Supplemental information. Supplementary_Fig_S1: Ribo-seq meta profiles at start and stop codons S. Typhimurium.
|
|
- Buck Tate
- 6 years ago
- Views:
Transcription
1 Supplementl informtion Pge 1 Supplementry_Fig_S1: Rio-seq met profiles t strt nd stop odons S. Typhimurium. 2 Supplementry_Fig_S2: Red length distriutions t Shine Dlgrno motifs. 3 Supplementry_Fig_S3: Codon speifi red length distriutions. 4 Supplementry_Fig_S4: Additionl predition support. 4 Supplementry_Fig_S5: Third odon periodiity nd GC ontent. 5 Supplementry_Fig_S6: Evidene for predited novel trnsltion initition sites. 5 Supplementry_Fig_S7: Rio-seq met profiles t strt odons E. oli. 6 Supplementry_Fig_S8: Lirry red length distriutions. 7 Supplementry_Fig_S9: Red length djustments. 7
2 d Supplementry_Fig_S1: Rio-seq met profiles t strt nd stop odons - S. Typhimurium Rio-seq met-profiles in windows round strt odons for nnotted genes (n=4205) in the S. Typhimurium genome, ontriutions from eh gene re sled to sum of one. (upper) Proportion of 5 or 3' rio-seq red ounts per nuleotide position, oloured y odon position. (lower) Hetmps of 5' or 3' rio-seq red ounts per length, oloured y z-sore per proteted red length. 2
3 Supplementry_Fig_S2: Red length distriutions t Shine Dlgrno motifs Rio-seq met-profiles in windows round shine dlgrno sequenes immeditely upstrem of TIS (n=736) or t internl CDS positions (n=8564) in the S. Typhimurium genome, ontriutions from eh motif window re sled to sum of one. Brhrts show the proportion of 5 or 3' rio-seq red ounts per nuleotide position, oloured y odon position. Hetmps show 5' or 3' rio-seq red ounts per length, oloured y z-sore per red length. () In reltion to SD motifs upstrem of initition odons. () In reltion to internl SD motifs within CDS regions. () In reltion to SD motifs upstrem of initition odons, feted y distne etween the SD motif nd initition odon (nt). 3
4 Supplementry_Fig_S3: Codon speifi red length distriutions. S. typhimurium rio-seq met-profiles in windows round the most ommonly used trnsltion initition odons t internl, in-frme CDS positions. Contriutions from eh odon window re sled to sum of one. (upper) Proportion of 5 or 3' rio-seq red ounts per nuleotide position, oloured y odon position. (lower) Hetmps of 5' or 3' rio-seq red ounts per frgment length, oloured y z-sore per red length. () ATG odons (n=35531). () GTG odons (n=35117). () TTG odons (n=17647). Supplementry_Fig_S4: Additionl predition support 4 () Showing the similrity in usge of different strt odons etween nnotted (n=4653) nd predited (n=4334) S. Typhimurium ORFs. (). Met plots showing the proportion of sled 5' rio-seq red ounts in reltion to nnotted or predited trnsltion initition sites, for ORFs mthing nnotted genes (n=3853), predited s extensions (n=214) or predited s truntions (n=205), in the S. Typhimurium dtset. Contriutions from eh gene re sled to sum of one. Nuleotide positions re oloured y odon position. Upstrem regions re highlighted in pink, downstrem regions re highlighted in light lue.
5 Supplementry_Fig_S5: Third odon periodiity nd GC ontent. () Proportion of 3' rio-seq red ounts per nuleotide position, from positions nt downstrem of the nnotted strt odon in the S. Typhimurium genome, oloured y odon position. Contriutions from eh gene re sled to sum of one. (upper) the highest 10% of regions y third odon GC ontent (n=467). (lower) the ottom 10% of regions y third odon GC ontent (n=468). () fourier trnsform showing the periodiity in the distriutions of (). Supplementry_Fig_S6: Evidene for predited novel trnsltion initition sites. () Sequene motifs reltion to predited trnsltion initition sites (n=61), for sequenes in ll novel predited ORFs in the S. Typhimurium dtset. (B) Met-profiles in reltion to nnotted (n=3853) or predited trnsltion initition sites. Blk dotted lines representing ORFs mthing nnotted genes, grey lines represent novel preditions. (upper) Met-profiles showing the perentge of GC ontent verged in 9nt sliding windows, higher vlues downstrem of the odon region re inditive of oding potentil. (lower) Met-profiles of free energy verged in 39nt sliding windows, higher vlues represent lower potentil for seondry struture formtion. 5
6 d e f Supplementry_Fig_S7: Rio-seq met profiles t strt odons - E. Coli Rio-seq met-profiles in windows round strt odons for nnotted genes (n=3726) in the E. oli genome, ontriutions from eh gene re sled to sum of one. (upper) Proportion of 5 or 3' rio-seq red ounts per nuleotide position, oloured y odon position. (lower) Hetmps of 5' or 3' rio-seq red length ounts, oloured y z-sore per red length. 6
7 Supplementry_Fig_S8: Lirry red length distriutions Red length distriutions of solute () or proportionl () ounts of ligned rio-seq reds per lirry. 7 Supplementry_Fig_S9: Red lengths djustments The sum of sled 5' rio-seq ounts from the () monosome or () polysome replite, in -30 to +60nt windows round nnotted strt odons (n=4205) in S. Typhimurium, per red length, oloured y odon position. Contriutions from eh gene re sled to sum of one. Blue rrows indite the pek orresponding to rio-seq footprints trnslting the strt odon.
