SpiC is required for secretion of Salmonella Pathogenicity Island 2 type III secretion system proteins

Transcription

1 Blackwell Science, LtdOxford, UKCMICellular Microbiology Blackwell Science, Original ArticleX.-J. Yu et al.spic and SPI-2 secretion Cellular Microbiology (2002) 4(8), SpiC is required for secretion of Salmonella Pathogenicity Island 2 type III secretion system proteins Xiu-Jun Yu, Javier Ruiz-Albert, Kate E. Unsworth, Steven Garvis, Mei Liu and David W. Holden* Department of Infectious Diseases, Centre for Molecular Microbiology and Infection, Imperial College School of Medicine, Armstrong Road, London SW7 2AZ, UK. Summary Replication of Salmonella typhimurium in host cells depends in part on the action of the Salmonella Pathogenicity Island 2 (SPI-2) type III secretion system (TTSS), which translocates bacterial effector proteins across the membrane of the Salmonella-containing vacuole (SCV). We have shown previously that one activity of the SPI-2 TTSS is the assembly of a coat of F-actin in the vicinity of bacterial microcolonies. To identify proteins involved in SPI-2 dependent actin polymerization, we tested strains carrying mutations in each of several genes whose products are proposed to be secreted through the SPI-2 TTSS, for their ability to assemble F-actin around intracellular bacteria. We found that strains carrying mutations in either sseb, ssec, ssed or spic were deficient in actin assembly. The phenotypes of the sseb -, ssec - and ssed mutants can be attributed to their requirement for translocation of SPI-2 effectors. SpiC was investigated further in view of its proposed role as an effector. Transient expression of a myc::spic fusion protein in Hela cells did not induce any significant alterations to the host cell cytoskeleton, and failed to restore actin polymerization around intracellular spic mutant bacteria. However, the same protein did complement the mutant phenotype when expressed from a plasmid within bacteria. Furthermore, spic was found to be required for SPI-2 mediated secretion of SseB, SseC and SseD in vitro. An antibody against SpiC detected the protein on immunoblots from total cell lysates of S. typhimurium expressing SpiC from a plasmid, but it was not detected in secreted fractions after exposure of cells to conditions that result in secretion of other SPI-2 effector proteins. Investigation of the trafficking of SCVs containing a spic Received 18 April, 2002; revised 30 May, 2002; accepted 31 May, *For correspondence. d.holden@ic.ac.uk; Tel. (+44) ; Fax (+44) mutant in macrophages revealed only a low level of association with the lysosomal marker cathepsin D, similar to that of wild-type bacteria. Together, these results show that SpiC is involved in the process of SPI-2 secretion and indicate that phenotypes associated with a spic - mutant are caused by the inability of this strain to translocate effector proteins, thus calling for further investigation into the function(s) of this protein. Introduction The type III secretion system (TTSS) encoded by Salmonella Pathogenicity Island 2 (SPI-2) is activated after bacteria are internalized by host cells, and is important for growth of Salmonella typhimurium in macrophages and mice (Hensel et al., 1995; Ochman et al., 1996; Valdivia and Falkow, 1997; Lee et al., 2000). The SPI-2 TTSS transfers effector proteins from the bacterial cell, across the phagosomal membrane and into the host cell cytosol. Translocation of effectors depends on the secretion of SseB, SseC and SseD (Nikolaus et al., 2001). This fact, and their similarity to translocon components of other TTSSs (Hensel et al., 1998), indicates that these three proteins are components of the SPI-2 TTSS translocon, which is thought to be assembled in the membrane of the Salmonella-containing vacuole (SCV). SpiC (referred to as SsaB by Hensel et al., 1998) is an effector protein encoded within SPI-2 (Ochman et al., 1996; Uchiya et al., 1999), which lacks the conserved N- terminal sequence present in most effectors whose translocation has been demonstrated (Miao et al., 1999; Miao and Miller, 2000). SpiC has been reported to inhibit interactions between the SCV and late endosomes and lysosomes, as well as endocytosis and recycling of transferrin (Uchiya et al., 1999). Another effector, SifA, is encoded outside SPI-2 (Stein et al., 1996) and maintains the integrity of the SCV membrane (Beuzón et al., 2000). SifA also induces the formation of tubular membrane structures (Sifs) in epithelial cells, which are likely to be extensions of SCVs (García-del Portillo et al., 1993; Stein et al., 1996). Sifs contain proteins, such as lysosomal membrane glycoproteins (García-del Portillo et al., 1993) and the vacuolar ATPase (Beuzón et al., 2000), which are also found in the SCV membrane (García-del Portillo and Finlay, 1995; Beuzón et al., 2000) Blackwell Science Ltd

2 532 X.-J. Yu et al. Through the action of unknown effectors, the SPI-2 TTSS enables Salmonella to avoid the respiratory burst by inhibiting trafficking to the SCV of NADPH oxidase subunits (Vazquez-Torres et al., 2000; Gallois et al., 2001). The SPI-2 TTSS also induces a delayed apoptoticlike cell death in macrophages (van der Velden et al., 2000), and the assembly of a meshwork of F-actin around the bacterial microcolony in a variety of host cell types (Méresse et al., 2001). Treatment of infected cells with the actin depolymerizing drugs cytochalasin D or latrunculin B inhibits intramacrophage replication of wild-type S. typhimurium and causes the loss of its vacuolar membrane (Méresse et al., 2001). Although this effect is similar to that of a sifa mutation, SCVs containing sifa mutant bacteria were found to be consistently associated with F- actin (Méresse et al., 2001), ruling out SifA as an effector of SPI-2 dependent actin polymerization. In this paper, we used a variety of mutant strains in an attempt to identify effectors of SPI-2 dependent actin polymerization. We found that a strain carrying a mutation in spic was deficient in actin assembly. However, further investigation revealed that spic is itself required for SPI- 2 mediated secretion of SseB, SseC and SseD. Therefore, the actin-deficient phenotype of the spic - mutant is probably due to an inability to secrete effector(s) of this process. Results and Discussion SpiC is required for assembly of F-actin around intracellular S. typhimurium Several candidate SPI-2 secreted proteins have been proposed. These include those encoded by the SPI-2 ssea- G and spic genes, along with a number of proteins encoded by genes located elsewhere on the S. typhimurium chromosome including ssph-1, ssph-2, sifa, sifb, slrp, ssei/srfh, ssej and srfj (Hensel et al., 1998; Miao et al., 