Supplemental information. Supplementary_Fig_S1: Ribo-seq meta profiles at start and stop codons S. Typhimurium.

Size: px
Start display at page:

Download "Supplemental information. Supplementary_Fig_S1: Ribo-seq meta profiles at start and stop codons S. Typhimurium."

Transcription

1 Supplementl informtion Pge 1 Supplementry_Fig_S1: Rio-seq met profiles t strt nd stop odons S. Typhimurium. 2 Supplementry_Fig_S2: Red length distriutions t Shine Dlgrno motifs. 3 Supplementry_Fig_S3: Codon speifi red length distriutions. 4 Supplementry_Fig_S4: Additionl predition support. 4 Supplementry_Fig_S5: Third odon periodiity nd GC ontent. 5 Supplementry_Fig_S6: Evidene for predited novel trnsltion initition sites. 5 Supplementry_Fig_S7: Rio-seq met profiles t strt odons E. oli. 6 Supplementry_Fig_S8: Lirry red length distriutions. 7 Supplementry_Fig_S9: Red length djustments. 7

2 d Supplementry_Fig_S1: Rio-seq met profiles t strt nd stop odons - S. Typhimurium Rio-seq met-profiles in windows round strt odons for nnotted genes (n=4205) in the S. Typhimurium genome, ontriutions from eh gene re sled to sum of one. (upper) Proportion of 5 or 3' rio-seq red ounts per nuleotide position, oloured y odon position. (lower) Hetmps of 5' or 3' rio-seq red ounts per length, oloured y z-sore per proteted red length. 2

3 Supplementry_Fig_S2: Red length distriutions t Shine Dlgrno motifs Rio-seq met-profiles in windows round shine dlgrno sequenes immeditely upstrem of TIS (n=736) or t internl CDS positions (n=8564) in the S. Typhimurium genome, ontriutions from eh motif window re sled to sum of one. Brhrts show the proportion of 5 or 3' rio-seq red ounts per nuleotide position, oloured y odon position. Hetmps show 5' or 3' rio-seq red ounts per length, oloured y z-sore per red length. () In reltion to SD motifs upstrem of initition odons. () In reltion to internl SD motifs within CDS regions. () In reltion to SD motifs upstrem of initition odons, feted y distne etween the SD motif nd initition odon (nt). 3

4 Supplementry_Fig_S3: Codon speifi red length distriutions. S. typhimurium rio-seq met-profiles in windows round the most ommonly used trnsltion initition odons t internl, in-frme CDS positions. Contriutions from eh odon window re sled to sum of one. (upper) Proportion of 5 or 3' rio-seq red ounts per nuleotide position, oloured y odon position. (lower) Hetmps of 5' or 3' rio-seq red ounts per frgment length, oloured y z-sore per red length. () ATG odons (n=35531). () GTG odons (n=35117). () TTG odons (n=17647). Supplementry_Fig_S4: Additionl predition support 4 () Showing the similrity in usge of different strt odons etween nnotted (n=4653) nd predited (n=4334) S. Typhimurium ORFs. (). Met plots showing the proportion of sled 5' rio-seq red ounts in reltion to nnotted or predited trnsltion initition sites, for ORFs mthing nnotted genes (n=3853), predited s extensions (n=214) or predited s truntions (n=205), in the S. Typhimurium dtset. Contriutions from eh gene re sled to sum of one. Nuleotide positions re oloured y odon position. Upstrem regions re highlighted in pink, downstrem regions re highlighted in light lue.

5 Supplementry_Fig_S5: Third odon periodiity nd GC ontent. () Proportion of 3' rio-seq red ounts per nuleotide position, from positions nt downstrem of the nnotted strt odon in the S. Typhimurium genome, oloured y odon position. Contriutions from eh gene re sled to sum of one. (upper) the highest 10% of regions y third odon GC ontent (n=467). (lower) the ottom 10% of regions y third odon GC ontent (n=468). () fourier trnsform showing the periodiity in the distriutions of (). Supplementry_Fig_S6: Evidene for predited novel trnsltion initition sites. () Sequene motifs reltion to predited trnsltion initition sites (n=61), for sequenes in ll novel predited ORFs in the S. Typhimurium dtset. (B) Met-profiles in reltion to nnotted (n=3853) or predited trnsltion initition sites. Blk dotted lines representing ORFs mthing nnotted genes, grey lines represent novel preditions. (upper) Met-profiles showing the perentge of GC ontent verged in 9nt sliding windows, higher vlues downstrem of the odon region re inditive of oding potentil. (lower) Met-profiles of free energy verged in 39nt sliding windows, higher vlues represent lower potentil for seondry struture formtion. 5

6 d e f Supplementry_Fig_S7: Rio-seq met profiles t strt odons - E. Coli Rio-seq met-profiles in windows round strt odons for nnotted genes (n=3726) in the E. oli genome, ontriutions from eh gene re sled to sum of one. (upper) Proportion of 5 or 3' rio-seq red ounts per nuleotide position, oloured y odon position. (lower) Hetmps of 5' or 3' rio-seq red length ounts, oloured y z-sore per red length. 6

7 Supplementry_Fig_S8: Lirry red length distriutions Red length distriutions of solute () or proportionl () ounts of ligned rio-seq reds per lirry. 7 Supplementry_Fig_S9: Red lengths djustments The sum of sled 5' rio-seq ounts from the () monosome or () polysome replite, in -30 to +60nt windows round nnotted strt odons (n=4205) in S. Typhimurium, per red length, oloured y odon position. Contriutions from eh gene re sled to sum of one. Blue rrows indite the pek orresponding to rio-seq footprints trnslting the strt odon.

Global alignment. Genome Rearrangements Finding preserved genes. Lecture 18

Global alignment. Genome Rearrangements Finding preserved genes. Lecture 18 Computt onl Biology Leture 18 Genome Rerrngements Finding preserved genes We hve seen before how to rerrnge genome to obtin nother one bsed on: Reversls Knowledge of preserved bloks (or genes) Now we re

More information

Instructions. An 8.5 x 11 Cheat Sheet may also be used as an aid for this test. MUST be original handwriting.