Global alignment. Genome Rearrangements Finding preserved genes. Lecture 18
Computt onl Biology Leture 18 Genome Rerrngements Finding preserved genes We hve seen before how to rerrnge genome to obtin nother one bsed on: Reversls Knowledge of preserved bloks (or genes) Now we re
More informationInstructions. An 8.5 x 11 Cheat Sheet may also be used as an aid for this test. MUST be original handwriting.
ID: B CSE 2021 Computer Orgniztion Midterm Test (Fll 2009) Instrutions This is losed ook, 80 minutes exm. The MIPS referene sheet my e used s n id for this test. An 8.5 x 11 Chet Sheet my lso e used s
More informationRibosome signatures aid bacterial translation initiation site identification
Giess et al. BMC Biology (2017) 15:76 DOI 10.1186/s12915-017-0416-0 RESEARCH ARTICLE Ribosome signatures aid bacterial translation initiation site identification Adam Giess 1, Veronique Jonckheere 2,3,
More informationIntroduction to Bioinformatics
Introdution to Bioinformtis Outline } Method without onsidering bkground distribution } Generl pproh onsidering bkground distribution } Wys to speed up the lgorithm Trnsription Ftor Binding Sites (TFBSs)
More informationb a wt ccd8 dad2 Secondary branches 15 e cd normal low b 2
A 3 1 Shoot mss (g) B Root mss (g) C 8 Primry rnhes D 8 Seonry rnhes 1 e E 8 Shoot mss/rnhes norml low 1 F 8 8 Shoot mss/root mss 8 8 Supplementl Figure 1 Aitionl phenotypi t reore from the plnts esrie
More information, g. Exercise 1. Generator polynomials of a convolutional code, given in binary form, are g. Solution 1.
Exerise Genertor polynomils of onvolutionl ode, given in binry form, re g, g j g. ) Sketh the enoding iruit. b) Sketh the stte digrm. ) Find the trnsfer funtion T. d) Wht is the minimum free distne of
More informationComputational Biology Lecture 18: Genome rearrangements, finding maximal matches Saad Mneimneh
Computtionl Biology Leture 8: Genome rerrngements, finding miml mthes Sd Mneimneh We hve seen how to rerrnge genome to otin nother one sed on reversls nd the knowledge of the preserved loks or genes. Now
More informationPeriodic string comparison
Periodi string omprison Alexnder Tiskin Deprtment of Computer Siene University of Wrwik http://www.ds.wrwik..uk/~tiskin Alexnder Tiskin (Wrwik) Periodi string omprison 1 / 51 1 Introdution 2 Semi-lol string
More informationSemantic Analysis. CSCI 3136 Principles of Programming Languages. Faculty of Computer Science Dalhousie University. Winter Reading: Chapter 4
Semnti nlysis SI 16 Priniples of Progrmming Lnguges Fulty of omputer Siene Dlhousie University Winter 2012 Reding: hpter 4 Motivtion Soure progrm (hrter strem) Snner (lexil nlysis) Front end Prse tree
More informationMotifs and Logos. Six Introduction to Bioinformatics. Importance and Abundance of Motifs. Getting the CDS. From DNA to Protein 6.1.
Motifs and Logos Six Discovering Genomics, Proteomics, and Bioinformatics by A. Malcolm Campbell and Laurie J. Heyer Chapter 2 Genome Sequence Acquisition and Analysis Sami Khuri Department of Computer
More information6.3.2 Spectroscopy. N Goalby chemrevise.org 1 NO 2 H 3 CH3 C. NMR spectroscopy. Different types of NMR
6.. Spetrosopy NMR spetrosopy Different types of NMR NMR spetrosopy involves intertion of mterils with the lowenergy rdiowve region of the eletromgneti spetrum NMR spetrosopy is the sme tehnology s tht
More information1 This diagram represents the energy change that occurs when a d electron in a transition metal ion is excited by visible light.
1 This igrm represents the energy hnge tht ours when eletron in trnsition metl ion is exite y visile light. Give the eqution tht reltes the energy hnge ΔE to the Plnk onstnt, h, n the frequeny, v, of the
More informationSUPPLEMENTARY INFORMATION
doi:.38/nture8499 doi:.38/nture8499 5 6 5 4.5 Firing rte (Hz) -67-65 -66-6 -58 V m (mv) -7-67 -68-66 -64 c Thet power (mv ) -73-69 -7-7 -7.5.8 3....9.9.4.6.6. 9 8 9 8 9 8 9 8 9 8 Supplementry Figure Firing
More informationLearning Partially Observable Markov Models from First Passage Times
Lerning Prtilly Oservle Mrkov s from First Pssge s Jérôme Cllut nd Pierre Dupont Europen Conferene on Mhine Lerning (ECML) 8 Septemer 7 Outline. FPT in models nd sequenes. Prtilly Oservle Mrkov s (POMMs).