1999; Uchiya et al., 1999; Beuzón et al., 2000; Miao and Miller, 2000; Worley et al., 2000; Brumell et al., 2001). We tested S. typhimurium strains available in our laboratory, carrying single mutations in several of these genes, for their ability to induce actin rearrangements in Swiss 3T3 cells. This host cell line was chosen because SPI-2 dependent actin rearrangements are particularly well defined in these cells (Méresse et al., 2001). For each strain, the percentage of bacterial microcolonies associated with F-actin (revealed by staining with Texas redphalloidin) was determined at 8 h after invasion. As recent results from our laboratory indicate that a non-polar mutation in ssea reduces expression of sseb (R. Mundy et al. unpublished results) this gene was not included in the screen for effectors of actin polymerization. The majority of intracellular bacterial microcolonies of ssee -, ssef -, sseg -, ssei/srfh -, ssej -, srfj - sifb - and slrp - mutant strains were associated with F-actin, indicating that these genes are not required for SPI-2-induced cytoskeletal reorganisation (Fig. 1A). However, only a minority of clusters of sseb -, ssec -, ssed - and spic - mutant bacteria were associated with F-actin (Fig. 1A). SseB, SseC and SseD are SPI-2 secreted proteins (Beuzón et al., 1999; Klein and Jones, 2001) required for the translocation of SPI-2 effector proteins into the host cell cytosol (Nikolaus et al., 2001). Therefore the inability of these mutant strains to induce F-actin assembly is most likely due to their failure to translocate effectors. However, the SpiC protein was reported to be a translocated effector protein of the SPI-2 TTSS (Uchiya et al., 1999), and was consequently a strong candidate to be an effector of SPI-2-dependent F-actin reorganisation. Therefore further studies were focused on SpiC. The lack of association of a spic - mutant with F-actin was also observed in HeLa cells (Fig. 1B). Expression of SpiC from a plasmid restored the ability of the mutant strain to induce actin reorganisation in infected cells (Fig. 1), confirming that the spic - mutation is nonpolar and that the gene is specifically required for SPI-2- dependent actin reorganization. Ectopic expression of SpiC in Hela cells does not complement spic - mutant phenotypes Because it has been shown that the translocated effector SifA can induce Sif formation when expressed in uninfected HeLa cells (Brumell et al., 2001), we investigated the possible role of SpiC in actin rearrangement by expressing an epitope-tagged version of the protein (myc::spic) in the same cell type. We first determined whether the presence of the myc epitope at the N-terminus of SpiC affected the function of the protein, by introducing a plasmid expressing myc::spic into spic bacteria. The myc::spic fusion was able to complement the spic mutant strain for actin assembly in both Swiss 3T3 (data not shown) and HeLa (Fig. 2A) cells. Having confirmed that the presence of the myc epitope does not affect the function of SpiC with respect to this phenotype, HeLa cells were transfected with the myc::spic fusion construct in a eukaryotic expression vector. Expression of a myc::spic fusion protein of the predicted molecular mass (15.3 kda) was verified by Western blotting with anti-myc and anti-spic antibodies (data not shown). Confocal immunofluorescence microscopy of transfected cells showed that the protein was usually localized to both cytoplasm and nucleus of transfected cells but did not colocalize significantly with F-actin (Fig. 3A). The distribution of F-actin, as revealed by Texas red-phalloidin staining, was examined in at least 50 transfected cells from several independent experiments. The morphology of cells expressing myc::spic was not noticeably different to that of untransfected cells in terms of general cytoskeletal

3 SpiC and SPI-2 secretion 533 Fig. 1. Intracellular actin assembly by S. typhimurium is SpiC-dependent. Swiss 3T3 or HeLa cells were infected for 8 h (A) or 10 h (B) with the indicated S. typhimurium strains. F-actin was visualized by Texas redphalloidin staining. Salmonella typhimurium strains expressed GFP or were detected with an anti-salmonella antibody. A. Percentage of infected cells in which bacterial microcolonies were surrounded with F-actin. Only clusters of 4 24 bacteria were included in the analysis. Results shown are the mean ± SE of three independent experiments in which a total of 300 infected cells were examined for each strain. B. Representative confocal micrographs of HeLa cells infected with wild-type, spic -, ssav - or spic -, pspic bacteria. Scale bar corresponds to 2 µm. organisation, i.e. number and appearance of stress fibres, filopodia and lamellipodia. Therefore, ectopically expressed SpiC does not have a significant effect on the host cell actin cytoskeleton. If SpiC is an effector involved in SPI-2 dependent actin reorganisation, then the failure to detect any change in the actin cytoskeleton in cells transfected with SpiC could reflect a requirement for additional SPI-2 effectors in this process. We therefore tested if ectopically expressed SpiC could complement the actin-deficient phenotype of a spic - mutant in transfected, infected cells. HeLa cells were first transfected with myc::spic, infected for 10 h with the S. typhimurium spic mutant, then fixed and stained with Texas red-phalloidin. The spic - mutant displayed an intracellular replication defect, as has been reported in macrophages (Uchiya et al., 1999), and this defect was not complemented by ectopic expression of myc::spic (data not shown). There was no increase in the proportion of actin-positive microcolonies in transfected, infected cells when compared with untransfected cells infected with the spic - mutant strain (Fig. 3B). This indicates that ectopic expression of SpiC did not rescue the defect in actin assembly displayed by the spic - mutant, and fails to support the hypothesis that SpiC is a SPI-2 effector mediating actin assembly. It has been reported previously that spic - mutant bacteria fail to induce Sifs in epithelial cells (Guy et al., 2000). We found that this defect, like the failure to induce actin assembly, could be rescued by expression of myc::spic from within the spic - mutant (Fig. 2B), but not by ectopic expression (Fig. 3C). It is possible that Salmonellamediated transfer of SpiC into host cells is essential to observe its effects on actin polymerization and Sif formation. An alternative explanation for these results is that SpiC is required for secretion or translocation of other effectors which mediate these processes. To test this hypothesis, we examined the effect of the spic - mutation on SPI-2 dependent secretion in vitro.

