Diversification of lindsaeoid ferns and phylogenetic uncertainty of early polypod relationships

Transcription

1 bs_bs_banner Botanical Journal of the Linnean Society, 202, 70, With 4 figures Diversification of lindsaeoid ferns and phylogenetic uncertainty of early polypod relationships SAMULI LEHTONEN *, NIKLAS WAHLBERG and MAARTEN J. M. CHRISTENHUSZ 2 FLS Department of Biology, University of Turku, FI-2004 Turku, Finland 2 Botany Unit, Finnish Museum of Natural History, University of Helsinki, P.O. Box 7, FI-0004 Helsinki, Finland Received 29 March 202; revised 27 August 202; accepted for publication September 202 We analysed one nuclear gene (8S) and seven plastid markers [five protein coding (atpa, atpb, rbcl, rpoc, rps4) and two non-coding (trnh-psba, trnl-trnf] for 3 members of Polypodiales and four outgroup taxa. We focused our sampling on the lindsaeoids and associated ferns in order to obtain a better understanding of the diversification of the early polypods. However, the exact phylogenetic position of Saccoloma and Cystodium remained uncertain. Based on relaxed molecular clock analyses, it appears that the crown group lindsaeoids diversified in the Caenozoic, more or less simultaneously with the main radiation of other Polypodiales, even though the original divergence between the lindsaeoid and non-lindsaeoid polypods occurred before the end of the Jurassic. The current pantropical distribution of lindsaeoids can be explained by either long-distance dispersal across the oceans or vicariance caused by the retreat of previously widely distributed tropical forests from higher to lower latitudes. 202 The Linnean Society of London, Botanical Journal of the Linnean Society, 202, 70, ADDITIONAL KEYWORDS: ancient rapid radiation direct optimization non-coding markers posterior probabilities relaxed molecular clock sensitivity analysis. INTRODUCTION The order Polypodiales (the polypods) includes 2 fern families and represents more than 80% of the extant fern species (Pryer et al., 2004; Christenhusz, Zhang & Schneider, 20). They form a well-supported clade in all recent phylogenetic analyses (Hasebe et al., 994, 995; Pryer, Smith & Skog, 995; Pryer et al., 2004; Schuettpelz, Korall & Pryer, 2006; Schneider, 2007; Schuettpelz & Pryer, 2007; Schneider, Smith & Pryer, 2009; Rai & Graham, 200; Lehtonen, 20a). Recent analyses support the view that Polypodiales are divided into two main clades, one containing the lindsaeoid ferns and a few associated genera, and the other, much larger, clade including the dennstaedtioid, pteridoid and eupolypod ferns (Schuettpelz & Pryer, 2007; Lehtonen, 20a). Palaeobotanical and molecular evidence suggests that the split of these two clades occurred in the late Jurassic, whereas the *Corresponding author. samile@utu.fi major diversification among the main polypod groups began during the Late Cretaceous (Pryer et al., 2004; Schneider et al., 2004; Schuettpelz & Pryer, 2009). Despite some focus on early leptosporangiate divergences (Pryer et al., 2004) and eupolypods (Schneider et al., 2004), the lindsaeoid clade has been sampled unsatisfactorily in most phylogenetic studies, and has remained sensitive to analytical choices in a taxonomically broadly sampled study (Lehtonen, 20a). It therefore remains unclear whether the lindsaeoids and associated genera really form a single clade, or whether they form a grade from which the pteridoid dennstaedtioid eupolypod lineage emerged. In addition, the age of the crown group lindsaeoids and the time of their further diversification have remained obscure (Pryer et al., 2004; Schneider et al., 2004; Schuettpelz & Pryer, 2009). According to our current understanding, the lindsaeoid ferns include seven genera: Lindsaea Dryand., Nesolindsaea Lehtonen & Christenh., Odontosoria Fée, Osmolindsaea (K.U.Kramer) Lehtonen & Christenh., Sphenomeris 202 The Linnean Society of London, Botanical Journal of the Linnean Society, 202, 70, Downloaded from on 25 December 207

2 490 S. LEHTONEN ET AL. Maxon, Tapeinidium (C.Presl) C.Chr. and Xyropteris K.U.Kramer (Lehtonen et al., 200; Christenhusz et al., 20), but three other genera have been associated with the lindsaeoids on the basis of molecular evidence (e.g. Smith et al., 2006), namely Cystodium J.Sm., Lonchitis L. and Saccoloma Kaulf. Cystodium is a monotypic genus historically considered to belong to Dicksoniaceae, a family of tree ferns (Kramer & Green, 990), until molecular evidence suggested otherwise (Korall et al., 2006), whereas Lonchitis with two species and Saccoloma with c. 2 species were placed in Dennstaedtiaceae in pre-molecular classifications (e.g. Kramer & Green, 990). Molecular systematic analyses have placed Saccoloma as the sister lineage to all other Polypodiales (Pryer et al., 2004; Korall et al., 2006; Schuettpelz & Pryer, 2006; Perrie & Brownsey, 2007; Rai & Graham, 200), as sister to the lindsaeoids (Schneider et al., 2004; Schuettpelz & Pryer, 2007; maximum likelihood analysis in Lehtonen, 20a) or as sister to nonlindsaeoid Polypodiales (parsimony analysis in Lehtonen, 20a). Lonchitis is usually resolved as part of the lindsaeoid clade (Wolf, Soltis & Soltis, 994; Wolf, 995, 997; Korall et al., 2006; Schuettpelz et al., 2006; Rai & Graham, 200; Lehtonen, 20a), but sometimes as sister to all non-lindsaeoid Polypodiales (Schneider et al., 2004). Saccoloma is now generally classified in its own family, Saccolomataceae, but Cystodium and Lonchitis are considered to be members of Lindsaeaceae in some of the recent classifications (Smith et al., 2006, 2008). However, based on considerable morphological differences, it has been suggested that Lonchitis and Cystodium are better placed in families of their own: Cystodiaceae (Korall et al., 2006) and Lonchitidaceae (Christenhusz, 2009; Christenhusz et al., 20). The instability of relationships among these groups in phylogenetic analyses is probably a consequence of a rapid radiation resulting from the combination of short internal and long external branches (see Ho & Jermin, 2004; Shavit et al., 2007). It has been commonly stated that slowly evolving conservative markers, such as protein-coding genes, are more appropriate at deep phylogenetic levels, because they are not as likely to be saturated by mutations and sequence alignment is less problematic (Graham & Olmstead, 2000; Wortley et al., 2005; Qiu et al., 2006; Jian et al., 2008). However, conservative genes may not have had time to accumulate sufficient phylogenetic information to solve short internal branches. Therefore, a contrasting opinion suggests that more rapidly evolving markers might be better suited to resolve short branches, even ancient ones (Hillis, 998; Asmussen & Chase, 200; Borsch et al., 2003; Hilu et al., 2004; Löhne & Borsch, 2005; Müller, Borsch & Hilu, 2006; Borsch & Quandt, 2009). Protein-coding genes are functionally constrained and the few variable sites may become saturated, whereas the non-coding sequences are generally considered to be less constrained and may be better suited for phylogenetic inference as their evolution follows a more stochastic pattern (Borsch et al., 2003; Müller et al., 2006). Furthermore, it has been shown that the combined analysis of quickly and slowly evolving sequences may provide complementary signals at various phylogenetic depths (Jian et al., 2008). Studies focused on rapid, ancient radiations have generally paid attention to attained resolution, support indices and congruence among datasets or between different methods (e.g. Qiu et al., 2006; Jian et al., 2008), but this may not always be sufficient, because high support values can be obtained even in the absence of a distinct phylogenetic signal (Wägele & Mayer, 2007) and congruence under certain analytical conditions may hide sensitivity to alternative analytical parameters (Giribet, DeSalle & Wheeler, 2002; Giribet, 2003). In this study, we aim to resolve the phylogenetic history and timing of the early polypod radiation by improving the sampling of lindsaeoid ferns and molecular characters utilizing coding and non-coding sequences. MATERIAL AND METHODS TAXON AND CHARACTER SAMPLING We sampled 35 taxa, including four tree ferns as outgroup taxa and representative members of most major polypod lineages, especially the early diverging ones. Our sampling covers all the genera placed or associated with Lindsaeaceae, except the monotypic genus Xyropteris, which is only known from a few historical herbarium specimens. Eight loci were sampled: the plastid genes atpa, atpb, rbcl, rpoc and rps4, the intergenic spacers trnh-psba and trnltrnf and the nuclear small-subunit ribosomal DNA gene 8S. The majority of sequences were obtained from GenBank, but we supplemented the available data with new extractions, amplifications and sequencing reactions (Table ). For these new extractions, plant material was dried on silica (Chase & Hills, 99) in nature from wild specimens, or material was taken from living plants in cultivation. In a few cases, when fresh material could not be obtained, DNA was extracted from leaf material from herbarium vouchers (Lehtonen & Christenhusz, 200). BLAST (blastn) searches (Altschul et al., 997) were conducted for all new sequences in order to evaluate possible contamination. Total genomic DNA was isolated with an E.Z.N.A. SP Plant DNA Kit (Omega Bio-tek, Doraville, GA, USA). The studied loci were amplified using PureTaq 202 The Linnean Society of London, Botanical Journal of the Linnean Society, 202, 70, Downloaded from on 25 December 207