More informationSEMANTIC ANALYSIS PRINCIPLES OF PROGRAMMING LANGUAGES. Norbert Zeh Winter Dalhousie University 1/28
SEMNTI NLYSIS PRINIPLES OF PROGRMMING LNGUGES Norbert Zeh Winter 2018 Dlhousie University 1/28 PROGRM TRNSLTION FLOW HRT Soure progrm (hrter strem) Snner (lexil nlysis) Front end Prse tree Prser (syntti
More informationEnergy Bands Energy Bands and Band Gap. Phys463.nb Phenomenon
Phys463.nb 49 7 Energy Bnds Ref: textbook, Chpter 7 Q: Why re there insultors nd conductors? Q: Wht will hppen when n electron moves in crystl? In the previous chpter, we discussed free electron gses,
More information22: Union Find. CS 473u - Algorithms - Spring April 14, We want to maintain a collection of sets, under the operations of:
22: Union Fin CS 473u - Algorithms - Spring 2005 April 14, 2005 1 Union-Fin We wnt to mintin olletion of sets, uner the opertions of: 1. MkeSet(x) - rete set tht ontins the single element x. 2. Fin(x)
More informationInstructions to students: Use your Text Book and attempt these questions.
Instrutions to students: Use your Text Book nd ttempt these questions. Due Dte: 16-09-2018 Unit 2 Chpter 8 Test Slrs nd vetors Totl mrks 50 Nme: Clss: Dte: Setion A Selet the est nswer for eh question.
More informationData Structures and Algorithm. Xiaoqing Zheng
Dt Strutures nd Algorithm Xioqing Zheng zhengxq@fudn.edu.n String mthing prolem Pttern P ours with shift s in text T (or, equivlently, tht pttern P ours eginning t position s + in text T) if T[s +... s
More informationPythagoras Theorem. The area of the square on the hypotenuse is equal to the sum of the squares on the other two sides
Pythgors theorem nd trigonometry Pythgors Theorem The hypotenuse of right-ngled tringle is the longest side The hypotenuse is lwys opposite the right-ngle 2 = 2 + 2 or 2 = 2-2 or 2 = 2-2 The re of the
More informationAutomatic Synthesis of New Behaviors from a Library of Available Behaviors
Automti Synthesis of New Behviors from Lirry of Aville Behviors Giuseppe De Giomo Università di Rom L Spienz, Rom, Itly degiomo@dis.unirom1.it Sestin Srdin RMIT University, Melourne, Austrli ssrdin@s.rmit.edu.u
More informationThermodynamics. Question 1. Question 2. Question 3 3/10/2010. Practice Questions PV TR PV T R
/10/010 Question 1 1 mole of idel gs is rought to finl stte F y one of three proesses tht hve different initil sttes s shown in the figure. Wht is true for the temperture hnge etween initil nd finl sttes?
More informationApril 8, 2017 Math 9. Geometry. Solving vector problems. Problem. Prove that if vectors and satisfy, then.
pril 8, 2017 Mth 9 Geometry Solving vetor prolems Prolem Prove tht if vetors nd stisfy, then Solution 1 onsider the vetor ddition prllelogrm shown in the Figure Sine its digonls hve equl length,, the prllelogrm
More informationILLUSTRATING THE EXTENSION OF A SPECIAL PROPERTY OF CUBIC POLYNOMIALS TO NTH DEGREE POLYNOMIALS
ILLUSTRATING THE EXTENSION OF A SPECIAL PROPERTY OF CUBIC POLYNOMIALS TO NTH DEGREE POLYNOMIALS Dvid Miller West Virgini University P.O. BOX 6310 30 Armstrong Hll Morgntown, WV 6506 millerd@mth.wvu.edu
More informationa cacnb1 ts25/ts25 Supplemental Figure 1
ccn1 ts/ts α -ungrotoxin prlyzed 0.6 ΔF/F 0.0 2 ΔF/F 2 s stimulus α -ungrotoxin ccn1 ts/ts Supplementl Figure 1 CSF-cNs recorded from lrv prlyzed with α-ungrotoxin nd ccn1 mutnt lrv show no difference
More informationRegular languages refresher
Regulr lnguges refresher 1 Regulr lnguges refresher Forml lnguges Alphet = finite set of letters Word = sequene of letter Lnguge = set of words Regulr lnguges defined equivlently y Regulr expressions Finite-stte
More informationAlpha Algorithm: A Process Discovery Algorithm
Proess Mining: Dt Siene in Ation Alph Algorithm: A Proess Disovery Algorithm prof.dr.ir. Wil vn der Alst www.proessmining.org Proess disovery = Ply-In Ply-In event log proess model Ply-Out Reply proess
More informationTechnische Universität München Winter term 2009/10 I7 Prof. J. Esparza / J. Křetínský / M. Luttenberger 11. Februar Solution