4 534 X.-J. Yu et al. show that SpiC is required for SPI-2 dependent secretion of these three proteins. In an effort to localize SpiC, a recombinant his-tagged SpiC protein was purified and used to raise an anti-spic antibody. The anti-spic antibody was able to detect the myc::spic fusion protein on immunoblots from transfected cells (data not shown), and the SpiC protein in whole cell lysates of S. typhimurium, when expressed from a low copy-number plasmid (Fig. 4B). The specificity of the anti- Fig. 2. Myc::SpiC can restore actin assembly and Sif formation to a spic - mutant strain. HeLa cells were infected with spic -, pmyc::spic bacteria and fixed at 10 h after invasion. Bacteria were labelled with an anti-salmonella antibody. Confocal micrographs of representative infected cells. A. F-actin was visualized by Texas red-phalloidin staining. Scale bar corresponds to 3 µm. B. Sifs were labelled with an anti-lamp-1 antibody. Scale bar corresponds to 5 µm. A Salmonella typhimurium spic - mutant fails to secrete three SPI-2 secreted proteins The secretion of SseB, SseC, SseD, and other SPI-2 secreted proteins, can be induced by culturing bacteria in a minimal medium at low ph (Beuzón et al., 1999; Klein and Jones, 2001; Hansen-Wester et al., 2002). Secretion of SseB, SseC and SseD in vitro leads to their association with the bacterial surface, from which they can be detached by exposing cells to the hydrophobic agent hexadecane (Beuzón et al., 1999). We therefore examined the secretion of these proteins in the spic - mutant strain by immunoblot analysis using specific polyclonal antibodies. All three proteins were detected in whole cell lysates from the wild-type strain, a strain carrying a mutation in ssav (which encodes an essential component of the SPI-2 secreton (Beuzón et al., 1999; Beuzón et al., 2000)) and the spic - mutant strain, with or without a plasmid carrying the wild-type spic allele (Fig. 4A). They were also found in the hexadecane fractions from the wildtype and the complemented spic - mutant. However, none of the proteins were detected in the hexadecane fraction from the ssav - or spic - mutants (Fig. 4A). These results Fig. 3. Ectopically expressed myc::spic neither affects the actin cytoskeleton nor rescues defects associated with a spic mutation in HeLa cells. A. HeLa cells expressing myc::spic were fixed at 24 h after transfection. F-actin and myc::spic were visualized by Texas red-phalloidin staining and an anti-myc antibody. Projection of a confocal z stack of a representative field. Scale bar corresponds to 20 µm. B and C. HeLa cells were transfected for 24 h with myc::spic, and infected for 10 h with the S. typhimurium spic - mutant. Bacteria were labelled with an anti-salmonella antibody. myc::spic expressing cells were identified by labelling with an anti-myc antibody (not shown). Confocal micrographs of representative transfected, infected cells. (B) F-actin was visualized by Texas red-phalloidin staining. Scale bar represents 2 µm. (C) Cells were labelled with an anti-lamp-1 antibody. Scale bar corresponds to 5 µm.

5 SpiC and SPI-2 secretion 535 Fig. 4. Secretion analysis of SseB, SseC, SseD and SpiC. Bacterial strains were cultured in MgM-MES at ph 5.0, and different fractions were prepared and analysed by immunoblotting as described in Experimental procedures. A. SpiC is required to secrete SseB, SseC, SseD onto the bacterial cell surface (hexadecane fraction). B. SpiC revealed with a rabbit anti-spic antibody was detected only in a strain expressing SpiC from a plasmid. C. SseB can be detected on the bacterial cell surface and the surface of the culture vessel, whereas SpiC can only be detected in the whole cell lysate. WL, whole cell lysate; H, hexadecane fraction; PS, plastic surface; S, supernatant. body was confirmed by the absence of a band of corresponding size when a different protein was expressed from the same plasmid (Fig. 4B). After growth of the spic -, pspic strain at low ph to induce SPI-2-mediated secretion, the protein was not detected in the hexadecane fraction, culture supernatant or on the inner plastic surface of the tube in which the bacteria were cultured (Beuzón et al., 1999; Daefler, 1999) (Fig. 4C). It is conceivable that SpiC secretion is induced by different signals to those required for other SPI-2 secreted proteins. However it should be noted that the low ph signal that induces secretion of the translocon components SseB, SseC and SseD (Beuzón et al., 1999; Klein and Jones, 2001; Nikolaus et al., 2001) is also sufficient to induce secretion of the SPI-2 translocated effectors SifA, SifB and SseJ, as well as the SPI-2-encoded proteins SseF and SseG, whose translocation to the host cell cytosol has yet to be demonstrated (Hansen-Wester et al., 2002). A further possibility is that SpiC secretion is induced in response to the same conditions as other SPI- 2 secreted proteins, but at levels that are below our detection threshold. However, our results are in agreement with those of Hansen-Wester et al. (2002), who