3 DIVERSIFICATION OF EARLY POLYPOD LINEAGES 49 Table. Taxa analysed and GenBank accession numbers for sampled loci Taxa Family atpa atpb trnh-psba rbcl rpoc rps4 trnl-trnf 8S Adiantum raddianum C.Presl Pteridaceae DQ U93840 HQ57295 U05906 HQ5738 AY45954 HQ57339 U862 Asplenium nidus L. Aspleniaceae EF AY62688 HQ57294 U05907 HQ57308 AY AF4258 HQ57257 Athyrium filix-femina (L.) Roth Athyriaceae EF EF46356 HQ57287 U05908 HQ573 HQ57326 AY HQ57254 Blechnum brasiliense Desv. Blechnaceae HQ5726 HQ57282 HQ57286 AB HQ57324 DQ AF33570 Cheilanthes tomentosa Link Pteridaceae HQ57270 HQ57274 HQ57296 HQ57306 HQ57322 DQ9460 DQ94232 HQ57252 Cyathea poeppigii (Hook.) Domin Cyatheaceae DQ AF33553 AF33585 AF3360 DQ Cystodium sorbifolium (Sm.) J.Sm. Cystodiaceae EF AM842 HQ57299 AM84 GU Cystopteris fragilis (L.) Bernh. Cystopteridaceae HQ57269 HQ57273 HQ57289 U0596 HQ5732 AF42548 AF42520 HQ57250 Davallia solida (G.Forst.) Sw. var. fejeensis (Hook.) Noot. Davalliaceae HQ57263 DQ64607 HQ57290 DQ HQ57309 AY09620 HQ57335 DQ Dicksonia antarctica Labill. Dicksoniaceae EF U93829 HQ57297 U0568 HQ5730 AF33596 HQ57336 U8624 Didymochlaena truncatula (Sw.) J.Sm. Hypodematiaceae EF45209 EF HQ57285 DQ HQ5732 AF4256 DQ5449 HQ57248 Dryopteris filix-mas (L.) Schott Dryopteridaceae EF EU GQ EF46380 HQ HQ AY HQ Lindsaea blotiana K.U.Kramer Lindsaeaceae EF EF GU47850 EF GU GU GU47883 HQ57260 Lindsaea multisora Alderw. Lindsaeaceae HQ57262 HQ57278 GU HQ57303 GU47863 GU GU HQ57242 Lindsaea parasitica (Roxb.) Hieron. Lindsaeaceae HQ57277 FJ U8640 FJ36097 GU FJ3606 HQ5724 Lindsaea plicata Baker Lindsaeaceae HQ5727 HQ57276 GU47847 HQ57304 GU GU47866 GU HQ5725 Lindsaea quadrangularis Raddi Lindsaeaceae EF46377 EF FJ EF FJ GU FJ36020 HQ57256 Lonchitis hirsuta L. Lonchitidaceae EF AY62700 GU EU GU AY45962 GU AY62728 Loxsoma cunninghamii R.Br. Loxsomataceae EF AY62702 AY62679 AY62664 AY62730 Metaxya rostrata (Kunth) C.Presl Metaxyaceae EF46379 AM7660 HQ57298 AM77346 HQ5736 AY62667 HQ57338 AY62733 Microlepia speluncae (L.) T.Moore Dennstaedtiaceae EF EF HQ57283 EF46369 HQ57334 HQ5734 Nephrolepis biserrata (Sw.) Schott Nephrolepidaceae HQ57268 DQ64605 HQ57293 HQ57305 HQ5735 HQ57329 HQ57337 DQ Nesolindsaea kirkii (Hook.) Lindsaeaceae HQ57265 HQ57275 GU HQ57307 HQ57323 HQ57327 GU HQ57240 Lehtonen & Christenh. Odontosoria aculeata (L.) J.Sm. Lindsaeaceae EF EF GU EF GU HQ57333 GU HQ57258 Odontosoria chinensis (L.) J.Sm. Lindsaeaceae EF AY6270 GU U0565 HQ5733 HQ57328 GU47873 U8627 Osmolindsaea odorata (Roxb.) Lindsaeaceae HQ57264 HQ5728 GU47843 U05630 GU GU GU HQ57259 Lehtonen & Christenh. Polypodium vulgare L. Polypodiaceae EF46384 EF46350 HQ5729 EF55065 HQ5737 EF5508 AY65840 HQ57247 Pteridium aquilinum (L.) Kuhn Dennstaedtiaceae DQ U93835 GU U05646 GU DQ AY U8628 Rumohra adiantiformis (G.Forst.) Dryopteridaceae EF EF HQ57284 U05942 HQ57330 DQ54520 HQ57243 Ching Saccoloma elegans Kaulf. Saccolomataceae HQ57279 GU HQ57302 GU GU GU HQ57249 Saccoloma inaequale (Kunze) Mett. Saccolomataceae DQ EU GU EU35230 GU AY62672 GU AY62737 Sphenomeris clavata (L.) Maxon Lindsaeaceae HQ57267 HQ57272 GU HQ5730 GU HQ57332 GU HQ57255 Tapeinidium luzonicum (Hook.) Lindsaeaceae HQ57266 HQ57280 GU HQ57300 GU GU GU47875 HQ57246 K.U.Kramer Tectaria incisa Cav. Tectariaceae EF EF HQ57292 EF HQ5739 HQ57325 HQ57340 HQ57245 Thelypteris palustris (A.Gray) Schott Thelypteridaceae EF45227 AY6273 HQ57288 U05947 AY62675 AF42545 HQ57253, the sequence was not sampled. New sequences are marked in bold. 202 The Linnean Society of London, Botanical Journal of the Linnean Society, 202, 70, Downloaded from on 25 December 207

