective comparative analysis of protein-protein interaction networks by measuring the steady-state network flow using a Markov model Hyundoo Jeong 1, Xiaoning Qian 1 and

More information

How much non-coding DNA do eukaryotes require?

How much non-coding DNA do eukaryotes require? How much non-coding DNA do eukaryotes require? Andrei Zinovyev UMR U900 Computational Systems Biology of Cancer Institute Curie/INSERM/Ecole de Mine Paritech Dr. Sebastian Ahnert Dr. Thomas Fink Bioinformatics

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. Schematic pipeline for single-cell genome assembly, cleaning and annotation. a. The assembly process was optimized to account for multiple cells putatively

More information

Gene Ontology and Functional Enrichment. Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein

Gene Ontology and Functional Enrichment. Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein Gene Ontology and Functional Enrichment Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein The parsimony principle: A quick review Find the tree that requires the fewest

More information

Three types of RNA polymerase in eukaryotic nuclei

Three types of RNA polymerase in eukaryotic nuclei Three types of RNA polymerase in eukaryotic nuclei Type Location RNA synthesized Effect of α-amanitin I Nucleolus Pre-rRNA for 18,.8 and 8S rrnas Insensitive II Nucleoplasm Pre-mRNA, some snrnas Sensitive

More information

Latent Variable models for GWAs

Latent Variable models for GWAs Latent Variable models for GWAs Oliver Stegle Machine Learning and Computational Biology Research Group Max-Planck-Institutes Tübingen, Germany September 2011 O. Stegle Latent variable models for GWAs

More information

Comparing transcription factor regulatory networks of human cell types. The Protein Network Workshop June 8 12, 2015

Comparing transcription factor regulatory networks of human cell types. The Protein Network Workshop June 8 12, 2015 Comparing transcription factor regulatory networks of human cell types The Protein Network Workshop June 8 12, 2015 KWOK-PUI CHOI Dept of Statistics & Applied Probability, Dept of Mathematics, NUS OUTLINE

More information

BIOINFORMATICS LAB AP BIOLOGY

BIOINFORMATICS LAB AP BIOLOGY BIOINFORMATICS LAB AP BIOLOGY Bioinformatics is the science of collecting and analyzing complex biological data. Bioinformatics combines computer science, statistics and biology to allow scientists to

More information

Whole-genome analysis of GCN4 binding in S.cerevisiae

Whole-genome analysis of GCN4 binding in S.cerevisiae Whole-genome analysis of GCN4 binding in S.cerevisiae Lillian Dai Alex Mallet Gcn4/DNA diagram (CREB symmetric site and AP-1 asymmetric site: Song Tan, 1999) removed for copyright reasons. What is GCN4?

More information

Regulation of Transcription in Eukaryotes. Nelson Saibo

Regulation of Transcription in Eukaryotes. Nelson Saibo Regulation of Transcription in Eukaryotes Nelson Saibo saibo@itqb.unl.pt In eukaryotes gene expression is regulated at different levels 1 - Transcription 2 Post-transcriptional modifications 3 RNA transport

More information

Comparative genomics: Overview & Tools + MUMmer algorithm

Comparative genomics: Overview & Tools + MUMmer algorithm Comparative genomics: Overview & Tools + MUMmer algorithm Urmila Kulkarni-Kale Bioinformatics Centre University of Pune, Pune 411 007. urmila@bioinfo.ernet.in Genome sequence: Fact file 1995: The first

More information

Sequence motif analysis

Sequence motif analysis Sequence motif analysis Alan Moses Associate Professor and Canada Research Chair in Computational Biology Departments of Cell & Systems Biology, Computer Science, and Ecology & Evolutionary Biology Director,

More information

Genome 541! Unit 4, lecture 3! Genomics assays

Genome 541! Unit 4, lecture 3! Genomics assays Genome 541! Unit 4, lecture 3! Genomics assays Much easier to follow with slides. Good pace.! Having the slides was really helpful clearer to read and easier to follow the trajectory of the lecture.!!

More information

Genome 541! Unit 4, lecture 2! Transcription factor binding using functional genomics

Genome 541! Unit 4, lecture 2! Transcription factor binding using functional genomics Genome 541 Unit 4, lecture 2 Transcription factor binding using functional genomics Slides vs chalk talk: I m not sure why you chose a chalk talk over ppt. I prefer the latter no issues with readability

More information

Grundlagen der Bioinformatik Summer semester Lecturer: Prof. Daniel Huson

Grundlagen der Bioinformatik Summer semester Lecturer: Prof. Daniel Huson Grundlagen der Bioinformatik, SS 10, D. Huson, April 12, 2010 1 1 Introduction Grundlagen der Bioinformatik Summer semester 2010 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a)

More information

Different gene regulation strategies revealed by analysis of binding motifs

Different gene regulation strategies revealed by analysis of binding motifs Different gene regulation strategies revealed by analysis of binding motifs The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation

More information

Peter Pristas. Gene regulation in eukaryotes

Peter Pristas. Gene regulation in eukaryotes Peter Pristas BNK1 Gene regulation in eukaryotes Gene Expression in Eukaryotes Only about 3-5% of all the genes in a human cell are expressed at any given time. The genes expressed can be specific for

More information

USING BLAST TO IDENTIFY PROTEINS THAT ARE EVOLUTIONARILY RELATED ACROSS SPECIES

USING BLAST TO IDENTIFY PROTEINS THAT ARE EVOLUTIONARILY RELATED ACROSS SPECIES USING BLAST TO IDENTIFY PROTEINS THAT ARE EVOLUTIONARILY RELATED ACROSS SPECIES HOW CAN BIOINFORMATICS BE USED AS A TOOL TO DETERMINE EVOLUTIONARY RELATIONSHPS AND TO BETTER UNDERSTAND PROTEIN HERITAGE?

More information

CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools. Giri Narasimhan

CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools. Giri Narasimhan CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools Giri Narasimhan ECS 254; Phone: x3748 giri@cis.fiu.edu www.cis.fiu.edu/~giri/teach/bioinfs15.html Describing & Modeling Patterns

More information