were unable to detect secretion of a SpiC::M45 fusion protein under similar conditions. Trafficking of a spic - mutant in macrophages Because the spic - mutant strain is unable to secrete translocon components, this implies that it should be null for all functions of the SPI-2 TTSS, and therefore phenotypically equivalent to a strain carrying a mutation in ssav. Therefore, all phenotypes associated with the spic - mutant, including its strong attenuation of virulence (Uchiya et al., 1999), intra-macrophage replication defect (Uchiya et al., 1999), inability to induce Sifs (Guy et al., 2000) and defect in actin assembly (this paper) most probably reflect an inability to translocate any SPI-2 effector proteins. Uchiya et al. (1999) reported that in J774 macrophages, SCVs containing a spic - mutant interact with endosomes and lysosomes to a much greater extent than vacuoles containing wild-type bacteria. Conversely, using different methods, our group reported that in RAW and mouse peritoneal macrophages, SCVs containing an ssav - mutant had a relatively low level of association with late endosomes and lysosomes, similar to those containing wild-type bacteria (Garvis et al., 2001). We explained this apparent inconsistency by postulating that a SPI-2 null mutant might traffic differently from a strain lacking only one effector. However, as spic is necessary for secretion of SPI-2 translocon components, the corresponding mutant strain would be predicted to traffic in the same way as an ssav - mutant. We therefore examined the trafficking of a spic - mutant in macrophages with respect to its association with the lysosomal marker cathepsin D. We have found that S. typhimurium strains that display high or low levels of association with cathepsin D associate to a similar degree with the late endoso-

6 536 X.-J. Yu et al. Fig. 5. Confocal immunofluorescence analysis of cathepsin D association with vacuoles containing different strains of GFP-expressing S. typhimurium in RAW macrophages. Cells were fixed at 16 h after uptake and stained with a rabbit anti-cathepsin D antibody (red). A. Representative confocal micrographs of macrophages containing wild-type, spic -, and phop - bacteria (green). Scale bar corresponds to 1 µm. B. Percentage of SCVs co-localizing with anti-cathepsin D antibody for each strain at 16 h. mal marker lysobisphosphatidic acid, or the fluid phase marker Texas red-ovalbumin pulse-chased into lysosomes (Garvis et al., 2001). Opsonised GFP-expressing bacterial strains were incubated with RAW macrophages. After phagocytosis and exposure to gentamicin to kill extracellular bacteria, macrophages were incubated for a further 16 h, then fixed, stained with an anti-cathepsin D antibody, and examined by confocal microscopy. A phop - mutant strain, which interacts with cathepsin D-containing compartments to a much greater degree than the wild-type strain (Garvis et al., 2001), was used as a positive control. While the level of colocalization between this strain and cathepsin D at 16 h was 52.3 ± 13.5%, those of the wildtype and spic - mutant were 15.0 ± 6.0%, and 4.2 ± 1.4% respectively (Fig. 5). We conclude that with respect to interactions with cathepsin D, the trafficking of the spic - mutant is very similar to that of the ssav - mutant (8.7 ± 5.5% association after 16 h; Garvis et al., 2001), as would be predicted in light of the results in Fig. 4. However these results are not consistent with those of Uchiya et al. (1999), who used electron microscopy to measure interactions between SCVs containing spic - mutant bacteria and either lysosomes or endosomes preloaded with goldlabelled bovine serum albumin. The fact that SpiC is required for SPI-2 dependent secretion does not rule out its reported role as a SPI-2 translocated effector. The InvJ and SpaO proteins encoded by the S. typhimurium SPI-1 TTSS (Collazo and Galán, 1996), Spa32 of Shigella flexneri (Tamano et al., 2002), and YscO of Yersinia spp. (Payne and Straley, 1998), are secreted via their respective TTSSs, and are also required for the secretion process. It is therefore possible that SpiC is another example of this class of protein. However, our failure to detect secretion of SpiC in vitro, and to find a trafficking defect of spic - and ssav - mutant strains in macrophages, call for additional studies to clarify the functions of this protein in the SPI-2 TTSS. The purpose of this study was to identify genes whose product(s) are responsible for F-actin assembly around intracellular S. typhimurium (Méresse et al., 2001). Of all strains tested, only those carrying mutations in genes required for secretion or translocation of SPI-2 proteins, and in spic, prevented intracellular actin assembly. As the results presented here do not support a direct role for SpiC in SPI-2-induced actin assembly, the effector(s) of this process remain to be identified. Experimental procedures Bacterial strains The S. typhimurium strains used in this study are listed in Table 1. Strain HH205 was constructed by P22 transduction of an ssed::apht mutation from strain JK22, a derivative of SL1344 (a gift from B. Jones, University of Iowa, Iowa City, IA), to strain Strain HH214, containing a non-polar deletion mutation in spic, was obtained by allelic exchange as follows: a DNA fragment encoding the first 33 amino acids of the spic gene together with the corresponding upstream flanking region was amplified by PCR from S. typhimurium strain genomic DNA, using the primers SPIC-1 and SPIC-2 (primers used in this study are listed in Table 2). The 1.2 kb PCR product, containing terminal EcoRI and SacI sites, was ligated into pcrii-topo (Invitrogen) generating plasmid pcr-spic12. A second DNA fragment, encoding