Instructions. An 8.5 x 11 Cheat Sheet may also be used as an aid for this test. MUST be original handwriting. ID: B CSE 2021 Computer Orgniztion Midterm Test (Fll 2009) Instrutions This is losed ook, 80 minutes exm. The MIPS referene sheet my e used s n id for this test. An 8.5 x 11 Chet Sheet my lso e used s

More information

Ribosome signatures aid bacterial translation initiation site identification

Ribosome signatures aid bacterial translation initiation site identification Giess et al. BMC Biology (2017) 15:76 DOI 10.1186/s12915-017-0416-0 RESEARCH ARTICLE Ribosome signatures aid bacterial translation initiation site identification Adam Giess 1, Veronique Jonckheere 2,3,

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introdution to Bioinformtis Outline } Method without onsidering bkground distribution } Generl pproh onsidering bkground distribution } Wys to speed up the lgorithm Trnsription Ftor Binding Sites (TFBSs)

More information

b a wt ccd8 dad2 Secondary branches 15 e cd normal low b 2

b a wt ccd8 dad2 Secondary branches 15 e cd normal low b 2 A 3 1 Shoot mss (g) B Root mss (g) C 8 Primry rnhes D 8 Seonry rnhes 1 e E 8 Shoot mss/rnhes norml low 1 F 8 8 Shoot mss/root mss 8 8 Supplementl Figure 1 Aitionl phenotypi t reore from the plnts esrie

More information

, g. Exercise 1. Generator polynomials of a convolutional code, given in binary form, are g. Solution 1.

, g. Exercise 1. Generator polynomials of a convolutional code, given in binary form, are g. Solution 1. Exerise Genertor polynomils of onvolutionl ode, given in binry form, re g, g j g. ) Sketh the enoding iruit. b) Sketh the stte digrm. ) Find the trnsfer funtion T. d) Wht is the minimum free distne of

More information

Computational Biology Lecture 18: Genome rearrangements, finding maximal matches Saad Mneimneh

Computational Biology Lecture 18: Genome rearrangements, finding maximal matches Saad Mneimneh Computtionl Biology Leture 8: Genome rerrngements, finding miml mthes Sd Mneimneh We hve seen how to rerrnge genome to otin nother one sed on reversls nd the knowledge of the preserved loks or genes. Now

More information

Periodic string comparison

Periodic string comparison Periodi string omprison Alexnder Tiskin Deprtment of Computer Siene University of Wrwik http://www.ds.wrwik..uk/~tiskin Alexnder Tiskin (Wrwik) Periodi string omprison 1 / 51 1 Introdution 2 Semi-lol string

More information

Semantic Analysis. CSCI 3136 Principles of Programming Languages. Faculty of Computer Science Dalhousie University. Winter Reading: Chapter 4

Semantic Analysis. CSCI 3136 Principles of Programming Languages. Faculty of Computer Science Dalhousie University. Winter Reading: Chapter 4 Semnti nlysis SI 16 Priniples of Progrmming Lnguges Fulty of omputer Siene Dlhousie University Winter 2012 Reding: hpter 4 Motivtion Soure progrm (hrter strem) Snner (lexil nlysis) Front end Prse tree

More information

Motifs and Logos. Six Introduction to Bioinformatics. Importance and Abundance of Motifs. Getting the CDS. From DNA to Protein 6.1.

Motifs and Logos. Six Introduction to Bioinformatics. Importance and Abundance of Motifs. Getting the CDS. From DNA to Protein 6.1. Motifs and Logos Six Discovering Genomics, Proteomics, and Bioinformatics by A. Malcolm Campbell and Laurie J. Heyer Chapter 2 Genome Sequence Acquisition and Analysis Sami Khuri Department of Computer

More information

6.3.2 Spectroscopy. N Goalby chemrevise.org 1 NO 2 H 3 CH3 C. NMR spectroscopy. Different types of NMR

6.3.2 Spectroscopy. N Goalby chemrevise.org 1 NO 2 H 3 CH3 C. NMR spectroscopy. Different types of NMR 6.. Spetrosopy NMR spetrosopy Different types of NMR NMR spetrosopy involves intertion of mterils with the lowenergy rdiowve region of the eletromgneti spetrum NMR spetrosopy is the sme tehnology s tht

More information

1 This diagram represents the energy change that occurs when a d electron in a transition metal ion is excited by visible light.

1 This diagram represents the energy change that occurs when a d electron in a transition metal ion is excited by visible light. 1 This igrm represents the energy hnge tht ours when eletron in trnsition metl ion is exite y visile light. Give the eqution tht reltes the energy hnge ΔE to the Plnk onstnt, h, n the frequeny, v, of the

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:.38/nture8499 doi:.38/nture8499 5 6 5 4.5 Firing rte (Hz) -67-65 -66-6 -58 V m (mv) -7-67 -68-66 -64 c Thet power (mv ) -73-69 -7-7 -7.5.8 3....9.9.4.6.6. 9 8 9 8 9 8 9 8 9 8 Supplementry Figure Firing

More information

Learning Partially Observable Markov Models from First Passage Times

Learning Partially Observable Markov Models from First Passage Times Lerning Prtilly Oservle Mrkov s from First Pssge s Jérôme Cllut nd Pierre Dupont Europen Conferene on Mhine Lerning (ECML) 8 Septemer 7 Outline. FPT in models nd sequenes. Prtilly Oservle Mrkov s (POMMs).