Tehnishe Universität Münhen Winter term 29/ I7 Prof. J. Esprz / J. Křetínský / M. Luttenerger. Ferur 2 Solution Automt nd Forml Lnguges Homework 2 Due 5..29. Exerise 2. Let A e the following finite utomton:
More informationThe University of Nottingham SCHOOL OF COMPUTER SCIENCE A LEVEL 2 MODULE, SPRING SEMESTER MACHINES AND THEIR LANGUAGES ANSWERS
The University of ottinghm SCHOOL OF COMPUTR SCIC A LVL 2 MODUL, SPRIG SMSTR 2015 2016 MACHIS AD THIR LAGUAGS ASWRS Time llowed TWO hours Cndidtes my omplete the front over of their nswer ook nd sign their
More informationNondeterministic Finite Automata
Nondeterministi Finite utomt The Power of Guessing Tuesdy, Otoer 4, 2 Reding: Sipser.2 (first prt); Stoughton 3.3 3.5 S235 Lnguges nd utomt eprtment of omputer Siene Wellesley ollege Finite utomton (F)
More informationOutline. Theory-based Bayesian framework for property induction Causal structure induction
Outline Theory-sed Byesin frmework for property indution Cusl struture indution Constrint-sed (ottom-up) lerning Theory-sed Byesin lerning The origins of usl knowledge Question: how do people relily ome
More informationCompiler Design. Spring Lexical Analysis. Sample Exercises and Solutions. Prof. Pedro C. Diniz
University of Southern Cliforni Computer Siene Deprtment Compiler Design Spring 7 Lexil Anlysis Smple Exerises nd Solutions Prof. Pedro C. Diniz USC / Informtion Sienes Institute 47 Admirlty Wy, Suite
More informationLing 3701H / Psych 3371H: Lecture Notes 9 Hierarchic Sequential Prediction
Ling 3701H / Psyh 3371H: Leture Notes 9 Hierrhi Sequentil Predition Contents 9.1 Complex events.................................... 1 9.2 Reognition of omplex events using event frgments................
More informationTremor-rich shallow dyke formation followed by silent magma flow at Bárðarbunga in Iceland
In the formt provided y the uthors nd unedited. SUPPLEMENTARY INFORMATION DOI: 1.138/NGEO9 Tremor-rich shllow dyke formtion followed y silent mgm flow t Bárðrung in Icelnd 1,, 1, 3 1, 1 1, NATURE GEOSCIENCE
More informationSupplementary Figure 1
Supplementry Figure (nesthetized) (wke) Normlized mplitude.5 Pek width (ms).6.4.2 4 2 2 x 3 Wveform slope Normlized mplitude.5 Pek width (ms).6.4.2 x 3 3 2 Wveform slope c (nesthetized) d (wke) Normlized
More informationSubsumption of Vertical Viewpoint Patterns
Susumption of Vertil Viewpoint Ptterns Mthieu Bergeron 1 nd Drrell Conklin 2 1 CIRMMT, MGill University, Montrel, Cnd mthieu.ergeron@mil.mgill. 2 Deprtment of Computer Siene nd AI Universidd del Pís Vso,
More informationFunctions. mjarrar Watch this lecture and download the slides
9/6/7 Mustf Jrrr: Leture Notes in Disrete Mthemtis. Birzeit University Plestine 05 Funtions 7.. Introdution to Funtions 7. One-to-One Onto Inverse funtions mjrrr 05 Wth this leture nd downlod the slides
More informationGM1 Consolidation Worksheet
Cmridge Essentils Mthemtis Core 8 GM1 Consolidtion Worksheet GM1 Consolidtion Worksheet 1 Clulte the size of eh ngle mrked y letter. Give resons for your nswers. or exmple, ngles on stright line dd up
More informationSection 7.2 Velocity. Solution
Section 7.2 Velocity In the previous chpter, we showed tht velocity is vector becuse it hd both mgnitude (speed) nd direction. In this section, we will demonstrte how two velocities cn be combined to determine
More informationSTRAND J: TRANSFORMATIONS, VECTORS and MATRICES
Mthemtics SKE: STRN J STRN J: TRNSFORMTIONS, VETORS nd MTRIES J3 Vectors Text ontents Section J3.1 Vectors nd Sclrs * J3. Vectors nd Geometry Mthemtics SKE: STRN J J3 Vectors J3.1 Vectors nd Sclrs Vectors
More informationCS311 Computational Structures Regular Languages and Regular Grammars. Lecture 6
CS311 Computtionl Strutures Regulr Lnguges nd Regulr Grmmrs Leture 6 1 Wht we know so fr: RLs re losed under produt, union nd * Every RL n e written s RE, nd every RE represents RL Every RL n e reognized
More information6.3.2 Spectroscopy. N Goalby chemrevise.org 1 NO 2 CH 3. CH 3 C a. NMR spectroscopy. Different types of NMR
6.. Spetrosopy NMR spetrosopy Different types of NMR NMR spetrosopy involves intertion of mterils with the lowenergy rdiowve region of the eletromgneti spetrum NMR spetrosopy is the sme tehnology s tht