7 SpiC and SPI-2 secretion 537 Name Description Source or reference Wild-type NCTC Nal r Sm r Nalidixic acid-resistant, streptomycin-resistant Ruiz-Albert et al. (2002) spontaneous mutant HH102 sseb::apht (Km r ) in Hensel et al. (1998) HH104 ssec::apht (Km r ) in Hensel et al. (1998) HH106 ssee in Hensel et al. (1998) HH107 ssef::apht (Km r ) in Hensel et al. (1998) HH108 sseg::apht (Km r ) in Hensel et al. (1998) HH109 ssav::apht (Km r ) in Deiwick et al. (1999) HH114 phop102::tn10dcm (Cm r ) in Garvis et al. (2001) HH197 sifb::cat (Cm r ) in Ruiz-Albert et al. (2002) HH199 ssei::pgp704 (Amp r ) in Ruiz-Albert et al. (2002) HH201 srfj:: pgp704 (Amp r ) in Ruiz-Albert et al. (2002) HH205 ssed::apht (Km r ) in This study HH210 ssej in Ruiz-Albert et al. (2002) HH214 spic::apht (Km r ) in This study STN39 slrp::mtn5 (Km r ) in Tsolis et al. (1999) Table 1. S. typhimurium strains used in this study. the last 69 amino acids of the spic gene together with the corresponding downstream flanking region, was amplified by PCR from S. typhimurium strain genomic DNA, using the primers SPIC-3 and SPIC-4. The 1.2 kb PCR product, containing terminal BamHI and SalI sites, was ligated into pcrii-topo (Invitrogen), generating plasmid pcr-spic34. A 795 bp DNA fragment containing the kanamycin resistance gene apha-3 was recovered from plasmid puc19-k2 (Ménard et al., 1993) by digestion with SacI and BamHI. This DNA fragment, together with the 1.2 kb EcoRI-SacI fragment from plasmid pcr-spic12 and the 1.2 kb BamHI-SalI fragment from plasmid pcr-spic34, were ligated into the EcoRI and SalI sites of puc18, generating plasmid puc-spic::apha3. In view of the low kanamycin resistance level displayed by this plasmid, the apha-3 gene was replaced with a more efficient apht kanamycin resistance gene obtained from plasmid psb315 (Galán et al., 1992), generating plasmid puc-spic::apht. This plasmid was digested with EcoRI and SalI, blunt-ended using Klenow DNA polymerase, and ligated into the EcoRV site of the suicide vector pkas32 (Skorupski and Taylor, 1996) to generate plasmid pkas-spic::apht. The resulting plasmid was transferred by conjugation from E. coli S17 1λpir to S. typhimurium Nal r Sm r, and exconjugants were selected as previously described (Shea et al., 1999). The spic::apht mutation was transduced by phage P22 as described previously (Davis et al., 1980) to strain (Shea et al., 1999) before use in this study. Bacterial growth and media Bacteria were grown in Luria Bertani (LB) medium supplemented with carbenicillin (50 µg ml 1 ), kanamycin (50 µg ml 1 ), chloramphenicol (30 µg ml 1 ), nalidixic acid (100 µg ml 1 ) or streptomycin (100 µg ml 1 ), for strains resistant to these antibiotics (Amp r, Km r, Cm r, Nal r and Sm r respectively). To induce SPI-2 gene expression and SPI-2 dependent secretion, bacteria were grown in magnesium minimal medium MES (MgM-MES), containing 170 mm 2-[N-morpholino]ethane-sulphonic acid at ph 5.0, 5 mm KCl, 7.5 mm (NH4) 2 SO 4, 0.5 mm K 2 SO 4, 1 mm KH 2 PO 4, 8 µm MgCl 2, 38 mm glycerol and 0.1% casamino acids (Beuzón et al., 1999) with the corresponding antibiotics when appropriate. Bacteria were grown at 37 C overnight with aeration. Plasmids Plasmid pfvp25.1, carrying gfpmut3a under the control of the rpsm constitutive promoter (Valdivia and Falkow, 1996), was introduced into bacterial strains and used for fluorescence visualization where indicated. The complementing plasmid pspic is a derivative of pacyc184 (Chang and Cohen, 1978) carrying the spic gene under the control of a constitutive promoter. A DNA fragment including the complete ORF of spic and its ribosomal binding site (rbs) was amplified by PCR from genomic DNA using SPIC-5 and PET-ABC primers. The 425 bp PCR Name Nucleotide sequence (5 3 ) SPIC-1 CACGAGCTCCTCTGGCAGGATGCCCATC SPIC-2 CCGGAATTCCTGCCATCCATCATGCAGCG SPIC-3 CGCGGATCCACAAGTAGTAGCTCTGAGC SPIC-4 CGCGTCGACAAGCGAGGTGTAACGCGTAAC SPIC-5 ACCCGGGTAAGAAGGAGATATACATATGTCTGAGGAGGGATTCATGCTGGC SPIC-7 TGGGATCCCTGGCAGTTTTAAAAGGC SPIC-8 GCGAATTCTTATACCCCACCCGAATAAAG SPIC-9 TCAGTACTGAGGAGGGATTCATGGAGCAGAAGCTGATCTCC SPIC-10 ACGCATGCTTATACCCCACCCGAATAAAGTTTATGGT PET-ABN GGAATTCCATATGTCTGAGGAGGGATTCATGCTGGC PET-ABC CCGGATCCTATTATACCCCACCCGAATAAAGTTTATGG SSA-F1 GATATCTAAACTTTATTCGGGTGGG SSA-R GTCGACCAGCAAATCTTCTAACCGG Table 2. Oligonucleotide primers used in this study.