More information

SEMANTIC ANALYSIS PRINCIPLES OF PROGRAMMING LANGUAGES. Norbert Zeh Winter Dalhousie University 1/28

SEMANTIC ANALYSIS PRINCIPLES OF PROGRAMMING LANGUAGES. Norbert Zeh Winter Dalhousie University 1/28 SEMNTI NLYSIS PRINIPLES OF PROGRMMING LNGUGES Norbert Zeh Winter 2018 Dlhousie University 1/28 PROGRM TRNSLTION FLOW HRT Soure progrm (hrter strem) Snner (lexil nlysis) Front end Prse tree Prser (syntti

More information

Energy Bands Energy Bands and Band Gap. Phys463.nb Phenomenon

Energy Bands Energy Bands and Band Gap. Phys463.nb Phenomenon Phys463.nb 49 7 Energy Bnds Ref: textbook, Chpter 7 Q: Why re there insultors nd conductors? Q: Wht will hppen when n electron moves in crystl? In the previous chpter, we discussed free electron gses,

More information

22: Union Find. CS 473u - Algorithms - Spring April 14, We want to maintain a collection of sets, under the operations of:

22: Union Find. CS 473u - Algorithms - Spring April 14, We want to maintain a collection of sets, under the operations of: 22: Union Fin CS 473u - Algorithms - Spring 2005 April 14, 2005 1 Union-Fin We wnt to mintin olletion of sets, uner the opertions of: 1. MkeSet(x) - rete set tht ontins the single element x. 2. Fin(x)

More information

Instructions to students: Use your Text Book and attempt these questions.

Instructions to students: Use your Text Book and attempt these questions. Instrutions to students: Use your Text Book nd ttempt these questions. Due Dte: 16-09-2018 Unit 2 Chpter 8 Test Slrs nd vetors Totl mrks 50 Nme: Clss: Dte: Setion A Selet the est nswer for eh question.

More information

Data Structures and Algorithm. Xiaoqing Zheng

Data Structures and Algorithm. Xiaoqing Zheng Dt Strutures nd Algorithm Xioqing Zheng zhengxq@fudn.edu.n String mthing prolem Pttern P ours with shift s in text T (or, equivlently, tht pttern P ours eginning t position s + in text T) if T[s +... s

More information

Pythagoras Theorem. The area of the square on the hypotenuse is equal to the sum of the squares on the other two sides

Pythagoras Theorem. The area of the square on the hypotenuse is equal to the sum of the squares on the other two sides Pythgors theorem nd trigonometry Pythgors Theorem The hypotenuse of right-ngled tringle is the longest side The hypotenuse is lwys opposite the right-ngle 2 = 2 + 2 or 2 = 2-2 or 2 = 2-2 The re of the

More information

Automatic Synthesis of New Behaviors from a Library of Available Behaviors

Automatic Synthesis of New Behaviors from a Library of Available Behaviors Automti Synthesis of New Behviors from Lirry of Aville Behviors Giuseppe De Giomo Università di Rom L Spienz, Rom, Itly degiomo@dis.unirom1.it Sestin Srdin RMIT University, Melourne, Austrli ssrdin@s.rmit.edu.u

More information

Thermodynamics. Question 1. Question 2. Question 3 3/10/2010. Practice Questions PV TR PV T R

Thermodynamics. Question 1. Question 2. Question 3 3/10/2010. Practice Questions PV TR PV T R /10/010 Question 1 1 mole of idel gs is rought to finl stte F y one of three proesses tht hve different initil sttes s shown in the figure. Wht is true for the temperture hnge etween initil nd finl sttes?

More information

April 8, 2017 Math 9. Geometry. Solving vector problems. Problem. Prove that if vectors and satisfy, then.

April 8, 2017 Math 9. Geometry. Solving vector problems. Problem. Prove that if vectors and satisfy, then. pril 8, 2017 Mth 9 Geometry Solving vetor prolems Prolem Prove tht if vetors nd stisfy, then Solution 1 onsider the vetor ddition prllelogrm shown in the Figure Sine its digonls hve equl length,, the prllelogrm

More information

ILLUSTRATING THE EXTENSION OF A SPECIAL PROPERTY OF CUBIC POLYNOMIALS TO NTH DEGREE POLYNOMIALS

ILLUSTRATING THE EXTENSION OF A SPECIAL PROPERTY OF CUBIC POLYNOMIALS TO NTH DEGREE POLYNOMIALS ILLUSTRATING THE EXTENSION OF A SPECIAL PROPERTY OF CUBIC POLYNOMIALS TO NTH DEGREE POLYNOMIALS Dvid Miller West Virgini University P.O. BOX 6310 30 Armstrong Hll Morgntown, WV 6506 millerd@mth.wvu.edu

More information

a cacnb1 ts25/ts25 Supplemental Figure 1

a cacnb1 ts25/ts25 Supplemental Figure 1 ccn1 ts/ts α -ungrotoxin prlyzed 0.6 ΔF/F 0.0 2 ΔF/F 2 s stimulus α -ungrotoxin ccn1 ts/ts Supplementl Figure 1 CSF-cNs recorded from lrv prlyzed with α-ungrotoxin nd ccn1 mutnt lrv show no difference

More information

Regular languages refresher

Regular languages refresher Regulr lnguges refresher 1 Regulr lnguges refresher Forml lnguges Alphet = finite set of letters Word = sequene of letter Lnguge = set of words Regulr lnguges defined equivlently y Regulr expressions Finite-stte

More information

Alpha Algorithm: A Process Discovery Algorithm

Alpha Algorithm: A Process Discovery Algorithm Proess Mining: Dt Siene in Ation Alph Algorithm: A Proess Disovery Algorithm prof.dr.ir. Wil vn der Alst www.proessmining.org Proess disovery = Ply-In Ply-In event log proess model Ply-Out Reply proess

More information

Technische Universität München Winter term 2009/10 I7 Prof. J. Esparza / J. Křetínský / M. Luttenberger 11. Februar Solution

Technische Universität München Winter term 2009/10 I7 Prof. J. Esparza / J. Křetínský / M. Luttenberger 11. Februar Solution Tehnishe Universität Münhen Winter term 29/ I7 Prof. J. Esprz / J. Křetínský / M. Luttenerger. Ferur 2 Solution Automt nd Forml Lnguges Homework 2 Due 5..29. Exerise 2. Let A e the following finite utomton:

More information

The University of Nottingham SCHOOL OF COMPUTER SCIENCE A LEVEL 2 MODULE, SPRING SEMESTER MACHINES AND THEIR LANGUAGES ANSWERS