More informationDiscrete Structures, Test 2 Monday, March 28, 2016 SOLUTIONS, VERSION α
Disrete Strutures, Test 2 Mondy, Mrh 28, 2016 SOLUTIONS, VERSION α α 1. (18 pts) Short nswer. Put your nswer in the ox. No prtil redit. () Consider the reltion R on {,,, d with mtrix digrph of R.. Drw
More informationSystem Validation (IN4387) November 2, 2012, 14:00-17:00
System Vlidtion (IN4387) Novemer 2, 2012, 14:00-17:00 Importnt Notes. The exmintion omprises 5 question in 4 pges. Give omplete explntion nd do not onfine yourself to giving the finl nswer. Good luk! Exerise
More informationSupporting Information for. Initial Biochemical and Functional Evaluation of Murine Calprotectin Reveals Ca(II)-
Supporting Information for Initial Biochemical and Functional Evaluation of Murine Calprotectin Reveals Ca(II)- Dependence and Its Ability to Chelate Multiple Nutrient Transition Metal Ions Rose C. Hadley,
More informationCS 2204 DIGITAL LOGIC & STATE MACHINE DESIGN SPRING 2014
S 224 DIGITAL LOGI & STATE MAHINE DESIGN SPRING 214 DUE : Mrh 27, 214 HOMEWORK III READ : Relte portions of hpters VII n VIII ASSIGNMENT : There re three questions. Solve ll homework n exm prolems s shown
More informationEmission of K -, L - and M - Auger Electrons from Cu Atoms. Abstract
Emission of K -, L - nd M - uger Electrons from Cu toms Mohmed ssd bdel-rouf Physics Deprtment, Science College, UEU, l in 17551, United rb Emirtes ssd@ueu.c.e bstrct The emission of uger electrons from
More informationHPLP310 Biblio_35 Fissures radial intern in a thick cylinder under pressure and thermal loading
defult Titre : HPLP310 - Biblio_35 Fissure rdile interne dns u[...] Dte : 0/09/011 Pge : 1/15 Responsble : TRAN Vn Xun Clé : V7.0.310 Révision : HPLP310 Biblio_35 Fissures rdil intern in thick cylinder
More informationFigure S1: Similar to Fig. 2D in paper, but using Euclidean distance instead of Spearman distance.
Supplementary analysis 1: Euclidean distance in the RESS As shown in Fig. S1, Euclidean distance did not adequately distinguish between pairs of random sequence and pairs of structurally-related sequence.
More informationTitle of file for HTML: Supplementary Information Description: Supplementary Figures. Title of file for HTML: Peer Review File Description:
Title of file for HTML: Supplementry Informtion Description: Supplementry Figures Title of file for HTML: Peer Review File Description: WTP SST IPO PDO WTP leds IPO PDO Supplementry Figure 1 IPO (or PDO)
More informationIdentification of an OPR3-independent pathway for jasmonate biosynthesis. Department of Plant Molecular Genetics, National Centre for Biotechnology,
Supplementry Informtion Identifition of n OPR3-independent pthwy for jsmonte iosynthesis Andre Chini 1, Isel Monte 1, Angel M. Zmrreño 2, Mts Hmerg 3, Steve Lssueur 4, Philippe Reymond 4, Slly Weiss 5,
More informationH 4 H 8 N 2. Example 1 A compound is found to have an accurate relative formula mass of It is thought to be either CH 3.
. Spetrosopy Mss spetrosopy igh resolution mss spetrometry n e used to determine the moleulr formul of ompound from the urte mss of the moleulr ion For exmple, the following moleulr formuls ll hve rough
More informationSolids of Revolution
Solis of Revolution Solis of revolution re rete tking n re n revolving it roun n is of rottion. There re two methos to etermine the volume of the soli of revolution: the isk metho n the shell metho. Disk
More information12.1 Introduction to Rational Expressions
. Introduction to Rtionl Epressions A rtionl epression is rtio of polynomils; tht is, frction tht hs polynomil s numertor nd/or denomintor. Smple rtionl epressions: 0 EVALUATING RATIONAL EXPRESSIONS To
More informationComparing the Pre-image and Image of a Dilation
hpter Summry Key Terms Postultes nd Theorems similr tringles (.1) inluded ngle (.2) inluded side (.2) geometri men (.) indiret mesurement (.6) ngle-ngle Similrity Theorem (.2) Side-Side-Side Similrity
More informationH (2a, a) (u 2a) 2 (E) Show that u v 4a. Explain why this implies that u v 4a, with equality if and only u a if u v 2a.