4 492 S. LEHTONEN ET AL. Table 2. Primers used in this study Locus 5 3 Reference trnl-trnf e* : GGTTCAAGTCCCTCTATCCC Taberlet et al., 99 f* : ATTTGAACTGGTGACACGAG Taberlet et al., 99 trnh-psba trnh* : CGCGCATGGTGGATTCACAATCC Tate & Simpson, 2003 psba3 f* : GTTATGCATGAACGTAATGCTC Sang, Crawford & Stuessy, 997 rpoc LP* : TATGAAACCAGAATGGATGG Chase et al., 2007 LP5* : CAAGAAGCATATCTTGASTYGG Chase et al., 2007 rps4 trns GGA * : TTACCGAGGGTTCGAATCCCTC Shaw et al., 2005 rps4.5 * : ATGTCSCGTTAYCGAGGACCT Small et al., 2005 rps4l-r* : TGSAATGGAATTCACRAACC This study 8S N26F* : TAAGCCATGCATGTGTAAGTATAAACTCTC Wolf, 995 C750R* : GAAACCTTGTTACGACTTCTCCTTCCTCTA Wolf, 995 NS357 : GGAGAGGGAGCCTGAGAA Wolf, 995 CS556 : CCTCCAATGGATCCTCGTTAA Wolf, 995 C922 : CCCCCAACTTTCGTTCTT Wolf, 995 rbcl af* : ATGTCACCACAAACAGAGACTAAAGC Hasebe et al., 994 F379R* : TCACAAGCAGCAGCTAGTTCAGGACTC Wolf et al., 999 Od90R : CGTGATTTCGTTGTCTATCGA Wolf et al., 994 F637MF : CTCTTTTTAAATCCSWGGCTGAA This study atpa ATPF42F*: GARCARGTTCGACAGCAAGT Schuettpelz et al., 2006 TRNR46F*: GTATAGGTTCRARTCCTATTGGACG Schuettpelz et al., 2006 ATPA535F : ACAGCAGTAGCTACAGATAC Schuettpelz et al., 2006 ATPA557R : ATTGTATCTGTAGCTACTGC Schuettpelz et al., 2006 ATPA856F : CGAGAAGCATATCCGGGAGATG Schuettpelz et al., 2006 ATPA877R : CATCTCCCGGATATGCTTCTCG Schuettpelz et al., 2006 atpb ATPB672F*: TTGATACGGGAGCYCCTCTWAGTGT Wolf, 997 ATPB63F : ATGGCAGAATRTTTCCGAGATRTYA Wolf, 997 ATPB49F : CRACATTTGCACATYTRGATGCTAC Wolf, 997 ATPB592R : TGTAACGYTGYAAAGTTTGCTTAA Wolf, 997 ATPB609R : TCRTTDCCTTCRCGTGTACGTTC Pryer et al., 2004 ATPE384R*: GAATTCCAAACTATTCGATTAGG Pryer et al., 2004 *PCR primer. Sequencing primer. RTG PCR beads (Amersham Biosciences, Piscataway, NJ, USA) following standard polymerase chain reaction (PCR) protocols. The primers used for amplification and sequencing are listed in Table 2. PCR products were purified and sequenced in both directions under BigDye terminator cycling conditions by Macrogen Inc., Seoul, South Korea ( macrogen.com). PARSIMONY ANALYSES Sequence alignment was straightforward for most of the protein-coding genes, as no length variation was observed. The exception was the rps4 gene, which was manually aligned based on the codon structure. For other markers, alignment was more difficult, and we performed direct optimization (DO) analyses (Wheeler, 996) using the software POY (Varón, Vinh & Wheeler, 200) and equal transformation costs. DO allows phylogenetic inference without a priori sequence alignment; instead, substitutions and indels are inferred as a part of the phylogenetic analysis (Wheeler, 996). Under this concept, the hypotheses of homology correspondences are the results of the phylogenetic analysis (Wheeler, 996). For this reason, the implied alignments produced by POY correspond to the secondary homologies of Pinna (99), in contrast with regular multiple sequence alignments that correspond to the untested primary homologies (Giribet, 2005). We performed parsimony analyses separately for each locus, and simultaneously for six-gene (atpa, atpb, rbcl, rpoc, rps4, 8S) and eight-locus datasets. Searches were performed by creating 250 random addition starting trees, which were swapped using subtree pruning and regrafting (SPR) and tree bisection and reconnection (TBR) branch swapping until shorter trees were no longer found. During the 202 The Linnean Society of London, Botanical Journal of the Linnean Society, 202, 70, Downloaded from on 25 December 207