The University of Nottingham SCHOOL OF COMPUTER SCIENCE A LEVEL 2 MODULE, SPRING SEMESTER MACHINES AND THEIR LANGUAGES ANSWERS The University of ottinghm SCHOOL OF COMPUTR SCIC A LVL 2 MODUL, SPRIG SMSTR 2015 2016 MACHIS AD THIR LAGUAGS ASWRS Time llowed TWO hours Cndidtes my omplete the front over of their nswer ook nd sign their

More information

Nondeterministic Finite Automata

Nondeterministic Finite Automata Nondeterministi Finite utomt The Power of Guessing Tuesdy, Otoer 4, 2 Reding: Sipser.2 (first prt); Stoughton 3.3 3.5 S235 Lnguges nd utomt eprtment of omputer Siene Wellesley ollege Finite utomton (F)

More information

Outline. Theory-based Bayesian framework for property induction Causal structure induction

Outline. Theory-based Bayesian framework for property induction Causal structure induction Outline Theory-sed Byesin frmework for property indution Cusl struture indution Constrint-sed (ottom-up) lerning Theory-sed Byesin lerning The origins of usl knowledge Question: how do people relily ome

More information

Compiler Design. Spring Lexical Analysis. Sample Exercises and Solutions. Prof. Pedro C. Diniz

Compiler Design. Spring Lexical Analysis. Sample Exercises and Solutions. Prof. Pedro C. Diniz University of Southern Cliforni Computer Siene Deprtment Compiler Design Spring 7 Lexil Anlysis Smple Exerises nd Solutions Prof. Pedro C. Diniz USC / Informtion Sienes Institute 47 Admirlty Wy, Suite

More information

Ling 3701H / Psych 3371H: Lecture Notes 9 Hierarchic Sequential Prediction

Ling 3701H / Psych 3371H: Lecture Notes 9 Hierarchic Sequential Prediction Ling 3701H / Psyh 3371H: Leture Notes 9 Hierrhi Sequentil Predition Contents 9.1 Complex events.................................... 1 9.2 Reognition of omplex events using event frgments................

More information

Tremor-rich shallow dyke formation followed by silent magma flow at Bárðarbunga in Iceland

Tremor-rich shallow dyke formation followed by silent magma flow at Bárðarbunga in Iceland In the formt provided y the uthors nd unedited. SUPPLEMENTARY INFORMATION DOI: 1.138/NGEO9 Tremor-rich shllow dyke formtion followed y silent mgm flow t Bárðrung in Icelnd 1,, 1, 3 1, 1 1, NATURE GEOSCIENCE

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementry Figure (nesthetized) (wke) Normlized mplitude.5 Pek width (ms).6.4.2 4 2 2 x 3 Wveform slope Normlized mplitude.5 Pek width (ms).6.4.2 x 3 3 2 Wveform slope c (nesthetized) d (wke) Normlized

More information

Subsumption of Vertical Viewpoint Patterns

Subsumption of Vertical Viewpoint Patterns Susumption of Vertil Viewpoint Ptterns Mthieu Bergeron 1 nd Drrell Conklin 2 1 CIRMMT, MGill University, Montrel, Cnd mthieu.ergeron@mil.mgill. 2 Deprtment of Computer Siene nd AI Universidd del Pís Vso,

More information

Functions. mjarrar Watch this lecture and download the slides

Functions. mjarrar Watch this lecture and download the slides 9/6/7 Mustf Jrrr: Leture Notes in Disrete Mthemtis. Birzeit University Plestine 05 Funtions 7.. Introdution to Funtions 7. One-to-One Onto Inverse funtions mjrrr 05 Wth this leture nd downlod the slides

More information

GM1 Consolidation Worksheet

GM1 Consolidation Worksheet Cmridge Essentils Mthemtis Core 8 GM1 Consolidtion Worksheet GM1 Consolidtion Worksheet 1 Clulte the size of eh ngle mrked y letter. Give resons for your nswers. or exmple, ngles on stright line dd up

More information

Section 7.2 Velocity. Solution

Section 7.2 Velocity. Solution Section 7.2 Velocity In the previous chpter, we showed tht velocity is vector becuse it hd both mgnitude (speed) nd direction. In this section, we will demonstrte how two velocities cn be combined to determine

More information

STRAND J: TRANSFORMATIONS, VECTORS and MATRICES

STRAND J: TRANSFORMATIONS, VECTORS and MATRICES Mthemtics SKE: STRN J STRN J: TRNSFORMTIONS, VETORS nd MTRIES J3 Vectors Text ontents Section J3.1 Vectors nd Sclrs * J3. Vectors nd Geometry Mthemtics SKE: STRN J J3 Vectors J3.1 Vectors nd Sclrs Vectors

More information

CS311 Computational Structures Regular Languages and Regular Grammars. Lecture 6

CS311 Computational Structures Regular Languages and Regular Grammars. Lecture 6 CS311 Computtionl Strutures Regulr Lnguges nd Regulr Grmmrs Leture 6 1 Wht we know so fr: RLs re losed under produt, union nd * Every RL n e written s RE, nd every RE represents RL Every RL n e reognized

More information

6.3.2 Spectroscopy. N Goalby chemrevise.org 1 NO 2 CH 3. CH 3 C a. NMR spectroscopy. Different types of NMR

6.3.2 Spectroscopy. N Goalby chemrevise.org 1 NO 2 CH 3. CH 3 C a. NMR spectroscopy. Different types of NMR 6.. Spetrosopy NMR spetrosopy Different types of NMR NMR spetrosopy involves intertion of mterils with the lowenergy rdiowve region of the eletromgneti spetrum NMR spetrosopy is the sme tehnology s tht

More information

Discrete Structures, Test 2 Monday, March 28, 2016 SOLUTIONS, VERSION α

Discrete Structures, Test 2 Monday, March 28, 2016 SOLUTIONS, VERSION α Disrete Strutures, Test 2 Mondy, Mrh 28, 2016 SOLUTIONS, VERSION α α 1. (18 pts) Short nswer. Put your nswer in the ox. No prtil redit. () Consider the reltion R on {,,, d with mtrix digrph of R.. Drw