Chpter Review 89 IGURE ol hord GH of the prol 4. G u v H (, ) (A) Use the distne formul to show tht u. (B) Show tht G nd H lie on the line m, where m ( )/( ). (C) Solve m for nd sustitute in 4, otining
More informationJournal of Chemical and Pharmaceutical Research, 2013, 5(12): Research Article
Avilble online www.jopr.om Journl of Chemil nd Phrmeutil Reserh, 2013, 5(12):1283-1288 Reserh Artile ISSN : 0975-7384 CODEN(USA) : JCPRC5 Study on osion resistne of zin lloy oting of mehnil plting by eletrohemil
More informationActivities. 4.1 Pythagoras' Theorem 4.2 Spirals 4.3 Clinometers 4.4 Radar 4.5 Posting Parcels 4.6 Interlocking Pipes 4.7 Sine Rule Notes and Solutions
MEP: Demonstrtion Projet UNIT 4: Trigonometry UNIT 4 Trigonometry tivities tivities 4. Pythgors' Theorem 4.2 Spirls 4.3 linometers 4.4 Rdr 4.5 Posting Prels 4.6 Interloking Pipes 4.7 Sine Rule Notes nd
More informationH SERIES. Algebra Basics. Algebra Basics. Solutions. Curriculum Ready.
Alger Bsis H SERIES Alger Bsis Curriulum Rey www.mthletis.om Copyright 009 P Lerning. All rights reserve. First eition printe 009 in Austrli. A tlogue reor for this ook is ville from P Lerning Lt. ISBN
More informationGene Structure & Gene Finding
Gene Structure & Gene Finding David Wishart Rm. 3-41 Athabasca Hall david.wishart@ualberta.ca Outline for Next 3 Weeks Genes and Gene Finding (Prokaryotes) Genes and Gene Finding (Eukaryotes) Genome and
More informationSequence Cartridge Valves
Sequene Vlves Type Pge Pilot Operted, lned Piston Diret ting with Reverse Flow Chek 7 Kik-down, Pilot Operted, lned Piston ir Controlled, Pilot Operted, lned Piston 9 Diret ting without Reverse Flow Chek
More informationWhat else can you do?
Wht else cn you do? ngle sums The size of specil ngle types lernt erlier cn e used to find unknown ngles. tht form stright line dd to 180c. lculte the size of + M, if L is stright line M + L = 180c( stright
More informationFormation of hard very high energy gamma-ray spectra of blazars due to internal photon photon absorption
Mon. Not. R. Astron. So. 387, 1206 1214 (2008) doi:10.1111/j.1365-2966.2008.13315.x Formtion of hrd very high energy gmm-ry spetr of lzrs due to internl photon photon sorption Felix A. Ahronin, 1,2 D.
More informationPattern Recognition 2015 Neural Networks (2)
Pttern Reognition 2015 Nerl Networks (2) Ad Feelders Universiteit Utreht Ad Feelders ( Universiteit Utreht ) Pttern Reognition 1 / 37 Error k-propgtion How to ompte the weights in nerl network? Evlte derivtives
More informationExpanded View Figures
Molecular Systems iology Evolutionary divergence of mouse P Mei-Sheng Xiao et al Expanded View Figures Nucleotide percentage (%) 0 20 40 60 80 100 T G Nucleotide percentage (%) 0 20 40 60 80 100 T G Frequency
More informationSupplementary Information to The role of endogenous and exogenous mechanisms in the formation of R&D networks
Supplementry Informtion to The role of endogenous nd exogenous mechnisms in the formtion of R&D networks Mrio V. Tomsello 1, Nicol Perr 2, Cludio J. Tessone 1, Márton Krsi 3, nd Frnk Schweitzer 1 1 Chir
More informationSupplementary Information
Supplementary Information 1 List of Figures 1 Models of circular chromosomes. 2 Distribution of distances between core genes in Escherichia coli K12, arc based model. 3 Distribution of distances between
More informationAlpha Algorithm: Limitations
Proess Mining: Dt Siene in Ation Alph Algorithm: Limittions prof.dr.ir. Wil vn der Alst www.proessmining.org Let L e n event log over T. α(l) is defined s follows. 1. T L = { t T σ L t σ}, 2. T I = { t
More informationMinnesota State University, Mankato 44 th Annual High School Mathematics Contest April 12, 2017
Minnesot Stte University, Mnkto 44 th Annul High School Mthemtics Contest April, 07. A 5 ft. ldder is plced ginst verticl wll of uilding. The foot of the ldder rests on the floor nd is 7 ft. from the wll.