8 538 X.-J. Yu et al. product, containing terminal SmaI and BamHI sites, was digested and ligated into the EcoRV and BamHI sites of pacyc184 within the tet r gene, generating pspic. The complementing plasmid pmyc::spic is a derivative of pacyc184, that expresses constitutively a full length version of SpiC bearing an N-terminal fusion to the c-myc epitope tag. A DNA fragment including an ORF encoding a c-myc::spic translational fusion with the corresponding ribosomal binding site (rbs) was amplified by PCR from plasmid prk5-myc::spic (see below) using SPIC-9 and SPIC-10 primers. The 436 bp PCR product, containing terminal ScaI and SphI sites, was digested and ligated into the EcoRV and SphI sites of pacyc184 within the tet r gene, generating pmyc::spic. The expression plasmid prk5-myc::spic was constructed as follows: a DNA fragment including the complete ORF of spic was amplified by PCR from genomic DNA using SPIC-7 and SPIC-8 primers. The 384 bp PCR product, containing terminal BamHI and EcoRI sites, was digested and ligated into the plasmid prk5-myc (Lamarche et al., 1996), within the same reading frame as that of the c-myc epitope tag of the plasmid, generating prk5-myc::spic. This plasmid expresses a full-length version of SpiC bearing an N-terminal fusion to the c-myc epitope tag. The plasmid pssacd is a derivative of pacyc184, carrying the ssacd genes under the control of a constitutive promoter. A DNA fragment including the complete ORFs of ssac and ssad with the corresponding ribosomal binding sites (rbs) was amplified by PCR from genomic DNA using SSA-F1 and SSA-R primers. The 2.7 kb PCR product, containing terminal EcoRV and SalI sites, was digested and ligated into pacyc184 within the tet r gene, generating pssacd. Recombinant SpiC protein and generation of anti-spic polyclonal antibody For the expression of recombinant SpiC, a DNA fragment including the complete ORF of spic was amplified by PCR from genomic DNA, using PET-ABN and PET-ABC primers. The 422 bp PCR product, containing terminal NdeI and BamHI sites, was digested and ligated into vector pet-15b (Novagen), generating pid810. This plasmid expresses a full-length version of SpiC bearing an N-terminal His-tag fusion, under the control of a T7 promoter. Plasmid pid810 was introduced into E. coli strain BL21 (DE3), and SpiC was expressed following standard protocols (Sambrook and Russell, 2001). The 16.8 kda recombinant protein was purified by metal-chelating chromatography using B- PER 6xHis Column Purification Kit according to the instructions of the manufacturer (Pierce) and used as an antigen for rabbit immunization (Abcam). Antibody titres were checked by Western blot using total cell fractions of E. coli strain BL21 (DE3) expressing SpiC. The rabbit polyclonal anti-spic antibody was used for Western analysis at a dilution of 1 : Antibodies and reagents The rabbit polyclonal anti-sseb (Beuzón et al., 1999), anti-ssec and anti-ssed (Nikolaus et al., 2001) antibodies were used at a dilution of 1 : The mouse monoclonal anti-c-myc antibody 9E10 was provided by E. Caron (Imperial College, London, UK) and was used at a dilution of 1 : 200 for immunofluorescence microscopy or 1 : 2000 for Western analysis. The rabbit polyclonal anti-cathepsin D antibody was provided by S. Kornfeld (Washington University, St Louis, MO) and was used at a dilution of 1 : 600. The rabbit polyclonal anti-lamp-1 antibody 156 (Steele-Mortimer et al., 1999) was provided by S. Méresse (Centre d'immunologie de Marseille-Luminy, Marseille, France) and was used at a dilution of 1 : The mouse monoclonal anti- LAMP-1 antibody H4A3 developed by J. T. August and J. E. K. Hildreth was obtained from the Developmental Studies Hybridoma Bank developed under the auspices of the NICHD and maintained by the University of Iowa (Department of Biological Siences, IA), and was used at a dilution of 1 : Anti-Salmonella goat polyclonal antibody CSA-1 was purchased from Kirkegaard and Perry Laboratories (Gaithensburg, MD) and was used at a dilution of 1 : 400. Texas red sulphonyl chloride (TRSC)-, and cyanine 2 (Cy2)-conjugated donkey anti-mouse and anti-rabbit antibodies, and cyanine 5 (Cy5)-conjugated donkey anti-goat antibody were purchased from Jackson Immunoresearch Laboratories (West Grove, PA), and used at a dilution of 1 : 400. Texas red-conjugated phalloidin was purchased from Molecular Probes and used at a dilution of 1 : 50. Horseradish peroxidase (HRP)-conjugated antirabbit and anti-mouse antibodies were purchased from Amersham Life Sciences and used at a dilution of 1 : Cell culture RAW murine macrophage-like cells were obtained from the European Collection of Animal Cell Cultures (ECACC ). HeLa (clone HtTA1) human epithelioid and Swiss 3T3 murine fibroblast cells were kindly provided by S. Méresse (Centre d'immunologie de Marseille-Luminy, Marseille, France) and E. Caron (Imperial College, London, UK) respectively. Cells were grown in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% fetal calf serum (FCS) and 2 mm glutamine at 37 C in 5% CO 2. Bacterial infection of cultured cells HeLa and Swiss 3T3 cells were infected with exponential phase S. typhimurium as described previously (Beuzón et al., 2000). Macrophages were infected with opsonized, stationary phase S. typhimurium as described previously (Garvis et al., 2001). In order to follow a synchronized population of bacteria host cells were washed after 15 min (HeLa and Swiss 3T3 cells) or 25 min (RAW cells) of exposure to S. typhimurium and subsequently incubated in medium containing gentamicin to kill extracellular bacteria. Immunofluorescence microscopy For immunofluorescence, cells were fixed in paraformaldehyde, stained, mounted and analysed using a confocal laser scanning microscope (LSM 510, Zeiss) as described previously (Beuzón et al., 2000). Transfection of HeLa cells Transient transfection of HeLa cells and bacterial infection of transfected HeLa cells were performed as described previously (Ruiz-Albert et al., 2002).