More information

System Validation (IN4387) November 2, 2012, 14:00-17:00

System Validation (IN4387) November 2, 2012, 14:00-17:00 System Vlidtion (IN4387) Novemer 2, 2012, 14:00-17:00 Importnt Notes. The exmintion omprises 5 question in 4 pges. Give omplete explntion nd do not onfine yourself to giving the finl nswer. Good luk! Exerise

More information

Supporting Information for. Initial Biochemical and Functional Evaluation of Murine Calprotectin Reveals Ca(II)-

Supporting Information for. Initial Biochemical and Functional Evaluation of Murine Calprotectin Reveals Ca(II)- Supporting Information for Initial Biochemical and Functional Evaluation of Murine Calprotectin Reveals Ca(II)- Dependence and Its Ability to Chelate Multiple Nutrient Transition Metal Ions Rose C. Hadley,

More information

CS 2204 DIGITAL LOGIC & STATE MACHINE DESIGN SPRING 2014

CS 2204 DIGITAL LOGIC & STATE MACHINE DESIGN SPRING 2014 S 224 DIGITAL LOGI & STATE MAHINE DESIGN SPRING 214 DUE : Mrh 27, 214 HOMEWORK III READ : Relte portions of hpters VII n VIII ASSIGNMENT : There re three questions. Solve ll homework n exm prolems s shown

More information

Emission of K -, L - and M - Auger Electrons from Cu Atoms. Abstract

Emission of K -, L - and M - Auger Electrons from Cu Atoms. Abstract Emission of K -, L - nd M - uger Electrons from Cu toms Mohmed ssd bdel-rouf Physics Deprtment, Science College, UEU, l in 17551, United rb Emirtes ssd@ueu.c.e bstrct The emission of uger electrons from

More information

HPLP310 Biblio_35 Fissures radial intern in a thick cylinder under pressure and thermal loading

HPLP310 Biblio_35 Fissures radial intern in a thick cylinder under pressure and thermal loading defult Titre : HPLP310 - Biblio_35 Fissure rdile interne dns u[...] Dte : 0/09/011 Pge : 1/15 Responsble : TRAN Vn Xun Clé : V7.0.310 Révision : HPLP310 Biblio_35 Fissures rdil intern in thick cylinder

More information

Figure S1: Similar to Fig. 2D in paper, but using Euclidean distance instead of Spearman distance.

Figure S1: Similar to Fig. 2D in paper, but using Euclidean distance instead of Spearman distance. Supplementary analysis 1: Euclidean distance in the RESS As shown in Fig. S1, Euclidean distance did not adequately distinguish between pairs of random sequence and pairs of structurally-related sequence.

More information

Title of file for HTML: Supplementary Information Description: Supplementary Figures. Title of file for HTML: Peer Review File Description:

Title of file for HTML: Supplementary Information Description: Supplementary Figures. Title of file for HTML: Peer Review File Description: Title of file for HTML: Supplementry Informtion Description: Supplementry Figures Title of file for HTML: Peer Review File Description: WTP SST IPO PDO WTP leds IPO PDO Supplementry Figure 1 IPO (or PDO)

More information

Identification of an OPR3-independent pathway for jasmonate biosynthesis. Department of Plant Molecular Genetics, National Centre for Biotechnology,

Identification of an OPR3-independent pathway for jasmonate biosynthesis. Department of Plant Molecular Genetics, National Centre for Biotechnology, Supplementry Informtion Identifition of n OPR3-independent pthwy for jsmonte iosynthesis Andre Chini 1, Isel Monte 1, Angel M. Zmrreño 2, Mts Hmerg 3, Steve Lssueur 4, Philippe Reymond 4, Slly Weiss 5,

More information

H 4 H 8 N 2. Example 1 A compound is found to have an accurate relative formula mass of It is thought to be either CH 3.

H 4 H 8 N 2. Example 1 A compound is found to have an accurate relative formula mass of It is thought to be either CH 3. . Spetrosopy Mss spetrosopy igh resolution mss spetrometry n e used to determine the moleulr formul of ompound from the urte mss of the moleulr ion For exmple, the following moleulr formuls ll hve rough

More information

Solids of Revolution

Solids of Revolution Solis of Revolution Solis of revolution re rete tking n re n revolving it roun n is of rottion. There re two methos to etermine the volume of the soli of revolution: the isk metho n the shell metho. Disk

More information

12.1 Introduction to Rational Expressions

12.1 Introduction to Rational Expressions . Introduction to Rtionl Epressions A rtionl epression is rtio of polynomils; tht is, frction tht hs polynomil s numertor nd/or denomintor. Smple rtionl epressions: 0 EVALUATING RATIONAL EXPRESSIONS To

More information

Comparing the Pre-image and Image of a Dilation

Comparing the Pre-image and Image of a Dilation hpter Summry Key Terms Postultes nd Theorems similr tringles (.1) inluded ngle (.2) inluded side (.2) geometri men (.) indiret mesurement (.6) ngle-ngle Similrity Theorem (.2) Side-Side-Side Similrity

More information

H (2a, a) (u 2a) 2 (E) Show that u v 4a. Explain why this implies that u v 4a, with equality if and only u a if u v 2a.

H (2a, a) (u 2a) 2 (E) Show that u v 4a. Explain why this implies that u v 4a, with equality if and only u a if u v 2a. Chpter Review 89 IGURE ol hord GH of the prol 4. G u v H (, ) (A) Use the distne formul to show tht u. (B) Show tht G nd H lie on the line m, where m ( )/( ). (C) Solve m for nd sustitute in 4, otining

More information

Journal of Chemical and Pharmaceutical Research, 2013, 5(12): Research Article

Journal of Chemical and Pharmaceutical Research, 2013, 5(12): Research Article Avilble online www.jopr.om Journl of Chemil nd Phrmeutil Reserh, 2013, 5(12):1283-1288 Reserh Artile ISSN : 0975-7384 CODEN(USA) : JCPRC5 Study on osion resistne of zin lloy oting of mehnil plting by eletrohemil

More information

Activities. 4.1 Pythagoras' Theorem 4.2 Spirals 4.3 Clinometers 4.4 Radar 4.5 Posting Parcels 4.6 Interlocking Pipes 4.7 Sine Rule Notes and Solutions

Activities. 4.1 Pythagoras' Theorem 4.2 Spirals 4.3 Clinometers 4.4 Radar 4.5 Posting Parcels 4.6 Interlocking Pipes 4.7 Sine Rule Notes and Solutions MEP: Demonstrtion Projet UNIT 4: Trigonometry UNIT 4 Trigonometry tivities tivities 4. Pythgors' Theorem 4.2 Spirls 4.3 linometers 4.4 Rdr 4.5 Posting Prels 4.6 Interloking Pipes 4.7 Sine Rule Notes nd

More information

H SERIES. Algebra Basics. Algebra Basics. Solutions. Curriculum Ready.

H SERIES. Algebra Basics. Algebra Basics. Solutions. Curriculum Ready. Alger Bsis H SERIES Alger Bsis Curriulum Rey www.mthletis.om Copyright 009 P Lerning. All rights reserve. First eition printe 009 in Austrli. A tlogue reor for this ook is ville from P Lerning Lt. ISBN

More information

Gene Structure & Gene Finding

Gene Structure & Gene Finding Gene Structure & Gene Finding David Wishart Rm. 3-41 Athabasca Hall david.wishart@ualberta.ca Outline for Next 3 Weeks Genes and Gene Finding (Prokaryotes) Genes and Gene Finding (Eukaryotes) Genome and

More information

Sequence Cartridge Valves

Sequence Cartridge Valves Sequene Vlves Type Pge Pilot Operted, lned Piston Diret ting with Reverse Flow Chek 7 Kik-down, Pilot Operted, lned Piston ir Controlled, Pilot Operted, lned Piston 9 Diret ting without Reverse Flow Chek

More information

What else can you do?

What else can you do? Wht else cn you do? ngle sums The size of specil ngle types lernt erlier cn e used to find unknown ngles. tht form stright line dd to 180c. lculte the size of + M, if L is stright line M + L = 180c( stright

More information

Formation of hard very high energy gamma-ray spectra of blazars due to internal photon photon absorption

Formation of hard very high energy gamma-ray spectra of blazars due to internal photon photon absorption Mon. Not. R. Astron. So. 387, 1206 1214 (2008) doi:10.1111/j.1365-2966.2008.13315.x Formtion of hrd very high energy gmm-ry spetr of lzrs due to internl photon photon sorption Felix A. Ahronin, 1,2 D.

More information

Pattern Recognition 2015 Neural Networks (2)

Pattern Recognition 2015 Neural Networks (2) Pttern Reognition 2015 Nerl Networks (2) Ad Feelders Universiteit Utreht Ad Feelders ( Universiteit Utreht ) Pttern Reognition 1 / 37 Error k-propgtion How to ompte the weights in nerl network? Evlte derivtives

More information

Expanded View Figures

Expanded View Figures Molecular Systems iology Evolutionary divergence of mouse P Mei-Sheng Xiao et al Expanded View Figures Nucleotide percentage (%) 0 20 40 60 80 100 T G Nucleotide percentage (%) 0 20 40 60 80 100 T G Frequency

More information

Supplementary Information to The role of endogenous and exogenous mechanisms in the formation of R&D networks

Supplementary Information to The role of endogenous and exogenous mechanisms in the formation of R&D networks Supplementry Informtion to The role of endogenous nd exogenous mechnisms in the formtion of R&D networks Mrio V. Tomsello 1, Nicol Perr 2, Cludio J. Tessone 1, Márton Krsi 3, nd Frnk Schweitzer 1 1 Chir

More information

Supplementary Information

Supplementary Information Supplementary Information 1 List of Figures 1 Models of circular chromosomes. 2 Distribution of distances between core genes in Escherichia coli K12, arc based model. 3 Distribution of distances between

More information

Alpha Algorithm: Limitations

Alpha Algorithm: Limitations Proess Mining: Dt Siene in Ation Alph Algorithm: Limittions prof.dr.ir. Wil vn der Alst www.proessmining.org Let L e n event log over T. α(l) is defined s follows. 1. T L = { t T σ L t σ}, 2. T I = { t

More information

Minnesota State University, Mankato 44 th Annual High School Mathematics Contest April 12, 2017

Minnesota State University, Mankato 44 th Annual High School Mathematics Contest April 12, 2017 Minnesot Stte University, Mnkto 44 th Annul High School Mthemtics Contest April, 07. A 5 ft. ldder is plced ginst verticl wll of uilding. The foot of the ldder rests on the floor nd is 7 ft. from the wll.

More information

arxiv: v1 [cond-mat.mtrl-sci] 10 Aug 2017

arxiv: v1 [cond-mat.mtrl-sci] 10 Aug 2017 rxiv:178.313v1 [ond-mt.mtrl-si] 1 Aug 217 Knowledge-Trnsfer sed Cost-effetive Serh for Interfe Strutures: A Cse Study on f-al [11] Tilt Grin Boundry Tomohiro Yonezu 1, Tomoyuki Tmur 2,3, Ihiro Tkeuhi 1,3,

More information

Algorithm Design and Analysis

Algorithm Design and Analysis Algorithm Design nd Anlysis LECTURE 8 Mx. lteness ont d Optiml Ching Adm Smith 9/12/2008 A. Smith; sed on slides y E. Demine, C. Leiserson, S. Rskhodnikov, K. Wyne Sheduling to Minimizing Lteness Minimizing

More information

332:221 Principles of Electrical Engineering I Fall Hourly Exam 2 November 6, 2006

332:221 Principles of Electrical Engineering I Fall Hourly Exam 2 November 6, 2006 2:221 Principles of Electricl Engineering I Fll 2006 Nme of the student nd ID numer: Hourly Exm 2 Novemer 6, 2006 This is closed-ook closed-notes exm. Do ll your work on these sheets. If more spce is required,

More information

Markov Models & DNA Sequence Evolution

Markov Models & DNA Sequence Evolution 7.91 / 7.36 / BE.490 Lecture #5 Mar. 9, 2004 Markov Models & DNA Sequence Evolution Chris Burge Review of Markov & HMM Models for DNA Markov Models for splice sites Hidden Markov Models - looking under

More information

TIME AND STATE IN DISTRIBUTED SYSTEMS

TIME AND STATE IN DISTRIBUTED SYSTEMS Distriuted Systems Fö 5-1 Distriuted Systems Fö 5-2 TIME ND STTE IN DISTRIUTED SYSTEMS 1. Time in Distriuted Systems Time in Distriuted Systems euse eh mhine in distriuted system hs its own lok there is

More information

22.Analytical Techniques Chromatography

22.Analytical Techniques Chromatography .Anlytil Tehniques hromtogrphy hromtogrphy is n nlytil tehnique tht seprtes omponents in mixture etween moile phse nd sttionry phse. Types of hromtogrphy inlude: thin-lyer hromtogrphy (TL) plte is oted

More information

Lecture 15: Programming Example: TASEP

Lecture 15: Programming Example: TASEP Carl Kingsford, 0-0, Fall 0 Lecture : Programming Example: TASEP The goal for this lecture is to implement a reasonably large program from scratch. The task we will program is to simulate ribosomes moving

More information

VIBRATION ANALYSIS OF AN ISOLATED MASS WITH SIX DEGREES OF FREEDOM Revision G

VIBRATION ANALYSIS OF AN ISOLATED MASS WITH SIX DEGREES OF FREEDOM Revision G B Tom Irvine Emil: tom@virtiondt.om Jnur 8, 3 VIBRATION ANALYSIS OF AN ISOLATED MASS WITH SIX DEGREES OF FREEDOM Revision G Introdution An vionis omponent m e mounted with isoltor grommets, whih t s soft

More information

1/31/ :33 PM. Chapter 11. Kinematics of Particles. Mohammad Suliman Abuhaiba,Ph.D., P.E.

1/31/ :33 PM. Chapter 11. Kinematics of Particles. Mohammad Suliman Abuhaiba,Ph.D., P.E. 1/31/18 1:33 PM Chpter 11 Kinemtics of Prticles 1 1/31/18 1:33 PM First Em Sturdy 1//18 3 1/31/18 1:33 PM Introduction Mechnics Mechnics = science which describes nd predicts conditions of rest or motion

More information

MCH T 111 Handout Triangle Review Page 1 of 3

MCH T 111 Handout Triangle Review Page 1 of 3 Hnout Tringle Review Pge of 3 In the stuy of sttis, it is importnt tht you e le to solve lgeri equtions n tringle prolems using trigonometry. The following is review of trigonometry sis. Right Tringle:

More information

Analytical Techniques Chromatography

Analytical Techniques Chromatography Anlytil Tehniques hromtogrphy hromtogrphy is n nlytil tehnique tht seprtes omponents in mixture etween moile phse nd sttionry phse. Types of hromtogrphy inlude: thin-lyer hromtogrphy (TL) plte is oted

More information

1 PYTHAGORAS THEOREM 1. Given a right angled triangle, the square of the hypotenuse is equal to the sum of the squares of the other two sides.

1 PYTHAGORAS THEOREM 1. Given a right angled triangle, the square of the hypotenuse is equal to the sum of the squares of the other two sides. 1 PYTHAGORAS THEOREM 1 1 Pythgors Theorem In this setion we will present geometri proof of the fmous theorem of Pythgors. Given right ngled tringle, the squre of the hypotenuse is equl to the sum of the

More information

(h+ ) = 0, (3.1) s = s 0, (3.2)

(h+ ) = 0, (3.1) s = s 0, (3.2) Chpter 3 Nozzle Flow Qusistedy idel gs flow in pipes For the lrge vlues of the Reynolds number typilly found in nozzles, the flow is idel. For stedy opertion with negligible body fores the energy nd momentum

More information

Complex cellular logic computation using ribocomputing devices. Output signals. Output protein. Output gene Gene OFF. NOT logic.

Complex cellular logic computation using ribocomputing devices. Output signals. Output protein. Output gene Gene OFF. NOT logic. LETTER doi:1.138/nture23271 Complex ellulr logi omputtion using rioomputing devies lexnder. Green 1,2 *, Jongmin Kim 1,3 *, Duo M 2, Pmel. Silver 1,3, Jmes J. Collins 1,4,5 & Peng Yin 1,3 Syntheti iology

More information

Magnetically Coupled Coil

Magnetically Coupled Coil Mgnetilly Coupled Ciruits Overview Mutul Indutne Energy in Coupled Coils Liner Trnsformers Idel Trnsformers Portlnd Stte University ECE 22 Mgnetilly Coupled Ciruits Ver..3 Mgnetilly Coupled Coil i v L

More information

ENCAPSULATED BOBBINS. Low Profile N and U series for PCB mounting Precision Winding Lead in slots Strong termination geometry and pin retention

ENCAPSULATED BOBBINS. Low Profile N and U series for PCB mounting Precision Winding Lead in slots Strong termination geometry and pin retention ENCAPSULATED BOBBINS Low Profile N nd U series for PCB mounting Preision Winding Led in slots Strong termintion geometry nd pin retention Volume prodution pility High Performne enefits t ompetitive pries

More information

CS375: Logic and Theory of Computing

CS375: Logic and Theory of Computing CS375: Logic nd Theory of Computing Fuhu (Frnk) Cheng Deprtment of Computer Science University of Kentucky 1 Tle of Contents: Week 1: Preliminries (set lger, reltions, functions) (red Chpters 1-4) Weeks

More information

Generalization of 2-Corner Frequency Source Models Used in SMSIM

Generalization of 2-Corner Frequency Source Models Used in SMSIM Generliztion o 2-Corner Frequeny Soure Models Used in SMSIM Dvid M. Boore 26 Mrh 213, orreted Figure 1 nd 2 legends on 5 April 213, dditionl smll orretions on 29 My 213 Mny o the soure spetr models ville

More information

A DNA Sequence 2017/12/6 1

A DNA Sequence 2017/12/6 1 A DNA Sequence ccgtacgtacgtagagtgctagtctagtcgtagcgccgtagtcgatcgtgtgg gtagtagctgatatgatgcgaggtaggggataggatagcaacagatgagc ggatgctgagtgcagtggcatgcgatgtcgatgatagcggtaggtagacttc gcgcataaagctgcgcgagatgattgcaaagragttagatgagctgatgcta

More information

Particle Physics. Michaelmas Term 2011 Prof Mark Thomson. Handout 3 : Interaction by Particle Exchange and QED. Recap

Particle Physics. Michaelmas Term 2011 Prof Mark Thomson. Handout 3 : Interaction by Particle Exchange and QED. Recap Prtile Physis Mihelms Term 2011 Prof Mrk Thomson g X g X g g Hnout 3 : Intertion y Prtile Exhnge n QED Prof. M.A. Thomson Mihelms 2011 101 Rep Working towrs proper lultion of ey n sttering proesses lnitilly

More information

Series. Teacher. Fractions

Series. Teacher. Fractions Series E Teher Frtions Copyright 009 P Lerning. All rights reserved. First edition printed 009 in Austrli. A tlogue reord for this ook is ville from P Lerning Ltd. ISBN 97--90-9-0 Ownership of ontent The

More information

2/2/ :36 AM. Chapter 11. Kinematics of Particles. Mohammad Suliman Abuhaiba,Ph.D., P.E.

2/2/ :36 AM. Chapter 11. Kinematics of Particles. Mohammad Suliman Abuhaiba,Ph.D., P.E. //16 1:36 AM Chpter 11 Kinemtics of Prticles 1 //16 1:36 AM First Em Wednesdy 4//16 3 //16 1:36 AM Introduction Mechnics Mechnics = science which describes nd predicts the conditions of rest or motion

More information

2/20/ :21 AM. Chapter 11. Kinematics of Particles. Mohammad Suliman Abuhaiba,Ph.D., P.E.

2/20/ :21 AM. Chapter 11. Kinematics of Particles. Mohammad Suliman Abuhaiba,Ph.D., P.E. //15 11:1 M Chpter 11 Kinemtics of Prticles 1 //15 11:1 M Introduction Mechnics Mechnics = science which describes nd predicts the conditions of rest or motion of bodies under the ction of forces It is

More information

4-cyanopentanoic acid dithiobenzoate (CPADB) was synthesized as reported by Y.

4-cyanopentanoic acid dithiobenzoate (CPADB) was synthesized as reported by Y. Eletroni upplementry Mteril (EI) for Journl of Mterils Chemistry B This journl is The Royl oiety of Chemistry 2012 ynthesis of 4-ynopentnoi id dithioenzote (CPADB). 4-ynopentnoi id dithioenzote (CPADB)

More information

CRITICA: Coding Region Identification Tool Invoking Comparative Analysis

CRITICA: Coding Region Identification Tool Invoking Comparative Analysis CRITICA: Coding Region Identification Tool Invoking Comparative Analysis Jonathan H. Badger and Gary J. Olsen Department of Microbiology, University of Illinois Gene recognition is essential to understanding

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Synthesis of metl oxide with roomtemperture photoreversile phse trnsition Shin-ichi Ohkoshi 1 *, Yoshihide Tsunouchi, 1 Tomoyuki Mtsud, 1 Kzuhito Hshimoto, 2 Asuk Nmi, 1 Fumiyoshi

More information

Prefix-Free Regular-Expression Matching

Prefix-Free Regular-Expression Matching Prefix-Free Regulr-Expression Mthing Yo-Su Hn, Yjun Wng nd Derik Wood Deprtment of Computer Siene HKUST Prefix-Free Regulr-Expression Mthing p.1/15 Pttern Mthing Given pttern P nd text T, find ll sustrings

More information

Geometry of the Circle - Chords and Angles. Geometry of the Circle. Chord and Angles. Curriculum Ready ACMMG: 272.

Geometry of the Circle - Chords and Angles. Geometry of the Circle. Chord and Angles. Curriculum Ready ACMMG: 272. Geometry of the irle - hords nd ngles Geometry of the irle hord nd ngles urriulum Redy MMG: 272 www.mthletis.om hords nd ngles HRS N NGLES The irle is si shpe nd so it n e found lmost nywhere. This setion

More information

Graph Theory. Simple Graph G = (V, E). V={a,b,c,d,e,f,g,h,k} E={(a,b),(a,g),( a,h),(a,k),(b,c),(b,k),...,(h,k)}

Graph Theory. Simple Graph G = (V, E). V={a,b,c,d,e,f,g,h,k} E={(a,b),(a,g),( a,h),(a,k),(b,c),(b,k),...,(h,k)} Grph Theory Simple Grph G = (V, E). V ={verties}, E={eges}. h k g f e V={,,,,e,f,g,h,k} E={(,),(,g),(,h),(,k),(,),(,k),...,(h,k)} E =16. 1 Grph or Multi-Grph We llow loops n multiple eges. G = (V, E.ψ)

More information

COMPUTER SCIENCE TRIPOS

COMPUTER SCIENCE TRIPOS CST.2011.2.1 COMPUTER SCIENCE TRIPOS Prt IA Tuesdy 7 June 2011 1.30 to 4.30 COMPUTER SCIENCE Pper 2 Answer one question from ech of Sections A, B nd C, nd two questions from Section D. Submit the nswers

More information

Intensity transformations

Intensity transformations Intensity trnsformtions Stefno Ferrri Università degli Studi di Milno stefno.ferrri@unimi.it Methods for Imge Processing cdemic yer 2017 2018 Sptil domin The sptil domin of n imge is the plne tht contins

More information