More informationarxiv: v1 [cond-mat.mtrl-sci] 10 Aug 2017
rxiv:178.313v1 [ond-mt.mtrl-si] 1 Aug 217 Knowledge-Trnsfer sed Cost-effetive Serh for Interfe Strutures: A Cse Study on f-al [11] Tilt Grin Boundry Tomohiro Yonezu 1, Tomoyuki Tmur 2,3, Ihiro Tkeuhi 1,3,
More informationAlgorithm Design and Analysis
Algorithm Design nd Anlysis LECTURE 8 Mx. lteness ont d Optiml Ching Adm Smith 9/12/2008 A. Smith; sed on slides y E. Demine, C. Leiserson, S. Rskhodnikov, K. Wyne Sheduling to Minimizing Lteness Minimizing
More information332:221 Principles of Electrical Engineering I Fall Hourly Exam 2 November 6, 2006
2:221 Principles of Electricl Engineering I Fll 2006 Nme of the student nd ID numer: Hourly Exm 2 Novemer 6, 2006 This is closed-ook closed-notes exm. Do ll your work on these sheets. If more spce is required,
More informationMarkov Models & DNA Sequence Evolution
7.91 / 7.36 / BE.490 Lecture #5 Mar. 9, 2004 Markov Models & DNA Sequence Evolution Chris Burge Review of Markov & HMM Models for DNA Markov Models for splice sites Hidden Markov Models - looking under
More informationTIME AND STATE IN DISTRIBUTED SYSTEMS
Distriuted Systems Fö 5-1 Distriuted Systems Fö 5-2 TIME ND STTE IN DISTRIUTED SYSTEMS 1. Time in Distriuted Systems Time in Distriuted Systems euse eh mhine in distriuted system hs its own lok there is
More information22.Analytical Techniques Chromatography
.Anlytil Tehniques hromtogrphy hromtogrphy is n nlytil tehnique tht seprtes omponents in mixture etween moile phse nd sttionry phse. Types of hromtogrphy inlude: thin-lyer hromtogrphy (TL) plte is oted
More informationLecture 15: Programming Example: TASEP
Carl Kingsford, 0-0, Fall 0 Lecture : Programming Example: TASEP The goal for this lecture is to implement a reasonably large program from scratch. The task we will program is to simulate ribosomes moving
More informationVIBRATION ANALYSIS OF AN ISOLATED MASS WITH SIX DEGREES OF FREEDOM Revision G
B Tom Irvine Emil: tom@virtiondt.om Jnur 8, 3 VIBRATION ANALYSIS OF AN ISOLATED MASS WITH SIX DEGREES OF FREEDOM Revision G Introdution An vionis omponent m e mounted with isoltor grommets, whih t s soft
More information1/31/ :33 PM. Chapter 11. Kinematics of Particles. Mohammad Suliman Abuhaiba,Ph.D., P.E.
1/31/18 1:33 PM Chpter 11 Kinemtics of Prticles 1 1/31/18 1:33 PM First Em Sturdy 1//18 3 1/31/18 1:33 PM Introduction Mechnics Mechnics = science which describes nd predicts conditions of rest or motion
More informationMCH T 111 Handout Triangle Review Page 1 of 3
Hnout Tringle Review Pge of 3 In the stuy of sttis, it is importnt tht you e le to solve lgeri equtions n tringle prolems using trigonometry. The following is review of trigonometry sis. Right Tringle:
More informationAnalytical Techniques Chromatography
Anlytil Tehniques hromtogrphy hromtogrphy is n nlytil tehnique tht seprtes omponents in mixture etween moile phse nd sttionry phse. Types of hromtogrphy inlude: thin-lyer hromtogrphy (TL) plte is oted
More information1 PYTHAGORAS THEOREM 1. Given a right angled triangle, the square of the hypotenuse is equal to the sum of the squares of the other two sides.
1 PYTHAGORAS THEOREM 1 1 Pythgors Theorem In this setion we will present geometri proof of the fmous theorem of Pythgors. Given right ngled tringle, the squre of the hypotenuse is equl to the sum of the
More information(h+ ) = 0, (3.1) s = s 0, (3.2)
Chpter 3 Nozzle Flow Qusistedy idel gs flow in pipes For the lrge vlues of the Reynolds number typilly found in nozzles, the flow is idel. For stedy opertion with negligible body fores the energy nd momentum
More informationComplex cellular logic computation using ribocomputing devices. Output signals. Output protein. Output gene Gene OFF. NOT logic.