9 SpiC and SPI-2 secretion 539 Preparation of cell fractions Bacterial cell densities were determined by measurement of the OD 600. To ensure that protein from equal numbers of cells was analysed, all experimental protein samples were adjusted to OD 600 values such that a volume corresponding to 10 ml of a culture of OD was taken up in 100 µl of protein denaturing buffer for gel electrophoresis. Cell cultures were divided in two fractions, cooled on ice, centrifuged at g for 5 min at 4 C, and the proteins present in the supernatant were collected by trichloroacetic acid precipitation (supernatant). After removal of the culture medium both cell pellets were washed with ice-cold PBS buffer, and one of them stored at 70 C before analysis (whole cell lysate). The second pellet was resuspended in 0.3 ml of PBS buffer, and the suspension mixed gently with 0.2 ml n- hexadecane for 5 min at room temperature and centrifuged at g for 10 min at room temperature (Michiels et al., 1990). The organic layer was discarded and the aqueous layer mixed with 1.2 ml acetone and held at 20 C to form a precipitate. The acetone precipitate was centrifuged, dried and stored at 70 C before analysis (hexadecane fraction). All fractions were dissolved in protein denaturing buffer before polyacrylamide gel electrophoresis. To analyse the presence of secreted proteins on the surface of the plastic vessel in which the bacteria were cultured (Daefler, 1999), an appropriate amount of proteindenaturing buffer was added to the drained growth vessel and incubated shaking for 30 min at 37 C (plastic surface). Polyacrylamide gel electrophoresis and Western analysis of proteins Protein fractions were dissolved in the appropriate volume of protein denaturing buffer (Beuzón et al., 1999) and held at 100 C for 5 min. Proteins were immediately separated on 12% SDSpolyacrylamide gels (Laemmli, 1970). For Western analysis, gels were transferred to Immobilon-P membranes (Millipore) and examined using the ECL detection system under conditions recommended by the manufacturer (Amersham Life Science). Incubation of membranes with primary antibodies (rabbit anti- SpiC, anti-sseb, anti-ssec, anti-ssed or mouse anti-myc) was followed by incubation with horseradish peroxidase (HRP)- conjugated anti-rabbit or anti-mouse as secondary antibodies. Acknowledgements We would like to thank C. Beuzón for critical reading of the manuscript. We also thank A. Bäumler for providing strain STN39 and M. Hensel for the anti-ssec and anti-ssed antibodies. This work was supported by a grant from the MRC to David Holden. References Beuzón, C.R., Banks, G., Deiwick, J., Hensel, M., and Holden, D.W. (1999) ph-dependent secretion of SseB, a product of the SPI-2 type III secretion system of Salmonella typhimurium. Mol Microbiol 33: Beuzón, C.R., Méresse, S., Unsworth, K.E., Ruiz-Albert, J., Garvis, S., Waterman, S.R. et al. (2000) Salmonella maintains the integrity of its intracellular vacuole through the action of SifA. EMBO J 19: Brumell, J.H., Rosenberger, C.M., Gotto, G.T., Marcus, S.L., and Finlay, B.B. (2001) SifA permits survival and replication of Salmonella typhimurium in murine macrophages. Cell Microbiol 3: Chang, A.C., and Cohen, S.N. (1978) Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J Bacteriol 134: Collazo, C.M., and Galán, J.E. (1996) Requirement for exported proteins in secretion through the invasionassociated type III system of Salmonella typhimurium. Infect Immun 64: Daefler, S. (1999) Type III secretion by Salmonella typhimurium does not require contact with a eukaryotic host. Mol Microbiol 31: Davis, R.H., Botstein, D., and Roth, J.R. (1980) Advanced Bacterial Genetics. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. Deiwick, J., Nikolaus, T., Erdogan, S., and Hensel, M. (1999) Environmental regulation of Salmonella pathogenicity island 2 gene expression. Mol Microbiol 31: Galán, J.E., Ginocchio, C., and Costeas, P. (1992) Molecular and functional characterization of the Salmonella invasion gene inva: homology of InvA to members of a new protein family. J Bacteriol 174: Gallois, A., Klein, J.R., Allen, L.A., Jones, B.D., and Nauseef, W.M. (2001) Salmonella pathogenicity island 2-encoded type III secretion system mediates exclusion of NADPH oxidase assembly from the phagosomal membrane. J Immunol 166: García-del Portillo, F., and Finlay, B.B. (1995) Targeting of Salmonella typhimurium to vesicles containing lysosomal membrane glycoproteins bypasses compartments with mannose 6-phosphate receptors. J Cell Biol 129: García-del Portillo, F., Zwick, M.B., Leung, K.Y., and Finlay, B.B. (1993) Salmonella induces the formation of filamentous structures containing lysosomal membrane glycoproteins in epithelial cells. Proc Natl Acad Sci USA 90: Garvis, S., Beuzón, C.R., and Holden, D.W. (2001) A role for the PhoP/Q regulon in inhibition of fusion between lysosomes and Salmonella-containing vacuoles in macrophages. Cell Microbiol 3: Guy, R.L., Gonias, L.A., and Stein, M.A. (2000) Aggregation of host endosomes by Salmonella requires SPI2 translocation of SseFG and involves SpvR and the fms-aroe intragenic region. Mol Microbiol 37: Hansen-Wester, I., Stecher, B., and Hensel, M. (2002) Type III secretion of Salmonella enterica serovar Typhimurium translocated effectors and SseFG. Infect Immun 70: Hensel, M., Shea, J.E., Gleeson, C., Jones, M.D., Dalton, E., and Holden, D.W. (1995) Simultaneous identification of bacterial virulence genes by negative selection. Science 269: Hensel, M., Shea, J.E., Waterman, S.R., Mundy, R., Nikolaus, T., Banks, G. et al. (1998) Genes encoding putative effector proteins of the type III secretion system of Salmonella pathogenicity island 2 are required for bacterial virulence and proliferation in macrophages. Mol Microbiol 30: Klein, J.R., and Jones, B.D. (2001) Salmonella pathogenicity island 2-encoded proteins SseC and SseD are essential