5 DIVERSIFICATION OF EARLY POLYPOD LINEAGES 493 swapping, all the suboptimal trees found within 5% of the optimal trees were evaluated in addition to the optimal ones. Congruence between different loci was evaluated by calculating the number of SPR swaps required to convert one tree into another (SPR distance), as implemented in TNT (Goloboff, Farris & Nixon, 2008). We evaluated the support and robustness of our results by calculating jackknife support values (Farris et al., 996) and by performing a sensitivity analysis (Wheeler, 995; Giribet, 2003; Lehtonen, 20b). Jackknife support was calculated for coding genes and total evidence analysis by resampling entire loci instead of individual nucleotides and performing a DO analysis of the resampled data ( dynamic jackknifing ), as dynamic jackknifing is less prone to overestimate support (Simmons, Müller & Norton, 200). In the sensitivity analyses, we varied transversion/transition and indel/transversion ratios in four increments (0.5,, 2, 4). The parameter space was selected on the following basis: the lowest cost for indels should be at least one-half the lowest substitution cost (Wheeler, 995) and the highest cost should not exceed the highest substitution cost by more than about four times (Spagna & Álvarez- Padilla, 2008). Hence, in addition to our preferred equal-cost transformation regime, we analysed the data applying 5 other cost regimes. It should be noted that the coding genes were considered to be pre-aligned also during the sensitivity analyses. Hence, the homology statements were not changed in these markers, but varied transformation costs could support contrasting topologies. The results of the sensitivity analyses were visualized with the program Cladescan (Sanders, 200). For jackknife calculations, search strategies were similar to those for the total evidence analysis, except that only 00 starting trees were built. In the sensitivity analyses, only 0 starting trees were built, suboptimal trees were not evaluated during the swapping and a 900-s time constraint was applied for swapping. The POY analyses were performed in a GHz Quad- Core Intel Xeon Macintosh with 8 GB of RAM, using 6 virtual cores in parallel. BAYESIAN ANALYSES AND ESTIMATION OF THE DIVERGENCE TIMES The Bayesian analyses were based on the implied alignments produced by POY under equal transformation costs. The Bayesian analysis was performed with MrBayes 3. (Ronquist & Huelsenbeck, 2003) on three combined datasets: the coding regions and 8S gene (six-gene dataset); the coding regions and 8S plus trnh-psba (seven-locus dataset); and the full eight-locus dataset. Missing gene sequences were coded as?. Parameter values were estimated separately for each gene region under the GTR +Gmodel using the unlink command and the rate prior (ratepr) set to variable. The analysis was run twice simultaneously for each dataset for 0 million generations, with four chains (one cold and three heated) and every 000th generation sampled. The first 000 sampled generations were discarded as burn-in from both runs (based on a visual inspection of when the log likelihood values reached stationarity and the standard deviation of the split frequencies was below 0.0), leaving sampled generations for the estimation of posterior probabilities (PPs). The results of the two simultaneous runs were compared for convergence using Tracer v.4.6 (Rambaut & Drummond, 2007). Bayesian inference of phylogeny and the times of divergence were carried out using the software BEAST v.5.4 (Drummond & Rambaut, 2007). These analyses excluded the trnl-trnf data, as we did not want the severely difficult alignment to affect branch length estimates. The dataset was partitioned into seven gene regions and analysed simultaneously under the GTR +Gmodel for each partition separately and with a relaxed clock allowing branch lengths to vary according to an uncorrelated log-normal distribution (Drummond et al., 2006). The tree prior was set to the birth death process. Six nodes were used to calibrate the relaxed clock analyses. Calibration was based on fossils: a lindsaeoid fossil from 99 Mya (Schneider & Kenrick, 200) gives the minimum age of the Lindsaeaceae clade; the split between Lindsaea blotiana K.U.Kramer and L. quadrangularis Raddi was set to a minimum of 5 Mya based on the late Miocene fossil spores of L. trichomanoides Dryand. (Cieraad & Lee, 2006; L. trichomanoides is placed between L. blotiana and L. quadrangularis in the molecular phylogeny of Lehtonen et al., 200); the fossil Onoclea L. from the Palaeocene (Rothwell & Stockey, 99) gives a minimum age of 56 Myr to the divergence of Blechnaceae and Athyriaceae; the polypod clade is estimated to have a minimum age of 2 Myr (Pryer et al., 2004); the pteridoid eupolypod node was constrained to a minimum of 93.5 Mya (Schneider et al., 2004); and the divergence of the blechnoid thelypteridoid clade was limited to a minimum of 65 Mya (Pryer et al., 2004). We did not include fossil calibrations for the tree fern nodes, because their inclusion resulted in dramatic topological alterations in our preliminary test runs. This was probably caused by the greatly reduced rates of molecular evolution in the tree fern lineage (Korall, Schuettpelz & Pryer, 200). We also ran the analysis excluding the 5-Mya calibration for the split between L. blotiana and L. quadrangularis, but this had practically no effect on the dates obtained (not shown). The constraints were 202 The Linnean Society of London, Botanical Journal of the Linnean Society, 202, 70, Downloaded from on 25 December 207

6 494 S. LEHTONEN ET AL. modelled as an exponential prior with a mean of 0 and the minimum age as the offset. The calibrated clades had to be defined as monophyletic in order for the analysis to run successfully, but, as all other analyses recovered these clades as strongly supported, we felt that this was justified. All other priors were left to the defaults in BEAST. Parameters were estimated using three independent runs of 0 million generations each (with a pre-run burn-in of generations), with parameters sampled every 000 generations. Convergence was checked in the Tracer v.4.6 program and summary trees were generated using TreeAnnotator v.5.3, both part of the BEAST package. Age estimates are reported with their 95% highest posterior density (HPD). RESULTS PARSIMONY ANALYSES Basic information on the sequence data is provided in Table 3. The sequence length varied by < 2% in coding genes, but by 4 33% in the non-coding markers. The POY analysis of all the data (eight-locus dataset), using equal transformation costs and static alignments for the coding genes, resulted in a single mostparsimonious solution of 853 steps (Fig. ). The analysis of coding genes resulted in a single mostparsimonious tree of 7504 steps (Fig. 2), and the analysis of trnh-psba and trnl-trnf sequences yielded a single most-parsimonious solution of 3963 steps (Fig. 3). The results of the individual locus analyses are briefly referred to where necessary (trees are available as online Supporting Information Figs S S8 and alignments are deposited in TreeBASE; purl.org/phylo/treebase/phylows/study/tb2:s3345). The strict consensus resulting from the total evidence analysis is largely congruent with the current view on fern relationships. Cystodium, Lonchitis and lindsaeoid ferns form a clade, although the placements of Cystodium and Lonchitis are unstable and poorly supported. When separately analysed, only atpb and trnl-trnf supported the position of Cystodium as a member of the lindsaeoid clade. Saccoloma was resolved as the earliest diverging lineage of the non-lindsaeoid polypods in the analyses of coding genes and total evidence, although with poor jackknife support and high sensitivity to analytical parameters. In contrast, non-coding markers resolved Saccoloma as the earliest diverging lineage of the lindsaeoid clade. In the separate analyses, only atpb and trnl-trnf sequences supported the placement of Saccoloma in the lindsaeoid lineage, 8S resulted in a mostly unresolved tree and rbcl supported Saccoloma as the first diverging lineage in Polypodiales. All the remaining markers suggested a closer affinity with non-lindsaeoid polypods than with lindsaeoids. Different loci produced variably congruent results in separate analyses, with rpoc and trnh-psba trees being, on average, most congruent with the results from other loci (Table 3). In contrast, 8S and trnltrnf trees were much more distinct from the others, as measured by the SPR distance (Table 3). The relationships between pteridoids and dennstaedtioids remained poorly supported. In the total evidence and coding gene analyses, Pteridaceae and Dennstaedtiaceae form a clade, whereas non-coding markers resolved them as a highly unstable grade. The relationship between these two families has also been found to be ambiguous in other studies (e.g. Schuettpelz & Pryer, 2007). The eupolypod clade was stable and well supported, and, in the total evidence analysis, it was divided into two clades corresponding to the eupolypods I and eupolypods II of Schneider et al. (2004). Dynamic jackknifing was performed for the coding genes and total evidence, but not for the analysis of non-coding markers, because only two non-coding sequence fragments were used. However, the effect of the non-coding markers for the support values can be evaluated by comparing the support obtained Table 3. Sequence characteristics of DNA regions used in this study trnl-trnf trnh-psba rpoc rps4 8S rbcl atpa atpb Sequence length Aligned length No. variable sites No. PI characters No. MPT Length of MPT SPR distance* MPT, most-parsimonious tree; PI, parsimony informative; SPR, subtree pruning and regrafting. *SPR distance, average number of SPR swaps separating the strict parsimony consensus tree from consensus trees of other loci. 202 The Linnean Society of London, Botanical Journal of the Linnean Society, 202, 70, Downloaded from on 25 December 207

7 DIVERSIFICATION OF EARLY POLYPOD LINEAGES 495 Figure. The single most-parsimonious tree resulting from the analysis of all eight datasets. Numbers above the nodes are dynamic jackknife support values; the results of sensitivity analyses are shown in sensitivity plots (black squares refer to a cost regime under which the node is resolved as monophyletic; unresolved or unsupported relationships are indicated by white squares). 202 The Linnean Society of London, Botanical Journal of the Linnean Society, 202, 70, Downloaded from on 25 December 207

8 496 S. LEHTONEN ET AL. Figure 2. The single most-parsimonious tree resulting from the analysis of the six-gene dataset. For further explanations, see Figure. 202 The Linnean Society of London, Botanical Journal of the Linnean Society, 202, 70, Downloaded from on 25 December 207

9 DIVERSIFICATION OF EARLY POLYPOD LINEAGES 497 Figure 3. The single most-parsimonious tree obtained in the analysis of trnh-psba and trnl-trnf intergenic spacers. For further explanations, see Figure. Note that dynamic jackknife support was not calculated for this tree. 202 The Linnean Society of London, Botanical Journal of the Linnean Society, 202, 70, Downloaded from on 25 December 207

10 498 S. LEHTONEN ET AL. Jurassic Early Cretaceous Late Cretaceous 0.88 * * * 0.84 * * Palaeocene Eocene Oligocene Miocene * Loxsoma cunninghamii Dicksonia antarctica Cyathea poeppigii Metaxya rostrata Saccoloma inaequale Saccoloma elegans Cystodium sorbifolium Lonchitis hirsuta Sphenomeris clavata Osmolindsaea odorata Nesolindsaea kirkii Tapeinidium luzonicum Odontosoria chinensis Odontosoria aculeata Lindsaea plicata Lindsaea parasitica Lindsaea multisora Lindsaea blotiana Lindsaea quadrangularis Cheilanthes tomentosa Adiantum raddianum Microlepia speluncae Pteridium aquilinum Asplenium nidus Cystopteris fragilis Thelypteris palustris Athyrium filix femina Blechnum brasiliense Didymochlaena truncatula Dryopteris filix mas Rumohra adiantiformis Nephrolepis biserrata Tectaria incisa Polypodium vulgare Davallia solida ssp. fejeensis Millions of years Figure 4. Bayesian phylogeny based on BEAST analysis of the seven-locus dataset with divergence time estimates. Age estimates are given with 95% confidence intervals; numbers shown above the branches are posterior probabilities. Nodes for which fossil constraints were applied are indicated by asterisks. between six-gene and eight-locus datasets. Average jackknife support decreased from to by the addition of the two intergenic spacers. In a similar fashion, the average nodal stability decreased from 4.25 in the six-gene dataset to 0.47 in the eight-locus dataset. BAYESIAN ANALYSES AND DIVERGENCE TIME ESTIMATES The results of the Bayesian analyses are largely congruent with those of the parsimony analyses. Bayesian analysis of the different datasets resulted in otherwise similar topologies, but Saccoloma was resolved as either the first diverging member of the lindsaeoid (six-gene dataset, Fig. S9) or non-lindsaeoid (sevenand eight-locus datasets, Figs. S0, S) polypod clade. Cystodium and Lonchitis were resolved as members of the lindsaeoid clade (both with.0 PP) and dennstaedtioids and pteridoids formed a sister clade to eupolypods (.0 PP). Divergence time estimates were obtained using BEAST, but excluding the trnl-trnf intergenic spacer. The topology obtained (for the unconstrained parts) is relatively similar to the results of the sevenlocus MrBayes analysis, with the exception that Saccoloma is found to be sister to the lindsaeoid clade (Fig. 4). We estimate that polypod ferns originated in the late Jurassic (95% HPD, Mya; a constraint of 2 Myr minimum age was used for the node). The split between Lonchitis and lindsaeoids occurred in the Early Cretaceous (95% HPD, Mya; a fossil constraint of 99 Myr was used for the node). Based on our analysis, the diversification of the lindsaeoid crown group begins at the Palaeocene Eocene boundary (95% HPD, Mya) with Sphenomeris being the first lineage to branch off the lindsaeoids. The split between the eupolypods and the dennstaedtioid pteridoid clade occurred in the Early Cretaceous (95% HPD, Mya) and the separation between the eupolypods I and II in the Late Cretaceous (95% HPD, Mya). 202 The Linnean Society of London, Botanical Journal of the Linnean Society, 202, 70, Downloaded from on 25 December 207

11 DIVERSIFICATION OF EARLY POLYPOD LINEAGES 499 DISCUSSION Despite the analysis of ~8900 bp of sequence data, the early polypod radiations remain poorly supported and highly sensitive to analytical parameters. High sensitivity has been associated with problems related to long-branch attraction (Giribet, 2003; Lehtonen, 20b) and the present study may indeed be another example of this pattern, given the presence of short internal branches mixed with long terminal branches. Because of the incongruent gene trees and high sensitivity, Saccoloma and Cystodium could not be placed with certainty in either of the two main polypod clades and the first diverging lineage of Polypodiales remains uncertain. Christenhusz et al. (20) tentatively chose Lonchitidaceae as the first diverging lineage, followed by Saccolomataceae and Cystodiaceae, but this was merely a result of linearization where species-poor clades are artificially placed before species-rich ones. Coding genes resolved Lonchitis as part of the lindsaeoid radiation with high support and stability, but this position was contradicted by the non-coding markers, resulting in weak support and instability in the total evidence analysis. As a result of their distinct morphologies, unstable phylogenetic position and distance in molecular phylogenetic analyses, Cystodium, Lonchitis and Saccoloma are best maintained in their own families. It remains to be seen whether larger datasets can provide better support for these nodes in the future. We are looking forward to studies incorporating additional nuclear markers and mitochondrial DNA in order to resolve the early polypod radiation. In addition to increased character sampling, wider taxonomic sampling of both ingroup and outgroup taxa is crucial in resolving difficult phylogenetic problems (Soltis et al., 2004; Shavit et al., 2007). Ambiguity in non-coding sequence alignment is a well-recognized problem, possibly hindering the use of these markers for the resolution of deeper phylogenetic relationships. However, the impact of sequence alignment uncertainty is only rarely measured or reported in published phylogenetic analyses. The performance of non-coding markers has generally been determined by comparing resolution and support (Asmussen & Chase, 200; Hilu et al., 2004). Unfortunately, high support values as such do not guarantee that a difficult phylogenetic problem has been resolved, but may hide the phylogenetic uncertainty of underlying homology schemes (Giribet, 2003). Naturally, sequence alignment becomes more problematic with increasing sequence divergence. The effect of this can be observed in the topology of the two main polypod clades: there is much less incongruence between coding and noncoding topologies in better sampled lindsaeoids than in non-lindsaeoids. Despite the apparent better suitability of coding markers for the resolution of ancient phylogenetic patterns, they may not always provide a stable solution. Both Cystodium and Saccoloma were placed among non-lindsaeoids by the coding genes, but with low stability and support. In contrast, the noncoding markers placed them in the lindsaeoid clade. It should be noted that the poor performance of the non-coding markers in this study is mostly caused by the direct optimization of the trnl-trnf marker; trnhpsba behaved much better in having relatively little length variation and producing trees highly congruent with the other markers (Table 3). Other studies have obtained more promising results with trnl-trnf (Borsch et al., 2003; Müller et al., 2006; Borsch & Quandt, 2009), but, in these studies, alignments were guided by secondary structure, rapidly evolving hotspots were removed and alignment uncertainty was never explored. Our age estimation for the crown group polypod ferns (~5 Myr) is somewhat younger than the previous estimates, although our 95% HPDs do not exclude an estimate of ~60 Myr (Pryer et al., 2004), but are significantly younger than ~9 Myr (Schuettpelz & Pryer, 2009). In addition, our analyses prefer a younger age for the lindsaeoids (~2 Myr) than previously estimated (33 5 Myr; Pryer et al., 2004; Schuettpelz & Pryer, 2009). The younger age for the deeper nodes in our analysis may result from the exclusion of tree fern fossil constraints that were used in previous studies. This is manifested by far younger age estimates for tree fern lineages in our analysis compared with other studies (Pryer et al., 2004; Schneider et al., 2004; Schuettpelz & Pryer, 2009; Korall et al., 200). It has been shown that the molecular evolution among tree ferns is much slower than in non-arborescent ferns, probably because of differences in generation time (Korall et al., 200). Hence, it is possible that we have underestimated the minimum age of deeper diversifications, but the lower nodes should be less affected because more fossil calibration points are present towards the tip of the tree. Our age estimation for the eupolypod crown group (~8 Myr) falls between the previously presented estimates (~77 Myr, Pryer et al., 2004; ~05 Myr, Schneider et al., 2004), also suggesting this. Molecular age estimations are generally, including in this study, based on an inadequate fossil record that can only provide a few minimum age calibration points. Because the calibration points are absolute minimum ages for the clades, the molecular divergence date estimates should also be considered as minimum rather than actual age estimates (Heads, 20), although here we have used priors that allow older estimates based on the interaction between calibration points. In our study, we estimated minimum diversification times in the crown group lindsaeoids for the first time. Our molecular estimate for crown 202 The Linnean Society of London, Botanical Journal of the Linnean Society, 202, 70, Downloaded from on 25 December 207

12 500 S. LEHTONEN ET AL. group lindsaeoids was ~50 Myr and the majority of the basal divergences appear to have happened during the Eocene, with the genera Lindsaea and Odontosoria, comprising a majority of all lindsaeoid species, diverging before ~45 Mya from each other. The divergence between Neotropical L. quadrangularis and Madagascan L. blotiana was estimated to have occurred before ~0 Mya. These estimates, although considered as minimum ages, suggest that the current pantropical distribution of Lindsaea and Odontosoria at first seems to be better explained by dispersal than by Gondwanan origin and consequent vicariance. However, the model of oceanic longdistance dispersal should be carefully compared with palaeoclimatic models, especially with the Boreotropical hypothesis, which might provide an alternative explanation of mixed dispersal, extinction and vicariance events (Morley, 2000). The dates obtained for the divergence of some higher lindsaeoid taxa correspond with the cooling climate and withdrawal of Boreotropical rain forests (Morley, 2000), and vicariance remains a possible explanation for these phylogenetic patterns. The diversification of polypod ferns has been explained as an adaptive response to the rise of angiosperm-dominated communities in the late Mesozoic and early Caenozoic (Pryer et al., 2004; Schneider et al., 2004). Most of the lindsaeoids are restricted to wet tropical forests (Kramer, 97) that became widespread in the early Palaeocene, Mya (Morley, 2000). Therefore, it seems likely that lindsaeoid and non-lindsaeoid polypods responded independently to the same ecological shift by parallel diversification. More detailed analyses, including data from the palaeontological record, biogeographical history, ecological specialization and timing of divergences, are needed to better understand the evolutionary history of the lindsaeoids and of Polypodiales in general. ACKNOWLEDGEMENTS The Botanical Garden in Helsinki provided living material for DNA extraction. Voucher specimens are preserved at AAU, BM, GOET, H, P and TUR. We thank Professor Mark W. Chase (Royal Botanic Gardens, Kew) for constructive comments during the preparation of the manuscript. Funding for this research was provided by Kone Foundation, Societas pro Fauna et Flora Fennica and Academy of Finland grants to Samuli Lehtonen and Niklas Wahlberg. The Willi Hennig Society is acknowledged for making TNT freely available. REFERENCES Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ Gapped BLAST and PSI- BLAST: a new generation of protein database search programs. Nucleic Acids Research 25: Asmussen CB, Chase MW Coding and noncoding plastid DNA in palm systematics. American Journal of Botany 88: Borsch T, Hilu KW, Quandt D, Wilde V, Neinhuis C, Barthlott W Non-coding plastid trnt-trnf sequences reveal a well resolved phylogeny of basal angiosperms. Journal of Evolutionary Biology 6: Borsch T, Quandt D Mutational dynamics and phylogenetic utility of noncoding chloroplast DNA. Plant Systematics and Evolution 282: Chase MW, Cowan RS, Hollingsworth PM, van den Berg C, Madriñan S, Petersen G, Seberg O, Jørgensen T, Cameron KM, Carine M, Pedersen N, Hedderson TAJ, Conrad F, Salazar GA, Richardson JE, Hollingsworth ML, Barraclough TG, Kelly L, Wilkinson M A proposal for a standardised protocol to barcode all land plants. Taxon 56: Chase MW, Hills HG. 99. Silica gel: an ideal material for field preservation of leaf samples for DNA studies. Taxon 40: Christenhusz MJM Index Pteridophytorum Guadalupensium or a revised checklist to the ferns and club mosses of Guadeloupe (French West Indies). Botanical Journal of the Linnean Society 6: Christenhusz MJM, Zhang X, Schneider H. 20. A linear sequence of extant lycophytes and ferns. Phytotaxa 9: Cieraad E, Lee DE The New Zealand fossil record of ferns for the past 85 million years. New Zealand Journal of Botany 44: Drummond AJ, Ho SYW, Phillips MJ, Rambaut A Relaxed phylogenetics and dating with confidence. PLoS Biology 4: e88. Drummond AJ, Rambaut A BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evolutionary Biology 7: 24. Farris JS, Albert VA, Källersjö M, Lipscomb D, Kluge AG Parsimony jackknifing outperforms neighborjoining. Cladistics 2: Giribet G Stability in phylogenetic formulations and its relationship to nodal support. Systematic Biology 52: Giribet G Generating implied alignment under direct optimization using POY. Cladistics 2: Giribet G, DeSalle R, Wheeler WC Pluralism and the aims of phylogenetic research. In: DeSalle R, Giribet G, Wheeler W, eds. Molecular systematics and evolution: theory and practice. Basle: Birkhäuser Verlag, Goloboff PA, Farris JS, Nixon KC TNT, a free program for phylogenetic analysis. Cladistics 24: Graham SW, Olmstead RG Utility of 7 chloroplast genes for inferring the phylogeny of the basal angiosperms. American Journal of Botany 87: Hasebe M, Omori T, Nakazawa M, Sano T, Kato M, Iwatsuki K rbcl gene sequences provide evidence for the evolutionary lineages of leptosporangiate ferns. 202 The Linnean Society of London, Botanical Journal of the Linnean Society, 202, 70, Downloaded from on 25 December 207

13 DIVERSIFICATION OF EARLY POLYPOD LINEAGES 50 Proceedings of the National Academy of Sciences of the United States of America 9: Hasebe M, Wolf PG, Pryer KM, Sano R, Gastony GJ, Crane EH, Hauk WD, Haufler CH, Manhart JR, Murakami N, Yokoyama J, Ito M Fern phylogeny based on rbcl nucleotide sequences. American Fern Journal 85: Heads M. 20. Old taxa on young islands: a critique of the use of island age to date island-endemic clades and calibrate phylogenies. Systematic Biology 60: Hillis DM Taxonomic sampling, phylogenetic accuracy, and investigator bias. Systematic Biology 47: 3 8. Hilu KW, Borsch T, Müller K, Soltis DE, Soltis PS, Savolainen V, Chase MW, Powell MP, Alice LA, Evans R, Sauquet H, Neinhuis C, Slotta TAB, Rohwer JG, Campbell CS, Chatrou LW Angiosperm phylogeny based on matk sequence information. American Journal of Botany 90: Ho SYW, Jermin LS Tracing the decay of the historical signal in biological sequence data. Systematic Biology 53: Jian S, Soltis PS, Gitzendanner MA, Moore MJ, Li R, Hendry TA, Qiu Y-L, Dhingra A, Bell CD, Soltis DE Resolving an ancient, rapid radiation in Saxifragales. Systematic Biology 57: Korall P, Conant DS, Schneider H, Ueda K, Nishida H, Pryer KM On the phylogenetic position of Cystodium: it s not a tree fern it s a polypod! American Fern Journal 96: Korall P, Schuettpelz E, Pryer KM Abrupt deceleration of molecular evolution linked to the origin of arborescence in ferns. Evolution 64: Kramer KU. 97. Lindsaea-group. Flora Malesiana : Kramer KU, Green PS Pteridophytes and gymnosperms. In: Kubitzki K, ed. The families and genera of vascular plants. Berlin: Springer-Verlag, 404. Lehtonen S. 20a. Towards resolving the complete fern tree of life. PLoS ONE 6: e2485. Lehtonen S. 20b. Can sensitivity analysis help to detect long-branch attraction? Molecular Phylogenetics and Evolution 6: Lehtonen S, Christenhusz MJM Historical herbarium specimens in plant molecular systematics: an example from the fern genus Lindsaea (Lindsaeaceae). Biologia 65: Lehtonen S, Tuomisto H, Rouhan G, Christenhusz MJM Phylogenetics and classification of the pantropical fern family Lindsaeaceae. Botanical Journal of the Linnean Society 63: Löhne C, Borsch T Molecular evolution and phylogenetic utility of the petd group II intron: a case study in basal angiosperms. Molecular Biology and Evolution 22: Morley RJ Origin and evolution of tropical rain forests. New York: Wiley. Müller KF, Borsch T, Hilu KW Phylogenetic utility of rapidly evolving DNA at high taxonomical levels: contrasting matk, trnt-f, and rbcl in basal angiosperms. Molecular Phylogenetics and Evolution 4: Perrie L, Brownsey P Molecular evidence for longdistance dispersal in the New Zealand pteridophyte flora. Journal of Biogeography 34: Pinna MCC. 99. Concepts and tests of homology in the cladistic paradigm. Cladistics 7: Pryer KM, Schuettpelz E, Wolf PG, Schneider H, Smith AR, Cranfill R Phylogeny and evolution of ferns (monilophytes) with a focus on the early leptosporangiate divergences. American Journal of Botany 9: Pryer KM, Smith AR, Skog JE Phylogenetic relationships of extant pteridophytes based on evidence from morphology and rbcl sequences. American Fern Journal 85: Qiu Y-L, Li L, Hendry TA, Li R, Taylor DW, Issa MJ, Ronen AJ, Vekaria ML, White AM Reconstructing the basal angiosperm phylogeny: evaluating information content of mitochondrial genes. Taxon 55: Rai HS, Graham SW Utility of a large, multigene plastid data set in inferring higher-order relationships in ferns and relatives (monilophytes). American Journal of Botany 97: Rambaut A, Drummond AJ Tracer v.4, Available at: (accessed 8 April, 20). Ronquist F, Huelsenbeck JP MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 9: Rothwell GW, Stockey RA. 99. Onoclea sensibilis in the Paleocene of North America, a dramatic example of structural and ecological stasis. Review of Palaeobotany and Palynology 70: Sanders JG Program note: cladescan, a program for automated phylogenetic sensitivity analysis. Cladistics 26: 4 6. Sang T, Crawford DJ, Stuessy TF Chloroplast DNA phylogeny, reticulate evolution, and biogeography of Paeonia (Paeoniaceae). American Journal of Botany 84: Schneider H Plant morphology as the cornerstone to the integration of fossils and extant taxa in phylogenetic systematics. Species, Phylogeny and Evolution : Schneider H, Kenrick P An Early Cretaceous rootclimbing epiphyte (Lindsaeaceae) and its significance for calibrating the diversification of polypodiaceous ferns. Review of Palaeobotany and Palynology 5: Schneider H, Schuettpelz E, Pryer KM, Cranfill R, Magallón S, Lupia R Ferns diversified in the shadow of angiosperms. Nature 428: Schneider H, Smith AR, Pryer KM Is morphology really at odds with molecules in estimating fern phylogeny? Systematic Botany 34: Schuettpelz E, Korall P, Pryer KM Plastid atpa data provide improved support for deep relationships among ferns. Taxon 55: Schuettpelz E, Pryer KM Reconciling extreme branch length differences: decoupling time and rate through the evolutionary history of filmy ferns. Systematic Biology 55: The Linnean Society of London, Botanical Journal of the Linnean Society, 202, 70, Downloaded from on 25 December 207

14 502 S. LEHTONEN ET AL. Schuettpelz E, Pryer KM Fern phylogeny inferred from 400 leptosporangiate species and three plastid genes. Taxon 56: Schuettpelz E, Pryer KM Evidence for a Cenozoic radiation of ferns in an angiosperm-dominated canopy. Proceedings of the National Academy of Sciences of the United States of America 06: Shavit L, Penny D, Hendy MD, Holland BR The problem of rooting rapid radiations. Molecular Biology and Evolution 24: Shaw J, Lickey EB, Beck JT, Farmer SB, Liu W, Miller J, Siripun KC, Winder CT, Schilling EE, Small RL The tortoise and the hare II: relative utility of 2 noncoding chloroplast DNA sequences for phylogenetic analysis. American Journal of Botany 92: Simmons MP, Müller KF, Norton AP Alignment of, and phylogenetic inference from, random sequences: the susceptibility of alternative alignment methods to creating artifactual resolution and support. Molecular Phylogenetics and Evolution 57: Small RL, Lickey EB, Shaw J, Hauk WD Amplification of noncoding chloroplast DNA for phylogenetic studies in lycophytes and monilophytes with a comparative example of relative phylogenetic utility from Ophioglossaceae. Molecular Phylogenetics and Evolution 36: Smith AR, Pryer KM, Schuettpelz E, Korall P, Schneider H, Wolf PG A classification for extant ferns. Taxon 55: Smith AR, Pryer KM, Schuettpelz E, Korall P, Schneider H, Wolf PG Fern classification. In: Ranker TA, Haufler CH, eds. The biology and evolution of ferns and lycophytes. Cambridge: Cambridge University Press, Soltis DE, Albert VA, Savolainen V, Hilu K, Qiu K, Chase MW, Farris JS, Stefanović S, Rice DW, Palmer JD, Soltis PS Genome-scale data, angiosperm relationships, and ending incongruence : a cautionary tale in phylogenetics. Trends in Plant Science 9: Spagna JC, Álvarez-Padilla F Finding an upper limit for gap costs in direct optimization parsimony. Cladistics 24: Taberlet P, Gielly L, Pautou G, Bouvet J. 99. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Molecular Biology 7: Tate JA, Simpson BB Paraphyly of Tarasa (Malvaceae) and diverse origins of the polyploid species. Systematic Botany 28: Varón A, Vinh LS, Wheeler WC POY version 4: phylogenetic analysis using dynamic homologies. Cladistics 26: Wägele JW, Mayer C Visualizing differences in phylogenetic information content of alignments and distinction of three classes of long-branch effects. BMC Evolutionary Biology 7: 47. Wheeler W Optimization alignment, the end of multiple sequence alignment in phylogenetics? Cladistics 2: 9. Wheeler WC Sequence alignment, parameter sensitivity, and the phylogenetic analysis of molecular data. Systematic Biology 44: Wolf PG Phylogenetic analyses of rbcl and nuclear ribosomal RNA gene sequences in Dennstaedtiaceae. American Fern Journal 85: Wolf PG Evaluation of atpb nucleotide sequence for phylogenetic studies of ferns and other pteridophytes. American Journal of Botany 84: Wolf PG, Sipes SD, White MR, Martines ML, Pryer KM, Smith AR, Ueda K Phylogenetic relationships of the enigmatic fern families Hymenophyllopsidaceae and Lophosoriaceae: evidence from rbcl nucleotide sequences. Plant Systematics and Evolution 29: Wolf PG, Soltis PS, Soltis DS Phylogenetic relationships of dennstaedtioid ferns: evidence from rbcl sequences. Molecular Phylogenetics and Evolution 3: Wortley AH, Rudall PJ, Harris DJ, Scotland RW How much data are needed to resolve a difficult phylogeny? Case study in Lamiales. Systematic Biology 54: SUPPORTING INFORMATION Additional Supporting Information may be found in the online version of this article: Figure S. Result of the parsimony analysis of the atpa gene, using pre-aligned data. Strict consensus of the nine most-parsimonious trees with 235 steps. Results of the sensitivity analysis are shown. Figure S2. Result of the parsimony analysis of the atpb gene, using pre-aligned data. Strict consensus of the three most-parsimonious trees with 566 steps. Results of the sensitivity analysis are shown. Figure S3. Result of the parsimony analysis of the 8S gene, using direct optimization. The single mostparsimonious tree of 7728 steps. Results of the sensitivity analysis are shown. Figure S4. Result of the parsimony analysis of the rbcl gene, using pre-aligned data. Strict consensus of the nine most-parsimonious trees with 765 steps. Results of the sensitivity analysis are shown. Figure S5. Result of the parsimony analysis of the rpoc gene, using pre-aligned data. Strict consensus of the four most-parsimonious trees with 857 steps. Results of the sensitivity analysis are shown. Figure S6. Result of the parsimony analysis of the rps4 gene, using pre-aligned data. Strict consensus of the 6 most-parsimonious trees with 26 steps. Results of the sensitivity analysis are shown. 202 The Linnean Society of London, Botanical Journal of the Linnean Society, 202, 70, Downloaded from on 25 December 207