LETTER doi:1.138/nture23271 Complex ellulr logi omputtion using rioomputing devies lexnder. Green 1,2 *, Jongmin Kim 1,3 *, Duo M 2, Pmel. Silver 1,3, Jmes J. Collins 1,4,5 & Peng Yin 1,3 Syntheti iology
More informationMagnetically Coupled Coil
Mgnetilly Coupled Ciruits Overview Mutul Indutne Energy in Coupled Coils Liner Trnsformers Idel Trnsformers Portlnd Stte University ECE 22 Mgnetilly Coupled Ciruits Ver..3 Mgnetilly Coupled Coil i v L
More informationENCAPSULATED BOBBINS. Low Profile N and U series for PCB mounting Precision Winding Lead in slots Strong termination geometry and pin retention
ENCAPSULATED BOBBINS Low Profile N nd U series for PCB mounting Preision Winding Led in slots Strong termintion geometry nd pin retention Volume prodution pility High Performne enefits t ompetitive pries
More informationCS375: Logic and Theory of Computing
CS375: Logic nd Theory of Computing Fuhu (Frnk) Cheng Deprtment of Computer Science University of Kentucky 1 Tle of Contents: Week 1: Preliminries (set lger, reltions, functions) (red Chpters 1-4) Weeks
More informationGeneralization of 2-Corner Frequency Source Models Used in SMSIM
Generliztion o 2-Corner Frequeny Soure Models Used in SMSIM Dvid M. Boore 26 Mrh 213, orreted Figure 1 nd 2 legends on 5 April 213, dditionl smll orretions on 29 My 213 Mny o the soure spetr models ville
More informationA DNA Sequence 2017/12/6 1
A DNA Sequence ccgtacgtacgtagagtgctagtctagtcgtagcgccgtagtcgatcgtgtgg gtagtagctgatatgatgcgaggtaggggataggatagcaacagatgagc ggatgctgagtgcagtggcatgcgatgtcgatgatagcggtaggtagacttc gcgcataaagctgcgcgagatgattgcaaagragttagatgagctgatgcta
More informationParticle Physics. Michaelmas Term 2011 Prof Mark Thomson. Handout 3 : Interaction by Particle Exchange and QED. Recap
Prtile Physis Mihelms Term 2011 Prof Mrk Thomson g X g X g g Hnout 3 : Intertion y Prtile Exhnge n QED Prof. M.A. Thomson Mihelms 2011 101 Rep Working towrs proper lultion of ey n sttering proesses lnitilly
More informationSeries. Teacher. Fractions
Series E Teher Frtions Copyright 009 P Lerning. All rights reserved. First edition printed 009 in Austrli. A tlogue reord for this ook is ville from P Lerning Ltd. ISBN 97--90-9-0 Ownership of ontent The
More information2/2/ :36 AM. Chapter 11. Kinematics of Particles. Mohammad Suliman Abuhaiba,Ph.D., P.E.
//16 1:36 AM Chpter 11 Kinemtics of Prticles 1 //16 1:36 AM First Em Wednesdy 4//16 3 //16 1:36 AM Introduction Mechnics Mechnics = science which describes nd predicts the conditions of rest or motion
More information2/20/ :21 AM. Chapter 11. Kinematics of Particles. Mohammad Suliman Abuhaiba,Ph.D., P.E.
//15 11:1 M Chpter 11 Kinemtics of Prticles 1 //15 11:1 M Introduction Mechnics Mechnics = science which describes nd predicts the conditions of rest or motion of bodies under the ction of forces It is
More information4-cyanopentanoic acid dithiobenzoate (CPADB) was synthesized as reported by Y.
Eletroni upplementry Mteril (EI) for Journl of Mterils Chemistry B This journl is The Royl oiety of Chemistry 2012 ynthesis of 4-ynopentnoi id dithioenzote (CPADB). 4-ynopentnoi id dithioenzote (CPADB)
More informationCRITICA: Coding Region Identification Tool Invoking Comparative Analysis
CRITICA: Coding Region Identification Tool Invoking Comparative Analysis Jonathan H. Badger and Gary J. Olsen Department of Microbiology, University of Illinois Gene recognition is essential to understanding
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Synthesis of metl oxide with roomtemperture photoreversile phse trnsition Shin-ichi Ohkoshi 1 *, Yoshihide Tsunouchi, 1 Tomoyuki Mtsud, 1 Kzuhito Hshimoto, 2 Asuk Nmi, 1 Fumiyoshi
More informationPrefix-Free Regular-Expression Matching
Prefix-Free Regulr-Expression Mthing Yo-Su Hn, Yjun Wng nd Derik Wood Deprtment of Computer Siene HKUST Prefix-Free Regulr-Expression Mthing p.1/15 Pttern Mthing Given pttern P nd text T, find ll sustrings
More informationGeometry of the Circle - Chords and Angles. Geometry of the Circle. Chord and Angles. Curriculum Ready ACMMG: 272.
Geometry of the irle - hords nd ngles Geometry of the irle hord nd ngles urriulum Redy MMG: 272 www.mthletis.om hords nd ngles HRS N NGLES The irle is si shpe nd so it n e found lmost nywhere. This setion
More informationGraph Theory. Simple Graph G = (V, E). V={a,b,c,d,e,f,g,h,k} E={(a,b),(a,g),( a,h),(a,k),(b,c),(b,k),...,(h,k)}
Grph Theory Simple Grph G = (V, E). V ={verties}, E={eges}. h k g f e V={,,,,e,f,g,h,k} E={(,),(,g),(,h),(,k),(,),(,k),...,(h,k)} E =16. 1 Grph or Multi-Grph We llow loops n multiple eges. G = (V, E.ψ)
More informationCOMPUTER SCIENCE TRIPOS
CST.2011.2.1 COMPUTER SCIENCE TRIPOS Prt IA Tuesdy 7 June 2011 1.30 to 4.30 COMPUTER SCIENCE Pper 2 Answer one question from ech of Sections A, B nd C, nd two questions from Section D. Submit the nswers
More informationIntensity transformations
Intensity trnsformtions Stefno Ferrri Università degli Studi di Milno stefno.ferrri@unimi.it Methods for Imge Processing cdemic yer 2017 2018 Sptil domin The sptil domin of n imge is the plne tht contins
More information