The paper describing phyml is here, a brief interview with the authors is here. Maximum likelihood ratio test
|
|
- Cynthia Beasley
- 6 years ago
- Views:
Transcription
1 equence alignment: CLUTALW MUCLE Removing ambiguous T-COFFEE FORBACK positions: Generation of pseudosamples: EQBOOT PROTDIT TREE-PUZZLE Calculating and PROTPAR PHYML evaluating phylogenies: NEIGHBOR FITCH H-TET in Comparing phylogenies: CONENE TREE-PUZZLE Comparing models: Maximum Likelihood Ratio Test Visualizing trees: ATV, njplot, treeview phyml PHYML - A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood An online interface is here ; there is a command line version that is described here (not as straight forward as in clustalw); a phylip like interface is automatically invoked, if you type phyml the manual is here. The paper describing phyml is here, a brief interview with the authors is here TreePuzzle ne PUZZLE TREE-PUZZLE is a very versatile maximum likelihood program that is particularly useful to analyze protein sequences. The program was developed by Korbian trimmer and Arnd von Haseler (then at the Univ. of Munich) and is maintained by von Haseler, Heiko A. chmidt, and Martin Vingron (contacts see ome possible pathways from sequence to tree, model and support values. TREE-PUZZLE allows fast and accurate estimation of ARV (through estimating the shape parameter alpha) for both nucleotide and amino acid sequences (see here for figures). It has a fast algorithm to calculate trees through quartet puzzling (calculating ml trees for quartets of species and building the multispecies tree from the quartets). The program provides confidence numbers (puzzle support values), which tend to be smaller than bootstrap values (i.e. provide a more conservative estimate), the program calculates branch lengths and likelihood for user defined trees, which is great if you want to compare different tree topologies, or different models using the maximum likelihood ratio test. Branches which are not significantly supported are collapsed. TREE-PUZZLE runs on "all" platforms TREE-PUZZLE reads PHYLIP format, and communicates with the user in a way similar to the PHYLIP programs. Maximum likelihood ratio test If you want to compare two models of evolution (this includes the tree) given a data set, you can utilize the so-called maximum likelihood ratio test. If L and L 2 are the likelihoods of the two models, d =2(logL -logl 2 ) approximately follows a Chi square distribution with n degrees of freedom. Usually n is the difference in model parameters. I.e., how many parameters are used to describe the substitution process and the tree. In particular n can be the difference in branches between two trees (one tree is more resolved than the other). In principle, this test can only be applied if on model is a more refined version of the other. In the particular case, when you compare two trees, one calculated without assuming a clock, the other assuming a clock, the degrees of freedom are the number of OTUs 2 (as all sequences end up in the present at the same level, their branches cannot be freely chosen). To calculate the probability you can use the CHIQUARE calculator for windows available from Paul Lewis. TREE-PUZZLE allows (cont) TREEPUZZLE calculates distance matrices using the ml specified model. These can be used in FITCH or Neighbor. PUZZLEBOOT automates this approach to do bootstrap analyses WARNING: this is a distance matrix analyses! The official script for PUZZLEBOOT is here you need to create a command file (puzzle.cmds), and puzzle needs to be envocable through the command puzzle. Your input file needs to be the renamed outfile from seqboot A slightly modified working version of puzzleboot_mod.sh is here, and here is an example for puzzle.cmds. Read the instructions before you run this! Maximum likelihood mapping is an excellent way to assess the phylogenetic information contained in a dataset. ML mapping can be used to calculate the support around one Puzzle is cool, don't leave home without ml mapping ml mapping ml mapping can asses the topology surrounding an individual branch : E.g.: If we want to know if Giardia lamblia forms the deepest branch within the known eukaryotes, we can use ML mapping to address this problem. To apply ml mapping we choose the "higher" eukaryotes as cluster a, another deep branching eukaryote (the one that competes against Giardia) as cluster b, Giardia as cluster c, and the outgroup as cluster d. For an example output see this sample ml-map. From: Olga Zhaxybayeva and J Peter Gogarten BMC Genomics 2002, 3: Figure 5. Likelihood-mapping analysis for two biological data sets. (Upper) The distribution patterns. (Lower) The occupancies (in percent) for the seven areas of attraction. (A) Cytochrome-b data from ref.. (B) Ribosomal DNA of major arthropod groups (5). From: Korbinian trimmer and Arndt von Haeseler Proc. Natl. Acad. ci. UA Vol., pp , June 7 An analysis of the carbamoyl phosphate synthetase domains with respect to the root of the tree of life is here.
2 ml mapping can asses the not necessarily treelike histories of genome Application of ML mapping to comparative Genome analyses see here for a comparison of different probability measures. Fig. 3: outline of approach Fig. : Example and comparison of different measures see here for an approach that solves the problem of poor taxon sampling that is usually considered inherent with quartet analyses. Fig. 2: The principle of analyzing extended to obtain embedded quartets Example next slides: Cluster a: sequences outgroup (prokaryotes) Cluster b: 20 sequences other Eukaryotes Cluster c: sequences Plasmodium Cluster d: sequences Giardia (a,b)-(c,d) /\ / \ / 3 : 2 \ / : \ / \ (a,d)-(b,c) (a,c)-(b,d) Number of quartets in region : 68 (= 2.3%) Number of quartets in region 2: 2 (= 7.5%) Number of quartets in region 3: (= 68.2%) Occupancies of the seven areas, 2, 3,, 5, 6, 7: (a,b)-(c,d) /\ / \ / /\ \ / 6 \ / / 7 \ \ / \ / 3 : 5 : 2 \ / \ (a,d)-(b,c) (a,c)-(b,d) Number of quartets in region : 53 (= 8.%) Number of quartets in region 2: 5 (= 5.%) Number of quartets in region 3: 73 (= 6.8%) Number of quartets in region : 3 (=.%) Number of quartets in region 5: 0 (= 0.0%) Number of quartets in region 6: 26 (=.3%) Number of quartets in region 7: 0 (= 3.6%) TREE-PUZZLE PROBLEM/DRAWBACK The more species you add the lower the support for individual branches. While this is true for all algorithms, in TREE-PUZZLE this can lead to completely unresolved trees with only a few handful of sequences. Trees calculated via quartet puzzling are usually not completely resolved, and they do not correspond to the ML-tree: The determined multi-species tree is not the tree with the highest likelihood, rather it is the tree whose topology is supported through ml-quartets, and the lengths of the resolved branches is determined through maximum likelihood. puzzle example The best tree might not be the true tree. When can one conclude that a tree is a significantly worse explanation for the data compared to the best tree Estimate the probability that a dataset might have resulted from a given tree. Example: Kira s kangaroo data Usertrees - H test - go through outfile (PAR, PROTPAR and DNAPAR perform a similar test when confronted with multiple usertrees) Zhaxybayeva and Gogarten, BMC Genomics 2003 : 37 COMPARION OF DIFFERENT UPPORT MEAURE A: mapping of posterior probabilities according to trimmer and von Haeseler B: mapping of bootstrap support values C: mapping of bootstrap support values from extended ml-mapping versus More gene families group species according to environment than according to 6rRNA phylogeny In contrast, a themophilic archaeon has more genes grouping with the thermophilic bacteria bootstrap values from extended Reverend Thomas Bayes (702-76) Bayes Theorem Posterior Probability represents the degree to which we believe a given model accurately describes the situation given the available data and all of our prior information I Prior Probability describes the degree to which we believe the model accurately describes reality based on all of our prior information. Likelihood describes how well the model predicts the data P(data model, I) P(model data, I) = P(model, I) P(data,I) Normalizing constant Elliot ober s Gremlins Observation: Loud noise in the attic Hypothesis: gremlins in the attic playing bowling Likelihood = P(noise gremlins in the attic) P(gremlins in the attic noise) Alternative Approaches to Estimate Posterior Probabilities Bayesian Posterior Probability Mapping with MrBayes (Huelsenbeck and Ronquist, 200) Problem: trimmer s formula olution: Exploration of the tree space by sampling trees using a biased random walk (Implemented in MrBayes program) Trees with higher likelihoods will be sampled more often p i N i N total L i p i = L +L 2 +L 3 only considers 3 trees (those that maximize the likelihood for the three topologies),where N i - number of sampled trees of topology i, i=,2,3 N total total number of sampled trees (has to be large) 2
3 Illustration of a biased random walk Figure generated using MCRobot program (Paul Lewis, 200) Phylogenetic information present in pectral Decomposition of Phylogenetic Data Break information into small quanta of information (bipartitions or embedded quartets) Analyze spectra to detect transferred genes and plurality consensus. BIPARTITION OF A PHYLOGENETIC TREE Bipartition (or split) a division of a phylogenetic tree into two parts that are connected by a single branch. It divides a dataset into two groups, but it does not consider the relationships within each of the two groups. Yellow vs Rest * * *... * * 5 compatible to illustrated bipartition * * *..... Orange vs Rest.. *.... * incompatible to illustrated bipartition Lento -plot of 3 supported bipartitions (out of 082 possible) Consensus clusters of eight significantly supported bipartitions Phylogeny of putatively transferred gene (virulence factor homologs (mvin)) Lento -plot of supported bipartitions (out of 50 possible) 3 gammaproteobacterial (258 putative orthologs): E.coli Buchnera Haemophilus Pasteurella almonella Yersinia pestis (2 strains) Vibrio Xanthomonas (2 sp.) Pseudomonas Wigglesworthia 0 cyanobacteria: Anabaena Trichodesmium ynechocystis sp. Prochlorococcus marinus (3 strains) Marine ynechococcus Thermosynechococcus elongatus Gloeobacter Nostoc punctioforme Number of There are 3,7,30,575 possible unrooted tree topologies for 3 only 258 genes analyzed Based on 678 sets of orthologous genes Zhaxybayeva, Lapierre and Gogarten, Trends in Genetics, 200, 20(5): Consensus clusters corresponding to three significantly supported bipartitions Zhaxybayeva, Lapierre and Gogarten, Trends in Genetics, 200, 20(5): The phylogeny of ribulose bisphosphate carboxylase large subunit Example of bipartition analysis for five of photosynthetic bacteria (88 gene families) R Ct Ca Ct total 0 bipartitions R: Rhodobacter capsulatus, H: Heliobacillus mobilis, : ynechocystis sp., Ct: Chlorobium tepidum, Ca: Chloroflexus aurantiacus H R Ca H Plurality Chl. Biosynth. Bipartitions supported by genes from chlorophyll biosynthesis pathway Zhaxybayeva, Hamel, Raymond, and Gogarten, Genome Biology 200, 5: R20 Phylogenetic Analyses of Genes from chlorophyll biosynthesis pathway (extended ) Xiong et al. cience, :72-30 R: Rhodobacter capsulatus, H: Heliobacillus mobilis, : ynechocystis sp., Ct: Chlorobium tepidum, Ca: Chloroflexus aurantiacus Zhaxybayeva, Hamel, Raymond, and Gogarten, Genome Biology 200, 5: R20 3
4 PROBLEM WITH BIPARTITION No easy way to incorporate gene families that are not represented in all. The more sequences are added, the shorter the internal branches become, and the lower is the bootstrap support for the individual bipartitions. A single misplaced sequence can destroy all bipartitions. Bootstrap support values for embedded quartets Quartet spectral analyses of iterates over three loops: Repeat for all bootstrap samples. Repeat for all possible embedded quartets. Repeat for all gene families. + : tree calculated from one pseudosample generated by bootstraping from an alignment of one gene family present in : embedded quartet for,,, and 0. This bootstrap sample supports the topology ((,),,0) Zhaxybayeva et al. 2006, Genome Research, in press Iterating over Bootstrap amples This gene family for the quartet of species A, B, C, D upports the Topology ((A, D), B, C) with 70% bootstrap support Bootstrap support values for embedded quartets + : tree calculated from one pseudosample generated by bootstraping from an alignment of one gene family present in Illustration of one component of a quartet spectral analyses ummary of phylogenetic information for one genome quartet for all gene families Total number of gene families containing the species quartet Quartet pectrum of cyanobacterial 330 possible quartets Quartet spectral analyses of iterates over three loops: Repeat for all bootstrap samples. Repeat for all possible embedded quartets. Repeat for all gene families. : embedded quartet for,,, and 0. This bootstrap sample supports the topology ((,),,0) Number of gene families supporting the same topology as the plurality (colored according to bootstrap support level) Number of gene families supporting one of the two alternative quartet topologies 28 from relaxed core (core + with one or two taxa missing) 685 show conflicts with plurality Number of quartets PLURALITY IGNAL Gloeobacter marine ynechococcus 3Prochlorococcus N 2Prochlorococcus A Prochlorococcus Nostoc m 3P 2P P G Th Conflicts with plurality signal are observed in sets of orthologs across all functional categories, including genes involved in translation and transcription Genes with orthologs outside the cyanobacterial phylum: Distribution among Functional Categories (using COG db, release of March 2003) Anabaena Cyanobacteria do form a coherent group, but conflict with plurality (2) Cyanobacteria do not form a coherent group (60) 700 phylogenetically useful extended Trichodesmium Tr Crocosphaera C ynechocystis Thermosynechococcus 62/28 55%
5 Example of interphylum transfer: threonyl trna synthetase pecies evolution versus plurality consensus In case of the marine ynecchococcus and Prochlorococcus spp. the plurality consensus is unlikely to reflect organismal history. The Coral of Life (Darwin) This is probably due to frequent gene transfer mediated by phages e.g.: These conflicting observations are not limited to prokaryotes. In incipient species of Darwin s finches frequent introgression can make some individuals characterized by morphology and mating behavior as belonging to the same species genetically more similar to a sister species (Grant et al. 200 Convergent evolution of Darwin's finches caused by introgressive hybridization and selection Evolution Int J Org Evolution 58, 588-5). Coalescence the process of tracing lineages backwards in time to their common ancestors. Every two extant lineages coalesce to their most recent common ancestor. Eventually, all lineages coalesce to the cenancestor. t/2 (Kingman, 82) Illustration is from J. Felsenstein, Inferring Phylogenies, inauer, 2003 Coalescence of ORGANIMAL and MOLECULAR Lineages Time 20 lineages One extinction and one speciation event per generation REULT: One horizontal transfer event once in Most recent common ancestors are different for organismal and 5 generations (I.e., speciation events) molecular phylogenies RED: organismal lineages (no HGT) Different coalescence times BLUE: molecular lineages (with HGT) GRAY: extinct lineages Long coalescence time for the last two lineages Y chromosome Adam Lived approximately 50,000 years ago Thomson, R. et al. (2000) Proc Natl Acad ci U A 7, Underhill, P.A. et al. (2000) Nat Genet 26, Albrecht Dürer, The Fall of Man, 50 Adam and Eve never met Mitochondrial Eve Lived 66,000-2,000 years ago Cann, R.L. et al. (87) Nature 325, 3-6 Vigilant, L. et al. () cience 253, The same is true for ancestral rrnas, EF, ATPases! EXTANT LINEAGE FOR THE IMULATION OF 50 LINEAGE log (number of surviving lineages) Lineages Through Time Plot 0 simulations of organismal evolution assuming a constant number of species (200) throughout the simulation; speciation and extinction per time step. (green O) 25 gene histories simulated for each organismal history assuming HGT per 0 speciation events (red x) green: organismal lineages ; red: molecular lineages (with gene transfer) Bacterial 6rRNA based phylogeny (from P. D. chloss and J. Handelsman, Microbiology and Molecular Biology Reviews, December 200.) The deviation from the long branches at the base pattern could be due to under sampling an actual radiation due to an invention that was not transferred following a mass extinction 5
New Tools for Visualizing Genome Evolution
New Tools for Visualizing Genome Evolution Lutz Hamel Dept. of Computer Science and Statistics University of Rhode Island J. Peter Gogarten Dept. of Molecular and Cell Biology University of Connecticut
More informationUnsupervised Learning in Spectral Genome Analysis
Unsupervised Learning in Spectral Genome Analysis Lutz Hamel 1, Neha Nahar 1, Maria S. Poptsova 2, Olga Zhaxybayeva 3, J. Peter Gogarten 2 1 Department of Computer Sciences and Statistics, University of
More informationPhylogenetic Tree Reconstruction
I519 Introduction to Bioinformatics, 2011 Phylogenetic Tree Reconstruction Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Evolution theory Speciation Evolution of new organisms is driven
More informationPhylogenetic relationship among S. castellii, S. cerevisiae and C. glabrata.
Supplementary Note S2 Phylogenetic relationship among S. castellii, S. cerevisiae and C. glabrata. Phylogenetic trees reconstructed by a variety of methods from either single-copy orthologous loci (Class
More informationConstructing Evolutionary/Phylogenetic Trees
Constructing Evolutionary/Phylogenetic Trees 2 broad categories: istance-based methods Ultrametric Additive: UPGMA Transformed istance Neighbor-Joining Character-based Maximum Parsimony Maximum Likelihood
More informationC3020 Molecular Evolution. Exercises #3: Phylogenetics
C3020 Molecular Evolution Exercises #3: Phylogenetics Consider the following sequences for five taxa 1-5 and the known outgroup O, which has the ancestral states (note that sequence 3 has changed from
More informationElements of Bioinformatics 14F01 TP5 -Phylogenetic analysis
Elements of Bioinformatics 14F01 TP5 -Phylogenetic analysis 10 December 2012 - Corrections - Exercise 1 Non-vertebrate chordates generally possess 2 homologs, vertebrates 3 or more gene copies; a Drosophila
More informationA Phylogenetic Network Construction due to Constrained Recombination
A Phylogenetic Network Construction due to Constrained Recombination Mohd. Abdul Hai Zahid Research Scholar Research Supervisors: Dr. R.C. Joshi Dr. Ankush Mittal Department of Electronics and Computer
More informationPOPULATION GENETICS Winter 2005 Lecture 17 Molecular phylogenetics
POPULATION GENETICS Winter 2005 Lecture 17 Molecular phylogenetics - in deriving a phylogeny our goal is simply to reconstruct the historical relationships between a group of taxa. - before we review the
More informationConstructing Evolutionary/Phylogenetic Trees
Constructing Evolutionary/Phylogenetic Trees 2 broad categories: Distance-based methods Ultrametric Additive: UPGMA Transformed Distance Neighbor-Joining Character-based Maximum Parsimony Maximum Likelihood
More informationPhylogenetics: Building Phylogenetic Trees
1 Phylogenetics: Building Phylogenetic Trees COMP 571 Luay Nakhleh, Rice University 2 Four Questions Need to be Answered What data should we use? Which method should we use? Which evolutionary model should
More informationA (short) introduction to phylogenetics
A (short) introduction to phylogenetics Thibaut Jombart, Marie-Pauline Beugin MRC Centre for Outbreak Analysis and Modelling Imperial College London Genetic data analysis with PR Statistics, Millport Field
More information8/23/2014. Phylogeny and the Tree of Life
Phylogeny and the Tree of Life Chapter 26 Objectives Explain the following characteristics of the Linnaean system of classification: a. binomial nomenclature b. hierarchical classification List the major
More informationPhylogenetics: Building Phylogenetic Trees. COMP Fall 2010 Luay Nakhleh, Rice University
Phylogenetics: Building Phylogenetic Trees COMP 571 - Fall 2010 Luay Nakhleh, Rice University Four Questions Need to be Answered What data should we use? Which method should we use? Which evolutionary
More informationMicrobial Taxonomy and the Evolution of Diversity
19 Microbial Taxonomy and the Evolution of Diversity Copyright McGraw-Hill Global Education Holdings, LLC. Permission required for reproduction or display. 1 Taxonomy Introduction to Microbial Taxonomy
More information9/30/11. Evolution theory. Phylogenetic Tree Reconstruction. Phylogenetic trees (binary trees) Phylogeny (phylogenetic tree)
I9 Introduction to Bioinformatics, 0 Phylogenetic ree Reconstruction Yuzhen Ye (yye@indiana.edu) School of Informatics & omputing, IUB Evolution theory Speciation Evolution of new organisms is driven by
More information"Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky
MOLECULAR PHYLOGENY "Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky EVOLUTION - theory that groups of organisms change over time so that descendeants differ structurally
More informationBINF6201/8201. Molecular phylogenetic methods
BINF60/80 Molecular phylogenetic methods 0-7-06 Phylogenetics Ø According to the evolutionary theory, all life forms on this planet are related to one another by descent. Ø Traditionally, phylogenetics
More informationMolecular phylogeny How to infer phylogenetic trees using molecular sequences
Molecular phylogeny How to infer phylogenetic trees using molecular sequences ore Samuelsson Nov 2009 Applications of phylogenetic methods Reconstruction of evolutionary history / Resolving taxonomy issues
More informationBioinformatics tools for phylogeny and visualization. Yanbin Yin
Bioinformatics tools for phylogeny and visualization Yanbin Yin 1 Homework assignment 5 1. Take the MAFFT alignment http://cys.bios.niu.edu/yyin/teach/pbb/purdue.cellwall.list.lignin.f a.aln as input and
More informationBootstrapping and Tree reliability. Biol4230 Tues, March 13, 2018 Bill Pearson Pinn 6-057
Bootstrapping and Tree reliability Biol4230 Tues, March 13, 2018 Bill Pearson wrp@virginia.edu 4-2818 Pinn 6-057 Rooting trees (outgroups) Bootstrapping given a set of sequences sample positions randomly,
More informationChapter 26: Phylogeny and the Tree of Life Phylogenies Show Evolutionary Relationships
Chapter 26: Phylogeny and the Tree of Life You Must Know The taxonomic categories and how they indicate relatedness. How systematics is used to develop phylogenetic trees. How to construct a phylogenetic
More informationMolecular phylogeny How to infer phylogenetic trees using molecular sequences
Molecular phylogeny How to infer phylogenetic trees using molecular sequences ore Samuelsson Nov 200 Applications of phylogenetic methods Reconstruction of evolutionary history / Resolving taxonomy issues
More informationAmira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut
Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic analysis Phylogenetic Basics: Biological
More informationPhylogenetics. Applications of phylogenetics. Unrooted networks vs. rooted trees. Outline
Phylogenetics Todd Vision iology 522 March 26, 2007 pplications of phylogenetics Studying organismal or biogeographic history Systematics ating events in the fossil record onservation biology Studying
More informationWhat is Phylogenetics
What is Phylogenetics Phylogenetics is the area of research concerned with finding the genetic connections and relationships between species. The basic idea is to compare specific characters (features)
More informationPhylogenetics - Orthology, phylogenetic experimental design and phylogeny reconstruction. Lesser Tenrec (Echinops telfairi)
Phylogenetics - Orthology, phylogenetic experimental design and phylogeny reconstruction Lesser Tenrec (Echinops telfairi) Goals: 1. Use phylogenetic experimental design theory to select optimal taxa to
More information2 Genome evolution: gene fusion versus gene fission
2 Genome evolution: gene fusion versus gene fission Berend Snel, Peer Bork and Martijn A. Huynen Trends in Genetics 16 (2000) 9-11 13 Chapter 2 Introduction With the advent of complete genome sequencing,
More informationASTRAL: Fast coalescent-based computation of the species tree topology, branch lengths, and local branch support
ASTRAL: Fast coalescent-based computation of the species tree topology, branch lengths, and local branch support Siavash Mirarab University of California, San Diego Joint work with Tandy Warnow Erfan Sayyari
More informationComputational methods for predicting protein-protein interactions
Computational methods for predicting protein-protein interactions Tomi Peltola T-61.6070 Special course in bioinformatics I 3.4.2008 Outline Biological background Protein-protein interactions Computational
More informationMolecular phylogeny - Using molecular sequences to infer evolutionary relationships. Tore Samuelsson Feb 2016
Molecular phylogeny - Using molecular sequences to infer evolutionary relationships Tore Samuelsson Feb 2016 Molecular phylogeny is being used in the identification and characterization of new pathogens,
More informationUsing phylogenetics to estimate species divergence times... Basics and basic issues for Bayesian inference of divergence times (plus some digression)
Using phylogenetics to estimate species divergence times... More accurately... Basics and basic issues for Bayesian inference of divergence times (plus some digression) "A comparison of the structures
More informationPhylogeny and systematics. Why are these disciplines important in evolutionary biology and how are they related to each other?
Phylogeny and systematics Why are these disciplines important in evolutionary biology and how are they related to each other? Phylogeny and systematics Phylogeny: the evolutionary history of a species
More informationIntegrative Biology 200 "PRINCIPLES OF PHYLOGENETICS" Spring 2018 University of California, Berkeley
Integrative Biology 200 "PRINCIPLES OF PHYLOGENETICS" Spring 2018 University of California, Berkeley B.D. Mishler Feb. 14, 2018. Phylogenetic trees VI: Dating in the 21st century: clocks, & calibrations;
More informationAlgorithms in Bioinformatics
Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri Distance Methods Character Methods
More informationPhylogenetic inference
Phylogenetic inference Bas E. Dutilh Systems Biology: Bioinformatic Data Analysis Utrecht University, March 7 th 016 After this lecture, you can discuss (dis-) advantages of different information types
More informationInferring phylogeny. Constructing phylogenetic trees. Tõnu Margus. Bioinformatics MTAT
Inferring phylogeny Constructing phylogenetic trees Tõnu Margus Contents What is phylogeny? How/why it is possible to infer it? Representing evolutionary relationships on trees What type questions questions
More informationPGA: A Program for Genome Annotation by Comparative Analysis of. Maximum Likelihood Phylogenies of Genes and Species
PGA: A Program for Genome Annotation by Comparative Analysis of Maximum Likelihood Phylogenies of Genes and Species Paulo Bandiera-Paiva 1 and Marcelo R.S. Briones 2 1 Departmento de Informática em Saúde
More informationPhylogenetic Trees. Phylogenetic Trees Five. Phylogeny: Inference Tool. Phylogeny Terminology. Picture of Last Quagga. Importance of Phylogeny 5.
Five Sami Khuri Department of Computer Science San José State University San José, California, USA sami.khuri@sjsu.edu v Distance Methods v Character Methods v Molecular Clock v UPGMA v Maximum Parsimony
More informationAlgorithmic Methods Well-defined methodology Tree reconstruction those that are well-defined enough to be carried out by a computer. Felsenstein 2004,
Tracing the Evolution of Numerical Phylogenetics: History, Philosophy, and Significance Adam W. Ferguson Phylogenetic Systematics 26 January 2009 Inferring Phylogenies Historical endeavor Darwin- 1837
More informationSTEM-hy: Species Tree Estimation using Maximum likelihood (with hybridization)
STEM-hy: Species Tree Estimation using Maximum likelihood (with hybridization) Laura Salter Kubatko Departments of Statistics and Evolution, Ecology, and Organismal Biology The Ohio State University kubatko.2@osu.edu
More informationBioinformatics 1. Sepp Hochreiter. Biology, Sequences, Phylogenetics Part 4. Bioinformatics 1: Biology, Sequences, Phylogenetics
Bioinformatics 1 Biology, Sequences, Phylogenetics Part 4 Sepp Hochreiter Klausur Mo. 30.01.2011 Zeit: 15:30 17:00 Raum: HS14 Anmeldung Kusss Contents Methods and Bootstrapping of Maximum Methods Methods
More informationMCB 372 #13: Selection, Data Partitioning Gene Transfer
MCB 372 #3: Selection, Data Partitioning Gene Transfer J. Peter Gogarten University of Connecticut Dept. of Molecular and Cell Biology Collaborators: Olga Zhaxybayeva (Dalhousie) Jinling Huang (ECU) Tim
More informationMichael Yaffe Lecture #5 (((A,B)C)D) Database Searching & Molecular Phylogenetics A B C D B C D
7.91 Lecture #5 Database Searching & Molecular Phylogenetics Michael Yaffe B C D B C D (((,B)C)D) Outline Distance Matrix Methods Neighbor-Joining Method and Related Neighbor Methods Maximum Likelihood
More informationIntraspecific gene genealogies: trees grafting into networks
Intraspecific gene genealogies: trees grafting into networks by David Posada & Keith A. Crandall Kessy Abarenkov Tartu, 2004 Article describes: Population genetics principles Intraspecific genetic variation
More informationPhylogenetic analyses. Kirsi Kostamo
Phylogenetic analyses Kirsi Kostamo The aim: To construct a visual representation (a tree) to describe the assumed evolution occurring between and among different groups (individuals, populations, species,
More informationThe minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome
Dr. Dirk Gevers 1,2 1 Laboratorium voor Microbiologie 2 Bioinformatics & Evolutionary Genomics The bacterial species in the genomic era CTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAG GTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGG
More informationC.DARWIN ( )
C.DARWIN (1809-1882) LAMARCK Each evolutionary lineage has evolved, transforming itself, from a ancestor appeared by spontaneous generation DARWIN All organisms are historically interconnected. Their relationships
More informationTaming the Beast Workshop
Workshop and Chi Zhang June 28, 2016 1 / 19 Species tree Species tree the phylogeny representing the relationships among a group of species Figure adapted from [Rogers and Gibbs, 2014] Gene tree the phylogeny
More informationMany of the slides that I ll use have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks!
Many of the slides that I ll use have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks! Paul has many great tools for teaching phylogenetics at his web site: http://hydrodictyon.eeb.uconn.edu/people/plewis
More informationChapter 26 Phylogeny and the Tree of Life
Chapter 26 Phylogeny and the Tree of Life Biologists estimate that there are about 5 to 100 million species of organisms living on Earth today. Evidence from morphological, biochemical, and gene sequence
More informationBiology 211 (2) Week 1 KEY!
Biology 211 (2) Week 1 KEY Chapter 1 KEY FIGURES: 1.2, 1.3, 1.4, 1.5, 1.6, 1.7 VOCABULARY: Adaptation: a trait that increases the fitness Cells: a developed, system bound with a thin outer layer made of
More informationThe Phylogenetic Handbook
The Phylogenetic Handbook A Practical Approach to DNA and Protein Phylogeny Edited by Marco Salemi University of California, Irvine and Katholieke Universiteit Leuven, Belgium and Anne-Mieke Vandamme Rega
More informationConsensus Methods. * You are only responsible for the first two
Consensus Trees * consensus trees reconcile clades from different trees * consensus is a conservative estimate of phylogeny that emphasizes points of agreement * philosophy: agreement among data sets is
More informationClassification and Phylogeny
Classification and Phylogeny The diversity of life is great. To communicate about it, there must be a scheme for organization. There are many species that would be difficult to organize without a scheme
More informationmolecular evolution and phylogenetics
molecular evolution and phylogenetics Charlotte Darby Computational Genomics: Applied Comparative Genomics 2.13.18 https://www.thinglink.com/scene/762084640000311296 Internal node Root TIME Branch Leaves
More information"PRINCIPLES OF PHYLOGENETICS: ECOLOGY AND EVOLUTION" Integrative Biology 200B Spring 2009 University of California, Berkeley
"PRINCIPLES OF PHYLOGENETICS: ECOLOGY AND EVOLUTION" Integrative Biology 200B Spring 2009 University of California, Berkeley B.D. Mishler Jan. 22, 2009. Trees I. Summary of previous lecture: Hennigian
More informationPhylogenetic analysis. Characters
Typical steps: Phylogenetic analysis Selection of taxa. Selection of characters. Construction of data matrix: character coding. Estimating the best-fitting tree (model) from the data matrix: phylogenetic
More informationBio 1B Lecture Outline (please print and bring along) Fall, 2007
Bio 1B Lecture Outline (please print and bring along) Fall, 2007 B.D. Mishler, Dept. of Integrative Biology 2-6810, bmishler@berkeley.edu Evolution lecture #5 -- Molecular genetics and molecular evolution
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. Schematic pipeline for single-cell genome assembly, cleaning and annotation. a. The assembly process was optimized to account for multiple cells putatively
More informationSession 5: Phylogenomics
Session 5: Phylogenomics B.- Phylogeny based orthology assignment REMINDER: Gene tree reconstruction is divided in three steps: homology search, multiple sequence alignment and model selection plus tree
More informationMacroevolution Part I: Phylogenies
Macroevolution Part I: Phylogenies Taxonomy Classification originated with Carolus Linnaeus in the 18 th century. Based on structural (outward and inward) similarities Hierarchal scheme, the largest most
More informationClassification and Phylogeny
Classification and Phylogeny The diversity it of life is great. To communicate about it, there must be a scheme for organization. There are many species that would be difficult to organize without a scheme
More informationComparative Genomics II
Comparative Genomics II Advances in Bioinformatics and Genomics GEN 240B Jason Stajich May 19 Comparative Genomics II Slide 1/31 Outline Introduction Gene Families Pairwise Methods Phylogenetic Methods
More informationChapter 27: Evolutionary Genetics
Chapter 27: Evolutionary Genetics Student Learning Objectives Upon completion of this chapter you should be able to: 1. Understand what the term species means to biology. 2. Recognize the various patterns
More informationMicrobial Diversity and Assessment (II) Spring, 2007 Guangyi Wang, Ph.D. POST103B
Microbial Diversity and Assessment (II) Spring, 007 Guangyi Wang, Ph.D. POST03B guangyi@hawaii.edu http://www.soest.hawaii.edu/marinefungi/ocn403webpage.htm General introduction and overview Taxonomy [Greek
More informationConcepts and Methods in Molecular Divergence Time Estimation
Concepts and Methods in Molecular Divergence Time Estimation 26 November 2012 Prashant P. Sharma American Museum of Natural History Overview 1. Why do we date trees? 2. The molecular clock 3. Local clocks
More informationMixture Models in Phylogenetic Inference. Mark Pagel and Andrew Meade Reading University.
Mixture Models in Phylogenetic Inference Mark Pagel and Andrew Meade Reading University m.pagel@rdg.ac.uk Mixture models in phylogenetic inference!some background statistics relevant to phylogenetic inference!mixture
More informationToday's project. Test input data Six alignments (from six independent markers) of Curcuma species
DNA sequences II Analyses of multiple sequence data datasets, incongruence tests, gene trees vs. species tree reconstruction, networks, detection of hybrid species DNA sequences II Test of congruence of
More informationAnatomy of a species tree
Anatomy of a species tree T 1 Size of current and ancestral Populations (N) N Confidence in branches of species tree t/2n = 1 coalescent unit T 2 Branch lengths and divergence times of species & populations
More information7. Tests for selection
Sequence analysis and genomics 7. Tests for selection Dr. Katja Nowick Group leader TFome and Transcriptome Evolution Bioinformatics group Paul-Flechsig-Institute for Brain Research www. nowicklab.info
More informationTaxonomy. Content. How to determine & classify a species. Phylogeny and evolution
Taxonomy Content Why Taxonomy? How to determine & classify a species Domains versus Kingdoms Phylogeny and evolution Why Taxonomy? Classification Arrangement in groups or taxa (taxon = group) Nomenclature
More informationPhylogeny 9/8/2014. Evolutionary Relationships. Data Supporting Phylogeny. Chapter 26
Phylogeny Chapter 26 Taxonomy Taxonomy: ordered division of organisms into categories based on a set of characteristics used to assess similarities and differences Carolus Linnaeus developed binomial nomenclature,
More informationTree of Life iological Sequence nalysis Chapter http://tolweb.org/tree/ Phylogenetic Prediction ll organisms on Earth have a common ancestor. ll species are related. The relationship is called a phylogeny
More informationBiology 559R: Introduction to Phylogenetic Comparative Methods Topics for this week (Jan 27 & 29):
Biology 559R: Introduction to Phylogenetic Comparative Methods Topics for this week (Jan 27 & 29): Statistical estimation of models of sequence evolution Phylogenetic inference using maximum likelihood:
More informationUoN, CAS, DBSC BIOL102 lecture notes by: Dr. Mustafa A. Mansi. The Phylogenetic Systematics (Phylogeny and Systematics)
- Phylogeny? - Systematics? The Phylogenetic Systematics (Phylogeny and Systematics) - Phylogenetic systematics? Connection between phylogeny and classification. - Phylogenetic systematics informs the
More information08/21/2017 BLAST. Multiple Sequence Alignments: Clustal Omega
BLAST Multiple Sequence Alignments: Clustal Omega What does basic BLAST do (e.g. what is input sequence and how does BLAST look for matches?) Susan Parrish McDaniel College Multiple Sequence Alignments
More informationPhylogeny: traditional and Bayesian approaches
Phylogeny: traditional and Bayesian approaches 5-Feb-2014 DEKM book Notes from Dr. B. John Holder and Lewis, Nature Reviews Genetics 4, 275-284, 2003 1 Phylogeny A graph depicting the ancestor-descendent
More informationChapter 19. Microbial Taxonomy
Chapter 19 Microbial Taxonomy 12-17-2008 Taxonomy science of biological classification consists of three separate but interrelated parts classification arrangement of organisms into groups (taxa; s.,taxon)
More informationMicrobial Taxonomy. Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationChapter 19: Taxonomy, Systematics, and Phylogeny
Chapter 19: Taxonomy, Systematics, and Phylogeny AP Curriculum Alignment Chapter 19 expands on the topics of phylogenies and cladograms, which are important to Big Idea 1. In order for students to understand
More informationX X (2) X Pr(X = x θ) (3)
Notes for 848 lecture 6: A ML basis for compatibility and parsimony Notation θ Θ (1) Θ is the space of all possible trees (and model parameters) θ is a point in the parameter space = a particular tree
More informationPHYLOGENY AND SYSTEMATICS
AP BIOLOGY EVOLUTION/HEREDITY UNIT Unit 1 Part 11 Chapter 26 Activity #15 NAME DATE PERIOD PHYLOGENY AND SYSTEMATICS PHYLOGENY Evolutionary history of species or group of related species SYSTEMATICS Study
More informationDr. Amira A. AL-Hosary
Phylogenetic analysis Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic Basics: Biological
More informationPhylogenetic Networks, Trees, and Clusters
Phylogenetic Networks, Trees, and Clusters Luay Nakhleh 1 and Li-San Wang 2 1 Department of Computer Science Rice University Houston, TX 77005, USA nakhleh@cs.rice.edu 2 Department of Biology University
More informationCHAPTERS 24-25: Evidence for Evolution and Phylogeny
CHAPTERS 24-25: Evidence for Evolution and Phylogeny 1. For each of the following, indicate how it is used as evidence of evolution by natural selection or shown as an evolutionary trend: a. Paleontology
More informationHow to read and make phylogenetic trees Zuzana Starostová
How to read and make phylogenetic trees Zuzana Starostová How to make phylogenetic trees? Workflow: obtain DNA sequence quality check sequence alignment calculating genetic distances phylogeny estimation
More informationGenome Annotation. Bioinformatics and Computational Biology. Genome sequencing Assembly. Gene prediction. Protein targeting.
Genome Annotation Bioinformatics and Computational Biology Genome Annotation Frank Oliver Glöckner 1 Genome Analysis Roadmap Genome sequencing Assembly Gene prediction Protein targeting trna prediction
More informationTheory of Evolution Charles Darwin
Theory of Evolution Charles arwin 858-59: Origin of Species 5 year voyage of H.M.S. eagle (83-36) Populations have variations. Natural Selection & Survival of the fittest: nature selects best adapted varieties
More informationEffects of Gap Open and Gap Extension Penalties
Brigham Young University BYU ScholarsArchive All Faculty Publications 200-10-01 Effects of Gap Open and Gap Extension Penalties Hyrum Carroll hyrumcarroll@gmail.com Mark J. Clement clement@cs.byu.edu See
More informationEvolution Problem Drill 09: The Tree of Life
Evolution Problem Drill 09: The Tree of Life Question No. 1 of 10 Question 1. The age of the Earth is estimated to be about 4.0 to 4.5 billion years old. All of the following methods may be used to estimate
More informationLecture 27. Phylogeny methods, part 7 (Bootstraps, etc.) p.1/30
Lecture 27. Phylogeny methods, part 7 (Bootstraps, etc.) Joe Felsenstein Department of Genome Sciences and Department of Biology Lecture 27. Phylogeny methods, part 7 (Bootstraps, etc.) p.1/30 A non-phylogeny
More informationPhylogenetics: Bayesian Phylogenetic Analysis. COMP Spring 2015 Luay Nakhleh, Rice University
Phylogenetics: Bayesian Phylogenetic Analysis COMP 571 - Spring 2015 Luay Nakhleh, Rice University Bayes Rule P(X = x Y = y) = P(X = x, Y = y) P(Y = y) = P(X = x)p(y = y X = x) P x P(X = x 0 )P(Y = y X
More informationCS5263 Bioinformatics. Guest Lecture Part II Phylogenetics
CS5263 Bioinformatics Guest Lecture Part II Phylogenetics Up to now we have focused on finding similarities, now we start focusing on differences (dissimilarities leading to distance measures). Identifying
More informationTHEORY. Based on sequence Length According to the length of sequence being compared it is of following two types
Exp 11- THEORY Sequence Alignment is a process of aligning two sequences to achieve maximum levels of identity between them. This help to derive functional, structural and evolutionary relationships between
More informationMolecular Evolution & Phylogenetics
Molecular Evolution & Phylogenetics Heuristics based on tree alterations, maximum likelihood, Bayesian methods, statistical confidence measures Jean-Baka Domelevo Entfellner Learning Objectives know basic
More informationMETHODS FOR DETERMINING PHYLOGENY. In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task.
Chapter 12 (Strikberger) Molecular Phylogenies and Evolution METHODS FOR DETERMINING PHYLOGENY In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task. Modern
More informationUnit 7: Evolution Guided Reading Questions (80 pts total)
AP Biology Biology, Campbell and Reece, 10th Edition Adapted from chapter reading guides originally created by Lynn Miriello Name: Unit 7: Evolution Guided Reading Questions (80 pts total) Chapter 22 Descent
More informationMaximum-Likelihood Analysis Using TREE-PUZZLE
Maximum-Likelihood Analysis Using TREE-PUZZLE UNIT 6.6 Maximum-likelihood (ML) analysis is a statistically well-founded and well-known method used in many scientific fields. Edwards and Cavalli-Sforza
More informationBIPARTITION VISUALIZATION USING SELF ORGANIZING MAPS NEHA NAHAR A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS OF MASTER OF SCIENCE
BIPARTITION VISUALIZATION USING SELF ORGANIZING MAPS BY NEHA NAHAR A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS OF MASTER OF SCIENCE IN COMPUTER SCIENCE UNIVERSITY OF RHODE ISLAND 2007
More information