10 540 X.-J. Yu et al. for virulence and are substrates of the type III secretion system. Infect Immun 69: Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: Lamarche, N., Tapon, N., Stowers, L., Burbelo, P.D., Aspenstrom, P., Bridges, T. et al. (1996) Rac and Cdc42 induce actin polymerization and G1 cell cycle progression independently of p65pak and the JNK/SAPK MAP kinase cascade. Cell 87: Lee, A.K., Detweiler, C.S., and Falkow, S. (2000) OmpR regulates the two-component system ssra-ssrb. in Salmonella pathogenicity island 2. J Bacteriol 182: Ménard, R., Sansonetti, P.J., Parsot, C., Collazo, C.M., and Galán, J.E. (1993) Nonpolar mutagenesis of the ipa genes defines IpaB, IpaC, and IpaD as effectors of Shigella flexneri entry into epithelial cells. J Bacteriol 175: Méresse, S., Unsworth, K.E., Habermann, A., Griffiths, G., Fang, F., Martinez-Lorenzo, M.J. et al. (2001) Remodelling of the actin cytoskeleton is essential for replication of intravacuolar Salmonella. Cell Microbiol 3: Miao, E.A., and Miller, S.I. (2000) A conserved amino acid sequence directing intracellular type III secretion by Salmonella typhimurium. Proc Natl Acad Sci USA 97: Miao, E.A., Scherer, C.A., Tsolis, R.M., Kingsley, R.A., Adams, L.G., Bäumler, A.J., and Miller, S.I. (1999) Salmonella typhimurium leucine-rich repeat proteins are targeted to the SPI1 and SPI2 type III secretion systems. Mol Microbiol 34: Michiels, T., Wattiau, P., Brasseur, R., Ruysschaert, J.M., and Cornelis, G. (1990) Secretion of Yop proteins by yersiniae. Infect Immun 58: Nikolaus, T., Deiwick, J., Rappl, C., Freeman, J.A., Schroder, W., Miller, S.I., and Hensel, M. (2001) SseBCD proteins are secreted by the type III secretion system of Salmonella pathogenicity island 2 and function as a translocon. J Bacteriol 183: Ochman, H., Soncini, F.C., Solomon, F., and Groisman, E.A. (1996) Identification of a pathogenicity island required for Salmonella survival in host cells. Proc Natl Acad Sci USA 93: Payne, P.L., and Straley, S.C. (1998) YscO of Yersinia pestis is a mobile core component of the Yop secretion system. J Bacteriol 180: Ruiz-Albert, J., YuX.-J., Beuzón, C.R., Blakely, A.N., Galyov, E.E., and Holden, D.W. (2002) Complementary activities of SseJ and SifA regulate dynamics of the Salmonella typhimurium vacuolar membrane. Mol Microbiol 44: Sambrook, J., and Russell, D.W. (2001) Molecular Cloning: a Laboratory Manual. New York: Cold Spring. Harbor Laboratory Press. Shea, J.E., Beuzón, C.R., Gleeson, C., Mundy, R., and Holden, D.W. (1999) Influence of the Salmonella typhimurium pathogenicity island 2 type III secretion system on bacterial growth in the mouse. Infect Immun 67: Skorupski, K., and Taylor, R.K. (1996) Positive selection vectors for allelic exchange. Gene 169: Steele-Mortimer, O., Méresse, S., Gorvel, J.P., and Finlay, B. (1999) Biogenesis of Salmonella typhimurium-containing vacuoles in epithelial cells involves interactions with the early endocytic pathways. Cell Microbiol 1: Stein, M.A., Leung, K.Y., Zwick, M., García-del Portillo, F., and Finlay, B.B. (1996) Identification of a Salmonella virulence gene required for formation of filamentous structures containing lysosomal membrane glycoproteins within epithelial cells. Mol Microbiol 20: Tamano, K., Katayama, E., Toyotome, T., and Sasakawa, C. (2002) Shigella Spa32 is an essential secretory protein for functional type III secretion machinery and uniformity of its needle length. J Bacteriol 184: Tsolis, R.M., Townsend, S.M., Miao, E.A., Miller, S.I., Ficht, T.A., Adams, L.G., and Bäumler, A.J. (1999) Identification of a putative Salmonella enterica serotype Typhimurium host range factor with homology to IpaH and YopM by signature-tagged mutagenesis. Infect Immun 67: Uchiya, K., Barbieri, M.A., Funato, K., Shah, A.H., Stahl, P.D., and Groisman, E.A. (1999) A Salmonella virulence protein that inhibits cellular trafficking. EMBO J 18: Valdivia, R.H., and Falkow, S. (1996) Bacterial genetics by flow cytometry: rapid isolation of Salmonella typhimurium acid-inducible promoters by differential fluorescence induction. Mol Microbiol 22: Valdivia, R.H., and Falkow, S. (1997) Fluorescence-based isolation of bacterial genes expressed within host cells. Science 277: Vazquez-Torres, A., Xu, Y., Jones-Carson, J., Holden, D.W., Lucia, S.M., Dinauer, M.C. et al. (2000) Salmonella pathogenicity island 2-dependent evasion of the phagocyte NADPH oxidase. Science 287: van der Velden, A.W., Lindgren, S.W., Worley, M.J., and Heffron, F. (2000) Salmonella pathogenicity island 1- independent induction of apoptosis in infected macrophages by Salmonella enterica serotype Typhimurium. Infect Immun 68: Worley, M.J., Ching, K.H., and Heffron, F. (2000) Salmonella SsrB activates a global regulon of horizontally acquired genes. Mol Microbiol 36: