The paper describing phyml is here, a brief interview with the authors is here. Maximum likelihood ratio test

Size: px
Start display at page:

Download "The paper describing phyml is here, a brief interview with the authors is here. Maximum likelihood ratio test"

Transcription

1 equence alignment: CLUTALW MUCLE Removing ambiguous T-COFFEE FORBACK positions: Generation of pseudosamples: EQBOOT PROTDIT TREE-PUZZLE Calculating and PROTPAR PHYML evaluating phylogenies: NEIGHBOR FITCH H-TET in Comparing phylogenies: CONENE TREE-PUZZLE Comparing models: Maximum Likelihood Ratio Test Visualizing trees: ATV, njplot, treeview phyml PHYML - A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood An online interface is here ; there is a command line version that is described here (not as straight forward as in clustalw); a phylip like interface is automatically invoked, if you type phyml the manual is here. The paper describing phyml is here, a brief interview with the authors is here TreePuzzle ne PUZZLE TREE-PUZZLE is a very versatile maximum likelihood program that is particularly useful to analyze protein sequences. The program was developed by Korbian trimmer and Arnd von Haseler (then at the Univ. of Munich) and is maintained by von Haseler, Heiko A. chmidt, and Martin Vingron (contacts see ome possible pathways from sequence to tree, model and support values. TREE-PUZZLE allows fast and accurate estimation of ARV (through estimating the shape parameter alpha) for both nucleotide and amino acid sequences (see here for figures). It has a fast algorithm to calculate trees through quartet puzzling (calculating ml trees for quartets of species and building the multispecies tree from the quartets). The program provides confidence numbers (puzzle support values), which tend to be smaller than bootstrap values (i.e. provide a more conservative estimate), the program calculates branch lengths and likelihood for user defined trees, which is great if you want to compare different tree topologies, or different models using the maximum likelihood ratio test. Branches which are not significantly supported are collapsed. TREE-PUZZLE runs on "all" platforms TREE-PUZZLE reads PHYLIP format, and communicates with the user in a way similar to the PHYLIP programs. Maximum likelihood ratio test If you want to compare two models of evolution (this includes the tree) given a data set, you can utilize the so-called maximum likelihood ratio test. If L and L 2 are the likelihoods of the two models, d =2(logL -logl 2 ) approximately follows a Chi square distribution with n degrees of freedom. Usually n is the difference in model parameters. I.e., how many parameters are used to describe the substitution process and the tree. In particular n can be the difference in branches between two trees (one tree is more resolved than the other). In principle, this test can only be applied if on model is a more refined version of the other. In the particular case, when you compare two trees, one calculated without assuming a clock, the other assuming a clock, the degrees of freedom are the number of OTUs 2 (as all sequences end up in the present at the same level, their branches cannot be freely chosen). To calculate the probability you can use the CHIQUARE calculator for windows available from Paul Lewis. TREE-PUZZLE allows (cont) TREEPUZZLE calculates distance matrices using the ml specified model. These can be used in FITCH or Neighbor. PUZZLEBOOT automates this approach to do bootstrap analyses WARNING: this is a distance matrix analyses! The official script for PUZZLEBOOT is here you need to create a command file (puzzle.cmds), and puzzle needs to be envocable through the command puzzle. Your input file needs to be the renamed outfile from seqboot A slightly modified working version of puzzleboot_mod.sh is here, and here is an example for puzzle.cmds. Read the instructions before you run this! Maximum likelihood mapping is an excellent way to assess the phylogenetic information contained in a dataset. ML mapping can be used to calculate the support around one Puzzle is cool, don't leave home without ml mapping ml mapping ml mapping can asses the topology surrounding an individual branch : E.g.: If we want to know if Giardia lamblia forms the deepest branch within the known eukaryotes, we can use ML mapping to address this problem. To apply ml mapping we choose the "higher" eukaryotes as cluster a, another deep branching eukaryote (the one that competes against Giardia) as cluster b, Giardia as cluster c, and the outgroup as cluster d. For an example output see this sample ml-map. From: Olga Zhaxybayeva and J Peter Gogarten BMC Genomics 2002, 3: Figure 5. Likelihood-mapping analysis for two biological data sets. (Upper) The distribution patterns. (Lower) The occupancies (in percent) for the seven areas of attraction. (A) Cytochrome-b data from ref.. (B) Ribosomal DNA of major arthropod groups (5). From: Korbinian trimmer and Arndt von Haeseler Proc. Natl. Acad. ci. UA Vol., pp , June 7 An analysis of the carbamoyl phosphate synthetase domains with respect to the root of the tree of life is here.

2 ml mapping can asses the not necessarily treelike histories of genome Application of ML mapping to comparative Genome analyses see here for a comparison of different probability measures. Fig. 3: outline of approach Fig. : Example and comparison of different measures see here for an approach that solves the problem of poor taxon sampling that is usually considered inherent with quartet analyses. Fig. 2: The principle of analyzing extended to obtain embedded quartets Example next slides: Cluster a: sequences outgroup (prokaryotes) Cluster b: 20 sequences other Eukaryotes Cluster c: sequences Plasmodium Cluster d: sequences Giardia (a,b)-(c,d) /\ / \ / 3 : 2 \ / : \ / \ (a,d)-(b,c) (a,c)-(b,d) Number of quartets in region : 68 (= 2.3%) Number of quartets in region 2: 2 (= 7.5%) Number of quartets in region 3: (= 68.2%) Occupancies of the seven areas, 2, 3,, 5, 6, 7: (a,b)-(c,d) /\ / \ / /\ \ / 6 \ / / 7 \ \ / \ / 3 : 5 : 2 \ / \ (a,d)-(b,c) (a,c)-(b,d) Number of quartets in region : 53 (= 8.%) Number of quartets in region 2: 5 (= 5.%) Number of quartets in region 3: 73 (= 6.8%) Number of quartets in region : 3 (=.%) Number of quartets in region 5: 0 (= 0.0%) Number of quartets in region 6: 26 (=.3%) Number of quartets in region 7: 0 (= 3.6%) TREE-PUZZLE PROBLEM/DRAWBACK The more species you add the lower the support for individual branches. While this is true for all algorithms, in TREE-PUZZLE this can lead to completely unresolved trees with only a few handful of sequences. Trees calculated via quartet puzzling are usually not completely resolved, and they do not correspond to the ML-tree: The determined multi-species tree is not the tree with the highest likelihood, rather it is the tree whose topology is supported through ml-quartets, and the lengths of the resolved branches is determined through maximum likelihood. puzzle example The best tree might not be the true tree. When can one conclude that a tree is a significantly worse explanation for the data compared to the best tree Estimate the probability that a dataset might have resulted from a given tree. Example: Kira s kangaroo data Usertrees - H test - go through outfile (PAR, PROTPAR and DNAPAR perform a similar test when confronted with multiple usertrees) Zhaxybayeva and Gogarten, BMC Genomics 2003 : 37 COMPARION OF DIFFERENT UPPORT MEAURE A: mapping of posterior probabilities according to trimmer and von Haeseler B: mapping of bootstrap support values C: mapping of bootstrap support values from extended ml-mapping versus More gene families group species according to environment than according to 6rRNA phylogeny In contrast, a themophilic archaeon has more genes grouping with the thermophilic bacteria bootstrap values from extended Reverend Thomas Bayes (702-76) Bayes Theorem Posterior Probability represents the degree to which we believe a given model accurately describes the situation given the available data and all of our prior information I Prior Probability describes the degree to which we believe the model accurately describes reality based on all of our prior information. Likelihood describes how well the model predicts the data P(data model, I) P(model data, I) = P(model, I) P(data,I) Normalizing constant Elliot ober s Gremlins Observation: Loud noise in the attic Hypothesis: gremlins in the attic playing bowling Likelihood = P(noise gremlins in the attic) P(gremlins in the attic noise) Alternative Approaches to Estimate Posterior Probabilities Bayesian Posterior Probability Mapping with MrBayes (Huelsenbeck and Ronquist, 200) Problem: trimmer s formula olution: Exploration of the tree space by sampling trees using a biased random walk (Implemented in MrBayes program) Trees with higher likelihoods will be sampled more often p i N i N total L i p i = L +L 2 +L 3 only considers 3 trees (those that maximize the likelihood for the three topologies),where N i - number of sampled trees of topology i, i=,2,3 N total total number of sampled trees (has to be large) 2

3 Illustration of a biased random walk Figure generated using MCRobot program (Paul Lewis, 200) Phylogenetic information present in pectral Decomposition of Phylogenetic Data Break information into small quanta of information (bipartitions or embedded quartets) Analyze spectra to detect transferred genes and plurality consensus. BIPARTITION OF A PHYLOGENETIC TREE Bipartition (or split) a division of a phylogenetic tree into two parts that are connected by a single branch. It divides a dataset into two groups, but it does not consider the relationships within each of the two groups. Yellow vs Rest * * *... * * 5 compatible to illustrated bipartition * * *..... Orange vs Rest.. *.... * incompatible to illustrated bipartition Lento -plot of 3 supported bipartitions (out of 082 possible) Consensus clusters of eight significantly supported bipartitions Phylogeny of putatively transferred gene (virulence factor homologs (mvin)) Lento -plot of supported bipartitions (out of 50 possible) 3 gammaproteobacterial (258 putative orthologs): E.coli Buchnera Haemophilus Pasteurella almonella Yersinia pestis (2 strains) Vibrio Xanthomonas (2 sp.) Pseudomonas Wigglesworthia 0 cyanobacteria: Anabaena Trichodesmium ynechocystis sp. Prochlorococcus marinus (3 strains) Marine ynechococcus Thermosynechococcus elongatus Gloeobacter Nostoc punctioforme Number of There are 3,7,30,575 possible unrooted tree topologies for 3 only 258 genes analyzed Based on 678 sets of orthologous genes Zhaxybayeva, Lapierre and Gogarten, Trends in Genetics, 200, 20(5): Consensus clusters corresponding to three significantly supported bipartitions Zhaxybayeva, Lapierre and Gogarten, Trends in Genetics, 200, 20(5): The phylogeny of ribulose bisphosphate carboxylase large subunit Example of bipartition analysis for five of photosynthetic bacteria (88 gene families) R Ct Ca Ct total 0 bipartitions R: Rhodobacter capsulatus, H: Heliobacillus mobilis, : ynechocystis sp., Ct: Chlorobium tepidum, Ca: Chloroflexus aurantiacus H R Ca H Plurality Chl. Biosynth. Bipartitions supported by genes from chlorophyll biosynthesis pathway Zhaxybayeva, Hamel, Raymond, and Gogarten, Genome Biology 200, 5: R20 Phylogenetic Analyses of Genes from chlorophyll biosynthesis pathway (extended ) Xiong et al. cience, :72-30 R: Rhodobacter capsulatus, H: Heliobacillus mobilis, : ynechocystis sp., Ct: Chlorobium tepidum, Ca: Chloroflexus aurantiacus Zhaxybayeva, Hamel, Raymond, and Gogarten, Genome Biology 200, 5: R20 3

4 PROBLEM WITH BIPARTITION No easy way to incorporate gene families that are not represented in all. The more sequences are added, the shorter the internal branches become, and the lower is the bootstrap support for the individual bipartitions. A single misplaced sequence can destroy all bipartitions. Bootstrap support values for embedded quartets Quartet spectral analyses of iterates over three loops: Repeat for all bootstrap samples. Repeat for all possible embedded quartets. Repeat for all gene families. + : tree calculated from one pseudosample generated by bootstraping from an alignment of one gene family present in : embedded quartet for,,, and 0. This bootstrap sample supports the topology ((,),,0) Zhaxybayeva et al. 2006, Genome Research, in press Iterating over Bootstrap amples This gene family for the quartet of species A, B, C, D upports the Topology ((A, D), B, C) with 70% bootstrap support Bootstrap support values for embedded quartets + : tree calculated from one pseudosample generated by bootstraping from an alignment of one gene family present in Illustration of one component of a quartet spectral analyses ummary of phylogenetic information for one genome quartet for all gene families Total number of gene families containing the species quartet Quartet pectrum of cyanobacterial 330 possible quartets Quartet spectral analyses of iterates over three loops: Repeat for all bootstrap samples. Repeat for all possible embedded quartets. Repeat for all gene families. : embedded quartet for,,, and 0. This bootstrap sample supports the topology ((,),,0) Number of gene families supporting the same topology as the plurality (colored according to bootstrap support level) Number of gene families supporting one of the two alternative quartet topologies 28 from relaxed core (core + with one or two taxa missing) 685 show conflicts with plurality Number of quartets PLURALITY IGNAL Gloeobacter marine ynechococcus 3Prochlorococcus N 2Prochlorococcus A Prochlorococcus Nostoc m 3P 2P P G Th Conflicts with plurality signal are observed in sets of orthologs across all functional categories, including genes involved in translation and transcription Genes with orthologs outside the cyanobacterial phylum: Distribution among Functional Categories (using COG db, release of March 2003) Anabaena Cyanobacteria do form a coherent group, but conflict with plurality (2) Cyanobacteria do not form a coherent group (60) 700 phylogenetically useful extended Trichodesmium Tr Crocosphaera C ynechocystis Thermosynechococcus 62/28 55%

5 Example of interphylum transfer: threonyl trna synthetase pecies evolution versus plurality consensus In case of the marine ynecchococcus and Prochlorococcus spp. the plurality consensus is unlikely to reflect organismal history. The Coral of Life (Darwin) This is probably due to frequent gene transfer mediated by phages e.g.: These conflicting observations are not limited to prokaryotes. In incipient species of Darwin s finches frequent introgression can make some individuals characterized by morphology and mating behavior as belonging to the same species genetically more similar to a sister species (Grant et al. 200 Convergent evolution of Darwin's finches caused by introgressive hybridization and selection Evolution Int J Org Evolution 58, 588-5). Coalescence the process of tracing lineages backwards in time to their common ancestors. Every two extant lineages coalesce to their most recent common ancestor. Eventually, all lineages coalesce to the cenancestor. t/2 (Kingman, 82) Illustration is from J. Felsenstein, Inferring Phylogenies, inauer, 2003 Coalescence of ORGANIMAL and MOLECULAR Lineages Time 20 lineages One extinction and one speciation event per generation REULT: One horizontal transfer event once in Most recent common ancestors are different for organismal and 5 generations (I.e., speciation events) molecular phylogenies RED: organismal lineages (no HGT) Different coalescence times BLUE: molecular lineages (with HGT) GRAY: extinct lineages Long coalescence time for the last two lineages Y chromosome Adam Lived approximately 50,000 years ago Thomson, R. et al. (2000) Proc Natl Acad ci U A 7, Underhill, P.A. et al. (2000) Nat Genet 26, Albrecht Dürer, The Fall of Man, 50 Adam and Eve never met Mitochondrial Eve Lived 66,000-2,000 years ago Cann, R.L. et al. (87) Nature 325, 3-6 Vigilant, L. et al. () cience 253, The same is true for ancestral rrnas, EF, ATPases! EXTANT LINEAGE FOR THE IMULATION OF 50 LINEAGE log (number of surviving lineages) Lineages Through Time Plot 0 simulations of organismal evolution assuming a constant number of species (200) throughout the simulation; speciation and extinction per time step. (green O) 25 gene histories simulated for each organismal history assuming HGT per 0 speciation events (red x) green: organismal lineages ; red: molecular lineages (with gene transfer) Bacterial 6rRNA based phylogeny (from P. D. chloss and J. Handelsman, Microbiology and Molecular Biology Reviews, December 200.) The deviation from the long branches at the base pattern could be due to under sampling an actual radiation due to an invention that was not transferred following a mass extinction 5

New Tools for Visualizing Genome Evolution

New Tools for Visualizing Genome Evolution New Tools for Visualizing Genome Evolution Lutz Hamel Dept. of Computer Science and Statistics University of Rhode Island J. Peter Gogarten Dept. of Molecular and Cell Biology University of Connecticut

More information

Unsupervised Learning in Spectral Genome Analysis

Unsupervised Learning in Spectral Genome Analysis Unsupervised Learning in Spectral Genome Analysis Lutz Hamel 1, Neha Nahar 1, Maria S. Poptsova 2, Olga Zhaxybayeva 3, J. Peter Gogarten 2 1 Department of Computer Sciences and Statistics, University of

More information

Phylogenetic Tree Reconstruction

Phylogenetic Tree Reconstruction I519 Introduction to Bioinformatics, 2011 Phylogenetic Tree Reconstruction Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Evolution theory Speciation Evolution of new organisms is driven

More information

Phylogenetic relationship among S. castellii, S. cerevisiae and C. glabrata.

Phylogenetic relationship among S. castellii, S. cerevisiae and C. glabrata. Supplementary Note S2 Phylogenetic relationship among S. castellii, S. cerevisiae and C. glabrata. Phylogenetic trees reconstructed by a variety of methods from either single-copy orthologous loci (Class

More information

Constructing Evolutionary/Phylogenetic Trees

Constructing Evolutionary/Phylogenetic Trees Constructing Evolutionary/Phylogenetic Trees 2 broad categories: istance-based methods Ultrametric Additive: UPGMA Transformed istance Neighbor-Joining Character-based Maximum Parsimony Maximum Likelihood

More information

C3020 Molecular Evolution. Exercises #3: Phylogenetics

C3020 Molecular Evolution. Exercises #3: Phylogenetics C3020 Molecular Evolution Exercises #3: Phylogenetics Consider the following sequences for five taxa 1-5 and the known outgroup O, which has the ancestral states (note that sequence 3 has changed from

More information

Elements of Bioinformatics 14F01 TP5 -Phylogenetic analysis

Elements of Bioinformatics 14F01 TP5 -Phylogenetic analysis Elements of Bioinformatics 14F01 TP5 -Phylogenetic analysis 10 December 2012 - Corrections - Exercise 1 Non-vertebrate chordates generally possess 2 homologs, vertebrates 3 or more gene copies; a Drosophila

More information

A Phylogenetic Network Construction due to Constrained Recombination

A Phylogenetic Network Construction due to Constrained Recombination A Phylogenetic Network Construction due to Constrained Recombination Mohd. Abdul Hai Zahid Research Scholar Research Supervisors: Dr. R.C. Joshi Dr. Ankush Mittal Department of Electronics and Computer

More information

POPULATION GENETICS Winter 2005 Lecture 17 Molecular phylogenetics

POPULATION GENETICS Winter 2005 Lecture 17 Molecular phylogenetics POPULATION GENETICS Winter 2005 Lecture 17 Molecular phylogenetics - in deriving a phylogeny our goal is simply to reconstruct the historical relationships between a group of taxa. - before we review the

More information

Constructing Evolutionary/Phylogenetic Trees

Constructing Evolutionary/Phylogenetic Trees Constructing Evolutionary/Phylogenetic Trees 2 broad categories: Distance-based methods Ultrametric Additive: UPGMA Transformed Distance Neighbor-Joining Character-based Maximum Parsimony Maximum Likelihood

More information

Phylogenetics: Building Phylogenetic Trees

Phylogenetics: Building Phylogenetic Trees 1 Phylogenetics: Building Phylogenetic Trees COMP 571 Luay Nakhleh, Rice University 2 Four Questions Need to be Answered What data should we use? Which method should we use? Which evolutionary model should

More information

A (short) introduction to phylogenetics

A (short) introduction to phylogenetics A (short) introduction to phylogenetics Thibaut Jombart, Marie-Pauline Beugin MRC Centre for Outbreak Analysis and Modelling Imperial College London Genetic data analysis with PR Statistics, Millport Field

More information

8/23/2014. Phylogeny and the Tree of Life

8/23/2014. Phylogeny and the Tree of Life Phylogeny and the Tree of Life Chapter 26 Objectives Explain the following characteristics of the Linnaean system of classification: a. binomial nomenclature b. hierarchical classification List the major

More information

Phylogenetics: Building Phylogenetic Trees. COMP Fall 2010 Luay Nakhleh, Rice University

Phylogenetics: Building Phylogenetic Trees. COMP Fall 2010 Luay Nakhleh, Rice University Phylogenetics: Building Phylogenetic Trees COMP 571 - Fall 2010 Luay Nakhleh, Rice University Four Questions Need to be Answered What data should we use? Which method should we use? Which evolutionary

More information

Microbial Taxonomy and the Evolution of Diversity

Microbial Taxonomy and the Evolution of Diversity 19 Microbial Taxonomy and the Evolution of Diversity Copyright McGraw-Hill Global Education Holdings, LLC. Permission required for reproduction or display. 1 Taxonomy Introduction to Microbial Taxonomy

More information

9/30/11. Evolution theory. Phylogenetic Tree Reconstruction. Phylogenetic trees (binary trees) Phylogeny (phylogenetic tree)

9/30/11. Evolution theory. Phylogenetic Tree Reconstruction. Phylogenetic trees (binary trees) Phylogeny (phylogenetic tree) I9 Introduction to Bioinformatics, 0 Phylogenetic ree Reconstruction Yuzhen Ye (yye@indiana.edu) School of Informatics & omputing, IUB Evolution theory Speciation Evolution of new organisms is driven by

More information

"Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky

Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky MOLECULAR PHYLOGENY "Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky EVOLUTION - theory that groups of organisms change over time so that descendeants differ structurally

More information

BINF6201/8201. Molecular phylogenetic methods

BINF6201/8201. Molecular phylogenetic methods BINF60/80 Molecular phylogenetic methods 0-7-06 Phylogenetics Ø According to the evolutionary theory, all life forms on this planet are related to one another by descent. Ø Traditionally, phylogenetics

More information

Molecular phylogeny How to infer phylogenetic trees using molecular sequences

Molecular phylogeny How to infer phylogenetic trees using molecular sequences Molecular phylogeny How to infer phylogenetic trees using molecular sequences ore Samuelsson Nov 2009 Applications of phylogenetic methods Reconstruction of evolutionary history / Resolving taxonomy issues

More information

Bioinformatics tools for phylogeny and visualization. Yanbin Yin

Bioinformatics tools for phylogeny and visualization. Yanbin Yin Bioinformatics tools for phylogeny and visualization Yanbin Yin 1 Homework assignment 5 1. Take the MAFFT alignment http://cys.bios.niu.edu/yyin/teach/pbb/purdue.cellwall.list.lignin.f a.aln as input and

More information

Bootstrapping and Tree reliability. Biol4230 Tues, March 13, 2018 Bill Pearson Pinn 6-057

Bootstrapping and Tree reliability. Biol4230 Tues, March 13, 2018 Bill Pearson Pinn 6-057 Bootstrapping and Tree reliability Biol4230 Tues, March 13, 2018 Bill Pearson wrp@virginia.edu 4-2818 Pinn 6-057 Rooting trees (outgroups) Bootstrapping given a set of sequences sample positions randomly,

More information

Chapter 26: Phylogeny and the Tree of Life Phylogenies Show Evolutionary Relationships

Chapter 26: Phylogeny and the Tree of Life Phylogenies Show Evolutionary Relationships Chapter 26: Phylogeny and the Tree of Life You Must Know The taxonomic categories and how they indicate relatedness. How systematics is used to develop phylogenetic trees. How to construct a phylogenetic

More information

Molecular phylogeny How to infer phylogenetic trees using molecular sequences

Molecular phylogeny How to infer phylogenetic trees using molecular sequences Molecular phylogeny How to infer phylogenetic trees using molecular sequences ore Samuelsson Nov 200 Applications of phylogenetic methods Reconstruction of evolutionary history / Resolving taxonomy issues

More information

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic analysis Phylogenetic Basics: Biological

More information

Phylogenetics. Applications of phylogenetics. Unrooted networks vs. rooted trees. Outline

Phylogenetics. Applications of phylogenetics. Unrooted networks vs. rooted trees. Outline Phylogenetics Todd Vision iology 522 March 26, 2007 pplications of phylogenetics Studying organismal or biogeographic history Systematics ating events in the fossil record onservation biology Studying

More information

What is Phylogenetics

What is Phylogenetics What is Phylogenetics Phylogenetics is the area of research concerned with finding the genetic connections and relationships between species. The basic idea is to compare specific characters (features)

More information

Phylogenetics - Orthology, phylogenetic experimental design and phylogeny reconstruction. Lesser Tenrec (Echinops telfairi)

Phylogenetics - Orthology, phylogenetic experimental design and phylogeny reconstruction. Lesser Tenrec (Echinops telfairi) Phylogenetics - Orthology, phylogenetic experimental design and phylogeny reconstruction Lesser Tenrec (Echinops telfairi) Goals: 1. Use phylogenetic experimental design theory to select optimal taxa to

More information

2 Genome evolution: gene fusion versus gene fission

2 Genome evolution: gene fusion versus gene fission 2 Genome evolution: gene fusion versus gene fission Berend Snel, Peer Bork and Martijn A. Huynen Trends in Genetics 16 (2000) 9-11 13 Chapter 2 Introduction With the advent of complete genome sequencing,

More information

ASTRAL: Fast coalescent-based computation of the species tree topology, branch lengths, and local branch support

ASTRAL: Fast coalescent-based computation of the species tree topology, branch lengths, and local branch support ASTRAL: Fast coalescent-based computation of the species tree topology, branch lengths, and local branch support Siavash Mirarab University of California, San Diego Joint work with Tandy Warnow Erfan Sayyari

More information

Computational methods for predicting protein-protein interactions

Computational methods for predicting protein-protein interactions Computational methods for predicting protein-protein interactions Tomi Peltola T-61.6070 Special course in bioinformatics I 3.4.2008 Outline Biological background Protein-protein interactions Computational

More information

Molecular phylogeny - Using molecular sequences to infer evolutionary relationships. Tore Samuelsson Feb 2016

Molecular phylogeny - Using molecular sequences to infer evolutionary relationships. Tore Samuelsson Feb 2016 Molecular phylogeny - Using molecular sequences to infer evolutionary relationships Tore Samuelsson Feb 2016 Molecular phylogeny is being used in the identification and characterization of new pathogens,

More information

Using phylogenetics to estimate species divergence times... Basics and basic issues for Bayesian inference of divergence times (plus some digression)

Using phylogenetics to estimate species divergence times... Basics and basic issues for Bayesian inference of divergence times (plus some digression) Using phylogenetics to estimate species divergence times... More accurately... Basics and basic issues for Bayesian inference of divergence times (plus some digression) "A comparison of the structures

More information

Phylogeny and systematics. Why are these disciplines important in evolutionary biology and how are they related to each other?

Phylogeny and systematics. Why are these disciplines important in evolutionary biology and how are they related to each other? Phylogeny and systematics Why are these disciplines important in evolutionary biology and how are they related to each other? Phylogeny and systematics Phylogeny: the evolutionary history of a species

More information

Integrative Biology 200 "PRINCIPLES OF PHYLOGENETICS" Spring 2018 University of California, Berkeley

Integrative Biology 200 PRINCIPLES OF PHYLOGENETICS Spring 2018 University of California, Berkeley Integrative Biology 200 "PRINCIPLES OF PHYLOGENETICS" Spring 2018 University of California, Berkeley B.D. Mishler Feb. 14, 2018. Phylogenetic trees VI: Dating in the 21st century: clocks, & calibrations;

More information

Algorithms in Bioinformatics

Algorithms in Bioinformatics Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri Distance Methods Character Methods

More information

Phylogenetic inference

Phylogenetic inference Phylogenetic inference Bas E. Dutilh Systems Biology: Bioinformatic Data Analysis Utrecht University, March 7 th 016 After this lecture, you can discuss (dis-) advantages of different information types

More information

Inferring phylogeny. Constructing phylogenetic trees. Tõnu Margus. Bioinformatics MTAT

Inferring phylogeny. Constructing phylogenetic trees. Tõnu Margus. Bioinformatics MTAT Inferring phylogeny Constructing phylogenetic trees Tõnu Margus Contents What is phylogeny? How/why it is possible to infer it? Representing evolutionary relationships on trees What type questions questions

More information

PGA: A Program for Genome Annotation by Comparative Analysis of. Maximum Likelihood Phylogenies of Genes and Species

PGA: A Program for Genome Annotation by Comparative Analysis of. Maximum Likelihood Phylogenies of Genes and Species PGA: A Program for Genome Annotation by Comparative Analysis of Maximum Likelihood Phylogenies of Genes and Species Paulo Bandiera-Paiva 1 and Marcelo R.S. Briones 2 1 Departmento de Informática em Saúde

More information

Phylogenetic Trees. Phylogenetic Trees Five. Phylogeny: Inference Tool. Phylogeny Terminology. Picture of Last Quagga. Importance of Phylogeny 5.

Phylogenetic Trees. Phylogenetic Trees Five. Phylogeny: Inference Tool. Phylogeny Terminology. Picture of Last Quagga. Importance of Phylogeny 5. Five Sami Khuri Department of Computer Science San José State University San José, California, USA sami.khuri@sjsu.edu v Distance Methods v Character Methods v Molecular Clock v UPGMA v Maximum Parsimony

More information

Algorithmic Methods Well-defined methodology Tree reconstruction those that are well-defined enough to be carried out by a computer. Felsenstein 2004,

Algorithmic Methods Well-defined methodology Tree reconstruction those that are well-defined enough to be carried out by a computer. Felsenstein 2004, Tracing the Evolution of Numerical Phylogenetics: History, Philosophy, and Significance Adam W. Ferguson Phylogenetic Systematics 26 January 2009 Inferring Phylogenies Historical endeavor Darwin- 1837

More information

STEM-hy: Species Tree Estimation using Maximum likelihood (with hybridization)

STEM-hy: Species Tree Estimation using Maximum likelihood (with hybridization) STEM-hy: Species Tree Estimation using Maximum likelihood (with hybridization) Laura Salter Kubatko Departments of Statistics and Evolution, Ecology, and Organismal Biology The Ohio State University kubatko.2@osu.edu

More information

Bioinformatics 1. Sepp Hochreiter. Biology, Sequences, Phylogenetics Part 4. Bioinformatics 1: Biology, Sequences, Phylogenetics

Bioinformatics 1. Sepp Hochreiter. Biology, Sequences, Phylogenetics Part 4. Bioinformatics 1: Biology, Sequences, Phylogenetics Bioinformatics 1 Biology, Sequences, Phylogenetics Part 4 Sepp Hochreiter Klausur Mo. 30.01.2011 Zeit: 15:30 17:00 Raum: HS14 Anmeldung Kusss Contents Methods and Bootstrapping of Maximum Methods Methods

More information

MCB 372 #13: Selection, Data Partitioning Gene Transfer

MCB 372 #13: Selection, Data Partitioning Gene Transfer MCB 372 #3: Selection, Data Partitioning Gene Transfer J. Peter Gogarten University of Connecticut Dept. of Molecular and Cell Biology Collaborators: Olga Zhaxybayeva (Dalhousie) Jinling Huang (ECU) Tim

More information

Michael Yaffe Lecture #5 (((A,B)C)D) Database Searching & Molecular Phylogenetics A B C D B C D

Michael Yaffe Lecture #5 (((A,B)C)D) Database Searching & Molecular Phylogenetics A B C D B C D 7.91 Lecture #5 Database Searching & Molecular Phylogenetics Michael Yaffe B C D B C D (((,B)C)D) Outline Distance Matrix Methods Neighbor-Joining Method and Related Neighbor Methods Maximum Likelihood

More information

Intraspecific gene genealogies: trees grafting into networks

Intraspecific gene genealogies: trees grafting into networks Intraspecific gene genealogies: trees grafting into networks by David Posada & Keith A. Crandall Kessy Abarenkov Tartu, 2004 Article describes: Population genetics principles Intraspecific genetic variation

More information

Phylogenetic analyses. Kirsi Kostamo

Phylogenetic analyses. Kirsi Kostamo Phylogenetic analyses Kirsi Kostamo The aim: To construct a visual representation (a tree) to describe the assumed evolution occurring between and among different groups (individuals, populations, species,

More information

The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome

The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome Dr. Dirk Gevers 1,2 1 Laboratorium voor Microbiologie 2 Bioinformatics & Evolutionary Genomics The bacterial species in the genomic era CTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAG GTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGG

More information

C.DARWIN ( )

C.DARWIN ( ) C.DARWIN (1809-1882) LAMARCK Each evolutionary lineage has evolved, transforming itself, from a ancestor appeared by spontaneous generation DARWIN All organisms are historically interconnected. Their relationships

More information

Taming the Beast Workshop

Taming the Beast Workshop Workshop and Chi Zhang June 28, 2016 1 / 19 Species tree Species tree the phylogeny representing the relationships among a group of species Figure adapted from [Rogers and Gibbs, 2014] Gene tree the phylogeny

More information

Many of the slides that I ll use have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks!

Many of the slides that I ll use have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks! Many of the slides that I ll use have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks! Paul has many great tools for teaching phylogenetics at his web site: http://hydrodictyon.eeb.uconn.edu/people/plewis

More information

Chapter 26 Phylogeny and the Tree of Life

Chapter 26 Phylogeny and the Tree of Life Chapter 26 Phylogeny and the Tree of Life Biologists estimate that there are about 5 to 100 million species of organisms living on Earth today. Evidence from morphological, biochemical, and gene sequence

More information

Biology 211 (2) Week 1 KEY!

Biology 211 (2) Week 1 KEY! Biology 211 (2) Week 1 KEY Chapter 1 KEY FIGURES: 1.2, 1.3, 1.4, 1.5, 1.6, 1.7 VOCABULARY: Adaptation: a trait that increases the fitness Cells: a developed, system bound with a thin outer layer made of

More information

The Phylogenetic Handbook

The Phylogenetic Handbook The Phylogenetic Handbook A Practical Approach to DNA and Protein Phylogeny Edited by Marco Salemi University of California, Irvine and Katholieke Universiteit Leuven, Belgium and Anne-Mieke Vandamme Rega

More information

Consensus Methods. * You are only responsible for the first two

Consensus Methods. * You are only responsible for the first two Consensus Trees * consensus trees reconcile clades from different trees * consensus is a conservative estimate of phylogeny that emphasizes points of agreement * philosophy: agreement among data sets is

More information

Classification and Phylogeny

Classification and Phylogeny Classification and Phylogeny The diversity of life is great. To communicate about it, there must be a scheme for organization. There are many species that would be difficult to organize without a scheme

More information

molecular evolution and phylogenetics

molecular evolution and phylogenetics molecular evolution and phylogenetics Charlotte Darby Computational Genomics: Applied Comparative Genomics 2.13.18 https://www.thinglink.com/scene/762084640000311296 Internal node Root TIME Branch Leaves

More information

"PRINCIPLES OF PHYLOGENETICS: ECOLOGY AND EVOLUTION" Integrative Biology 200B Spring 2009 University of California, Berkeley

PRINCIPLES OF PHYLOGENETICS: ECOLOGY AND EVOLUTION Integrative Biology 200B Spring 2009 University of California, Berkeley "PRINCIPLES OF PHYLOGENETICS: ECOLOGY AND EVOLUTION" Integrative Biology 200B Spring 2009 University of California, Berkeley B.D. Mishler Jan. 22, 2009. Trees I. Summary of previous lecture: Hennigian

More information

Phylogenetic analysis. Characters

Phylogenetic analysis. Characters Typical steps: Phylogenetic analysis Selection of taxa. Selection of characters. Construction of data matrix: character coding. Estimating the best-fitting tree (model) from the data matrix: phylogenetic

More information

Bio 1B Lecture Outline (please print and bring along) Fall, 2007

Bio 1B Lecture Outline (please print and bring along) Fall, 2007 Bio 1B Lecture Outline (please print and bring along) Fall, 2007 B.D. Mishler, Dept. of Integrative Biology 2-6810, bmishler@berkeley.edu Evolution lecture #5 -- Molecular genetics and molecular evolution

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. Schematic pipeline for single-cell genome assembly, cleaning and annotation. a. The assembly process was optimized to account for multiple cells putatively

More information

Session 5: Phylogenomics

Session 5: Phylogenomics Session 5: Phylogenomics B.- Phylogeny based orthology assignment REMINDER: Gene tree reconstruction is divided in three steps: homology search, multiple sequence alignment and model selection plus tree

More information

Macroevolution Part I: Phylogenies

Macroevolution Part I: Phylogenies Macroevolution Part I: Phylogenies Taxonomy Classification originated with Carolus Linnaeus in the 18 th century. Based on structural (outward and inward) similarities Hierarchal scheme, the largest most

More information

Classification and Phylogeny

Classification and Phylogeny Classification and Phylogeny The diversity it of life is great. To communicate about it, there must be a scheme for organization. There are many species that would be difficult to organize without a scheme

More information

Comparative Genomics II

Comparative Genomics II Comparative Genomics II Advances in Bioinformatics and Genomics GEN 240B Jason Stajich May 19 Comparative Genomics II Slide 1/31 Outline Introduction Gene Families Pairwise Methods Phylogenetic Methods

More information

Chapter 27: Evolutionary Genetics

Chapter 27: Evolutionary Genetics Chapter 27: Evolutionary Genetics Student Learning Objectives Upon completion of this chapter you should be able to: 1. Understand what the term species means to biology. 2. Recognize the various patterns

More information

Microbial Diversity and Assessment (II) Spring, 2007 Guangyi Wang, Ph.D. POST103B

Microbial Diversity and Assessment (II) Spring, 2007 Guangyi Wang, Ph.D. POST103B Microbial Diversity and Assessment (II) Spring, 007 Guangyi Wang, Ph.D. POST03B guangyi@hawaii.edu http://www.soest.hawaii.edu/marinefungi/ocn403webpage.htm General introduction and overview Taxonomy [Greek

More information

Concepts and Methods in Molecular Divergence Time Estimation

Concepts and Methods in Molecular Divergence Time Estimation Concepts and Methods in Molecular Divergence Time Estimation 26 November 2012 Prashant P. Sharma American Museum of Natural History Overview 1. Why do we date trees? 2. The molecular clock 3. Local clocks

More information

Mixture Models in Phylogenetic Inference. Mark Pagel and Andrew Meade Reading University.

Mixture Models in Phylogenetic Inference. Mark Pagel and Andrew Meade Reading University. Mixture Models in Phylogenetic Inference Mark Pagel and Andrew Meade Reading University m.pagel@rdg.ac.uk Mixture models in phylogenetic inference!some background statistics relevant to phylogenetic inference!mixture

More information

Today's project. Test input data Six alignments (from six independent markers) of Curcuma species

Today's project. Test input data Six alignments (from six independent markers) of Curcuma species DNA sequences II Analyses of multiple sequence data datasets, incongruence tests, gene trees vs. species tree reconstruction, networks, detection of hybrid species DNA sequences II Test of congruence of

More information

Anatomy of a species tree

Anatomy of a species tree Anatomy of a species tree T 1 Size of current and ancestral Populations (N) N Confidence in branches of species tree t/2n = 1 coalescent unit T 2 Branch lengths and divergence times of species & populations

More information

7. Tests for selection

7. Tests for selection Sequence analysis and genomics 7. Tests for selection Dr. Katja Nowick Group leader TFome and Transcriptome Evolution Bioinformatics group Paul-Flechsig-Institute for Brain Research www. nowicklab.info

More information

Taxonomy. Content. How to determine & classify a species. Phylogeny and evolution

Taxonomy. Content. How to determine & classify a species. Phylogeny and evolution Taxonomy Content Why Taxonomy? How to determine & classify a species Domains versus Kingdoms Phylogeny and evolution Why Taxonomy? Classification Arrangement in groups or taxa (taxon = group) Nomenclature

More information

Phylogeny 9/8/2014. Evolutionary Relationships. Data Supporting Phylogeny. Chapter 26

Phylogeny 9/8/2014. Evolutionary Relationships. Data Supporting Phylogeny. Chapter 26 Phylogeny Chapter 26 Taxonomy Taxonomy: ordered division of organisms into categories based on a set of characteristics used to assess similarities and differences Carolus Linnaeus developed binomial nomenclature,

More information

Tree of Life iological Sequence nalysis Chapter http://tolweb.org/tree/ Phylogenetic Prediction ll organisms on Earth have a common ancestor. ll species are related. The relationship is called a phylogeny

More information

Biology 559R: Introduction to Phylogenetic Comparative Methods Topics for this week (Jan 27 & 29):

Biology 559R: Introduction to Phylogenetic Comparative Methods Topics for this week (Jan 27 & 29): Biology 559R: Introduction to Phylogenetic Comparative Methods Topics for this week (Jan 27 & 29): Statistical estimation of models of sequence evolution Phylogenetic inference using maximum likelihood:

More information

UoN, CAS, DBSC BIOL102 lecture notes by: Dr. Mustafa A. Mansi. The Phylogenetic Systematics (Phylogeny and Systematics)

UoN, CAS, DBSC BIOL102 lecture notes by: Dr. Mustafa A. Mansi. The Phylogenetic Systematics (Phylogeny and Systematics) - Phylogeny? - Systematics? The Phylogenetic Systematics (Phylogeny and Systematics) - Phylogenetic systematics? Connection between phylogeny and classification. - Phylogenetic systematics informs the

More information

08/21/2017 BLAST. Multiple Sequence Alignments: Clustal Omega

08/21/2017 BLAST. Multiple Sequence Alignments: Clustal Omega BLAST Multiple Sequence Alignments: Clustal Omega What does basic BLAST do (e.g. what is input sequence and how does BLAST look for matches?) Susan Parrish McDaniel College Multiple Sequence Alignments

More information

Phylogeny: traditional and Bayesian approaches

Phylogeny: traditional and Bayesian approaches Phylogeny: traditional and Bayesian approaches 5-Feb-2014 DEKM book Notes from Dr. B. John Holder and Lewis, Nature Reviews Genetics 4, 275-284, 2003 1 Phylogeny A graph depicting the ancestor-descendent

More information

Chapter 19. Microbial Taxonomy

Chapter 19. Microbial Taxonomy Chapter 19 Microbial Taxonomy 12-17-2008 Taxonomy science of biological classification consists of three separate but interrelated parts classification arrangement of organisms into groups (taxa; s.,taxon)

More information

Microbial Taxonomy. Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.

Microbial Taxonomy. Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible. Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional

More information

Chapter 19: Taxonomy, Systematics, and Phylogeny

Chapter 19: Taxonomy, Systematics, and Phylogeny Chapter 19: Taxonomy, Systematics, and Phylogeny AP Curriculum Alignment Chapter 19 expands on the topics of phylogenies and cladograms, which are important to Big Idea 1. In order for students to understand

More information

X X (2) X Pr(X = x θ) (3)

X X (2) X Pr(X = x θ) (3) Notes for 848 lecture 6: A ML basis for compatibility and parsimony Notation θ Θ (1) Θ is the space of all possible trees (and model parameters) θ is a point in the parameter space = a particular tree

More information

PHYLOGENY AND SYSTEMATICS

PHYLOGENY AND SYSTEMATICS AP BIOLOGY EVOLUTION/HEREDITY UNIT Unit 1 Part 11 Chapter 26 Activity #15 NAME DATE PERIOD PHYLOGENY AND SYSTEMATICS PHYLOGENY Evolutionary history of species or group of related species SYSTEMATICS Study

More information

Dr. Amira A. AL-Hosary

Dr. Amira A. AL-Hosary Phylogenetic analysis Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic Basics: Biological

More information

Phylogenetic Networks, Trees, and Clusters

Phylogenetic Networks, Trees, and Clusters Phylogenetic Networks, Trees, and Clusters Luay Nakhleh 1 and Li-San Wang 2 1 Department of Computer Science Rice University Houston, TX 77005, USA nakhleh@cs.rice.edu 2 Department of Biology University

More information

CHAPTERS 24-25: Evidence for Evolution and Phylogeny

CHAPTERS 24-25: Evidence for Evolution and Phylogeny CHAPTERS 24-25: Evidence for Evolution and Phylogeny 1. For each of the following, indicate how it is used as evidence of evolution by natural selection or shown as an evolutionary trend: a. Paleontology

More information

How to read and make phylogenetic trees Zuzana Starostová

How to read and make phylogenetic trees Zuzana Starostová How to read and make phylogenetic trees Zuzana Starostová How to make phylogenetic trees? Workflow: obtain DNA sequence quality check sequence alignment calculating genetic distances phylogeny estimation

More information

Genome Annotation. Bioinformatics and Computational Biology. Genome sequencing Assembly. Gene prediction. Protein targeting.

Genome Annotation. Bioinformatics and Computational Biology. Genome sequencing Assembly. Gene prediction. Protein targeting. Genome Annotation Bioinformatics and Computational Biology Genome Annotation Frank Oliver Glöckner 1 Genome Analysis Roadmap Genome sequencing Assembly Gene prediction Protein targeting trna prediction

More information

Theory of Evolution Charles Darwin

Theory of Evolution Charles Darwin Theory of Evolution Charles arwin 858-59: Origin of Species 5 year voyage of H.M.S. eagle (83-36) Populations have variations. Natural Selection & Survival of the fittest: nature selects best adapted varieties

More information

Effects of Gap Open and Gap Extension Penalties

Effects of Gap Open and Gap Extension Penalties Brigham Young University BYU ScholarsArchive All Faculty Publications 200-10-01 Effects of Gap Open and Gap Extension Penalties Hyrum Carroll hyrumcarroll@gmail.com Mark J. Clement clement@cs.byu.edu See

More information

Evolution Problem Drill 09: The Tree of Life

Evolution Problem Drill 09: The Tree of Life Evolution Problem Drill 09: The Tree of Life Question No. 1 of 10 Question 1. The age of the Earth is estimated to be about 4.0 to 4.5 billion years old. All of the following methods may be used to estimate

More information

Lecture 27. Phylogeny methods, part 7 (Bootstraps, etc.) p.1/30

Lecture 27. Phylogeny methods, part 7 (Bootstraps, etc.) p.1/30 Lecture 27. Phylogeny methods, part 7 (Bootstraps, etc.) Joe Felsenstein Department of Genome Sciences and Department of Biology Lecture 27. Phylogeny methods, part 7 (Bootstraps, etc.) p.1/30 A non-phylogeny

More information

Phylogenetics: Bayesian Phylogenetic Analysis. COMP Spring 2015 Luay Nakhleh, Rice University

Phylogenetics: Bayesian Phylogenetic Analysis. COMP Spring 2015 Luay Nakhleh, Rice University Phylogenetics: Bayesian Phylogenetic Analysis COMP 571 - Spring 2015 Luay Nakhleh, Rice University Bayes Rule P(X = x Y = y) = P(X = x, Y = y) P(Y = y) = P(X = x)p(y = y X = x) P x P(X = x 0 )P(Y = y X

More information

CS5263 Bioinformatics. Guest Lecture Part II Phylogenetics

CS5263 Bioinformatics. Guest Lecture Part II Phylogenetics CS5263 Bioinformatics Guest Lecture Part II Phylogenetics Up to now we have focused on finding similarities, now we start focusing on differences (dissimilarities leading to distance measures). Identifying

More information

THEORY. Based on sequence Length According to the length of sequence being compared it is of following two types

THEORY. Based on sequence Length According to the length of sequence being compared it is of following two types Exp 11- THEORY Sequence Alignment is a process of aligning two sequences to achieve maximum levels of identity between them. This help to derive functional, structural and evolutionary relationships between

More information

Molecular Evolution & Phylogenetics

Molecular Evolution & Phylogenetics Molecular Evolution & Phylogenetics Heuristics based on tree alterations, maximum likelihood, Bayesian methods, statistical confidence measures Jean-Baka Domelevo Entfellner Learning Objectives know basic

More information

METHODS FOR DETERMINING PHYLOGENY. In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task.

METHODS FOR DETERMINING PHYLOGENY. In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task. Chapter 12 (Strikberger) Molecular Phylogenies and Evolution METHODS FOR DETERMINING PHYLOGENY In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task. Modern

More information

Unit 7: Evolution Guided Reading Questions (80 pts total)

Unit 7: Evolution Guided Reading Questions (80 pts total) AP Biology Biology, Campbell and Reece, 10th Edition Adapted from chapter reading guides originally created by Lynn Miriello Name: Unit 7: Evolution Guided Reading Questions (80 pts total) Chapter 22 Descent

More information

Maximum-Likelihood Analysis Using TREE-PUZZLE

Maximum-Likelihood Analysis Using TREE-PUZZLE Maximum-Likelihood Analysis Using TREE-PUZZLE UNIT 6.6 Maximum-likelihood (ML) analysis is a statistically well-founded and well-known method used in many scientific fields. Edwards and Cavalli-Sforza

More information

BIPARTITION VISUALIZATION USING SELF ORGANIZING MAPS NEHA NAHAR A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS OF MASTER OF SCIENCE

BIPARTITION VISUALIZATION USING SELF ORGANIZING MAPS NEHA NAHAR A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS OF MASTER OF SCIENCE BIPARTITION VISUALIZATION USING SELF ORGANIZING MAPS BY NEHA NAHAR A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS OF MASTER OF SCIENCE IN COMPUTER SCIENCE UNIVERSITY OF RHODE ISLAND 2007

More information