UNIVERSITI SAINS MALAYSIA. CIT562 Bioinformatics Computing [Perkomputeran Bioinformatik]

Save this PDF as:
Size: px
Start display at page:

Download "UNIVERSITI SAINS MALAYSIA. CIT562 Bioinformatics Computing [Perkomputeran Bioinformatik]"


1 UNIVERSITI SAINS MALAYSIA First Semester Examination 2015/2016 Academic Session December 2015/January 2016 CIT562 Bioinformatics Computing [Perkomputeran Bioinformatik] Duration : 2 hours [Masa : 2 jam] INSTRUCTIONS TO CANDIDATE: [ARAHAN KEPADA CALON:] Please ensure that this examination paper contains SIX questions in FIVE printed pages before you begin the examination. [Sila pastikan bahawa kertas peperiksaan ini mengandungi ENAM soalan di dalam LIMA muka surat yang bercetak sebelum anda memulakan peperiksaan ini.] Answer ALL questions. [Jawab SEMUA soalan.] You may answer the questions either in English or in Bahasa Malaysia. [Anda dibenarkan menjawab soalan sama ada dalam bahasa Inggeris atau bahasa Malaysia.] In the event of any discrepancies, the English version shall be used. [Sekiranya terdapat sebarang percanggahan pada soalan peperiksaan, versi bahasa Inggeris hendaklah diguna pakai.]...2/-

2 What is bioinformatics as described by Luscombe, Greenbaum and Gerstien in their review paper What is bioinformatics? An Introduction and overview, Yearbook of Medical Informatics, What are other definitions of Bioinformatics and what are the main differences between these definitions? (c) Discuss the main sub-research areas in Bioinformatics and what are the type of data involved in the sub-research areas. 2. Compare the different data types in biological databases and name the main public databases that keep them. (8/100) The central dogma in molecular biology is an important concept and theory for many researchers in Bioinformatics. Discuss the concept and name the processes or functions involved in each of the stage of the central dogma. (7/100) 3. Sequence Alignment is the basic and important operation in Bioinformatics. Substitution matrix is an important substitution cost matrix when doing an alignment. Discuss different types of Substitution Matrices and explain their respective usage. Distinguish three (3) characteristics of BLAST, FASTA and Dynamic Programming Based sequence alignment algorithms. Compare them on the basis of: the main focus of one algorithm, how comparison operation is done, type of parameters involved in the alignment....3/-

3 Multiple Sequence Alignment (MSA) cannot be efficiently handled using pure dynamic programming. Choose two (2) existing MSA methods and compare them on the basis of parameters involved and the alignment process. Discuss the five (5) processes in the automatic proteins analysis pipeline. 5. The purpose of phylogeny is to reconstruct the history of life and explain the present diversity of living creatures. Phylogenetics is a special kind of phylogeny that relies on the comparison of equivalent genes coming from several species for reconstructing the genealogic tree of these species. Discuss the three (3) major reason of why you want to use Phylogenetics. What are the four (4) major ingredients to be consider when a distance based methods are used to compute a phylogenetic tree? 6 Perl is a popular programming language that is extensively used in areas such as Bioinformatics and web programming. Perl has become popular with biologists because it is so well-suited to several bioinformatics tasks. What are the special features of Perl that makes it a popular choice for bioinformatics applications? Write a Perl program to concatenate two DNA sequences. The output of the program is given below: Here are the original two DNA fragments: ACGGGAGGACGGGAAAATTACTACGGCATTAGC ATAGTGCCGTGAGAGTGATGTAGTA (version 1): (version 2): (version 3):...4/-

4 KERTAS SOALAN DALAM VERSI BAHASA MALAYSIA Apa itu bioinformatics seperti yang dihuraikan oleh Luscombe, Greenbaum dan Gerstien dalam kertas ulasan What is bioinformatics? An Introduction and overview, Yearbook of Medical Informatics, (c) Apakah definisi-definisi Bioinformatik dan apakah perbezaan antara definisidefinisi ini? Bincangkan sub-sub bidang penyelidikan dalam Bioinformatik dan apakah jenis data yang terlibat dalam setiap sub-bidang penyelidikan ini. 2. Bandingkan jenis-jenis data yang berbeza dalam pangkalan data biologi dan namakan pangkalan data umum yang utama yang menyimpan data-data ini. (8/100) Dogma pusat dalam biologi molekul adalah konsep dan teori penting bagi kebanyakan penyelidik dalam Bioinfomatik. Bincangkan konsep ini dan namakan proses-proses atau fungsi-fungsi yang terlibat pada setiap peringkat dogma pusat ini. (7/100) 3. Penjajaran Jujukan adalah operasi asas dan penting dalam Bioinformatik. Matrik penggantian merupakan satu matrik kos penggantian yang penting semasa proses penjajaran. Bincangkan jenis-jenis matrix penggantian yang berbeza dan terangkan penggunaan masing-masing. Bezakan tiga (3) sifat BLAST, FASTA dan algoritma penjajaran berasaskan pengaturcaraan dinamik. Bandingkan mereka berdasarkan kepada: fokus utama algoritma di atas, bagaimana perbandingan dilakukan oleh algoritma, jenis parameter yang terlibat dalam penjajaran....5/-

5 Penjajaran Jujukan Berbilang (MSA) tidak boleh dikendalikan secara cekap menggunakan pengaturcaraan dinamik. Pilih dua (2) kaedah MSA yang sedia ada dan bandingkan keduanya dari segi parameter yang terlibat dan proses penjajaran. Bincangkan lima (5) proses dalam talian paip analisis protein automatik. 5. Tujuan filogeni adalah untuk membina semula sejarah kehidupan dan menerangkan kepelbagaian makhluk yang hidup. Filogenetik adalah sejenis filogeni yang bergantung kepada perbandingan gen sama yang datang dari beberapa spesies untuk membina semula pepohon genealogik spesies ini. Bincangkan tiga (3) sebab utama kenapa anda menggunakan filogenetik. Apakah empat (4) bahan utama yang akan dipertimbangkan apabila kaedah berasaskan jarak digunakan untuk mengira pepohon filogenetik. 6 Perl adalah bahasa pengaturcaraan yang popular yang banyak digunakan dalam bidang seperti Bioinformatik dan pengaturcaraan web. Perl telah menjadi popular dalam kalangan ahli-ahli biologi kerana ia sesuai untuk beberapa tugas bioinformatik. Apakah ciri-ciri istimewa Perl yang menjadikan ia pilihan popular bagi aplikasi bioinformatik? Tulis program Perl untuk mencantum dua urutan DNA. Hasil program ini adalah seperti berikut: Here are the original two DNA fragments: ACGGGAGGACGGGAAAATTACTACGGCATTAGC ATAGTGCCGTGAGAGTGATGTAGTA (version 1): (version 2): (version 3): - ooooooo -

UNIVERSITI SAINS MALAYSIA. CCS511 Evolutionary Computing [Perkomputeran Berevolusi]

UNIVERSITI SAINS MALAYSIA. CCS511 Evolutionary Computing [Perkomputeran Berevolusi] UNIVERSITI SAINS MALAYSIA First Semester Examination 2015/2016 Academic Session December 2015/January 2016 CCS511 Evolutionary Computing [Perkomputeran Berevolusi] Duration : 2 hours [Masa : 2 jam] INSTRUCTIONS

More information

UNIVERSITI SAINS MALAYSIA. CCS513 Computer Vision and Image Analysis [Penglihatan Komputer dan Analisis Imej]

UNIVERSITI SAINS MALAYSIA. CCS513 Computer Vision and Image Analysis [Penglihatan Komputer dan Analisis Imej] UNIVERSITI SAINS MALAYSIA First Semester Examination 2016/2017 Academic Session December 2016 / January 2017 CCS513 Computer Vision and Image Analysis [Penglihatan Komputer dan Analisis Imej] Duration

More information

MAT 223 DIFFERENTIAL EQUATIONS I [Persamaan Pembezaan I]

MAT 223 DIFFERENTIAL EQUATIONS I [Persamaan Pembezaan I] UNIVERSITI SAINS MALAYSIA First Semester Examination 2015/2016 Academic Session December 2015/January2016 MAT 223 DIFFERENTIAL EQUATIONS I [Persamaan Pembezaan I] Duration : 3 hours [Masa : 3 jam] Please

More information

EME 411 Numerical Methods For Engineers [Kaedah Berangka Untuk Jurutera]

EME 411 Numerical Methods For Engineers [Kaedah Berangka Untuk Jurutera] -1- [EMH 451/3] UNIVERSITI SAINS MALAYSIA First Semester Examination 2014/2015Academic Session December 2014 / January 2015 EME 411 Numerical Methods For Engineers [Kaedah Berangka Untuk Jurutera] Duration

More information

UNIVERSITI SAINS MALAYSIA. CCS511 Evolutionary Computing [Perkomputeran Berevolusi]

UNIVERSITI SAINS MALAYSIA. CCS511 Evolutionary Computing [Perkomputeran Berevolusi] UNIVERSITI SAINS MALAYSIA First Semester Examination 2014/2015 Academic Session December 2014/January 2015 CCS511 Evolutionary Computing [Perkomputeran Berevolusi] Duration : 2 hours [Masa : 2 jam] INSTRUCTIONS

More information

MAT 202 Introduction to Analysis [ Pengantar Analisis]

MAT 202 Introduction to Analysis [ Pengantar Analisis] UNIVERSITI SAINS MALAYSIA Second Semester Examination 2016/2017 Academic Session June 2017 MAT 202 Introduction to Analysis [ Pengantar Analisis] Duration : 3 hours [Masa : 3 jam] Please check that this

More information

MAT Calculus [Kalkulus]

MAT Calculus [Kalkulus] UNIVERSITI SAINS MALAYSIA Second Semester Eamination 015/016 Academic Session June 016 MAT 101 - Calculus [Kalkulus] Duration : hours [Masa : jam] Please check that this eamination paper consists of EIGHT

More information

MAT 111 Linear Algebra [Aljabar Linear]

MAT 111 Linear Algebra [Aljabar Linear] UNIVERSITI SAINS MALAYSIA Second Semester Examination 0/0 Academic Session June 0 MAT Linear Algebra [Aljabar Linear] Duration : hours [Masa : jam] Please check that this examination paper consists of

More information

MAT 111 Linear Algebra [Aljabar Linear]

MAT 111 Linear Algebra [Aljabar Linear] UNIVERSITI SAINS MALAYSIA Second Semester Examination 00/0 Academic Session November 00 MAT Linear Algebra [Aljabar Linear] Duration : hours [Masa : jam] Please check that this examination paper consists

More information

MSS 317 Coding Theory [Teori Pengekodan]

MSS 317 Coding Theory [Teori Pengekodan] UNIVERSITI SAINS MALAYSIA First Semester Examination Academic Session 2015/2016 January 2016 MSS 31 Coding Theory [Teori Pengekodan] Duration : 3 hours [Masa : 3 jam] Please check that this examination

More information

MAT Linear Algebra [Aljabar Linear]

MAT Linear Algebra [Aljabar Linear] UNIVERSITI SAINS MALAYSIA Second Semester Examination 2014/2015 Academic Session June 2015 MAT 111 - Linear Algebra [Aljabar Linear] Duration : hours [Masa : jam] Please check that this examination paper

More information

CPT115 Mathematical Methods for Computer Sciences [Kaedah Matematik bagi Sains Komputer]

CPT115 Mathematical Methods for Computer Sciences [Kaedah Matematik bagi Sains Komputer] Second Semester Examination 6/7 Academic Session June 7 CPT Mathematical Methods for Computer Sciences [Kaedah Matematik bagi Sains Komputer] Duration : hours [Masa : jam] INSTRUCTIONS TO CANDIDATE: [ARAHAN

More information

MSG 356 Mathematical Programming [Pengaturcaraan Matematik]

MSG 356 Mathematical Programming [Pengaturcaraan Matematik] UNIVERSITI SAINS MALAYSIA Second Semester Examination 2011/2012 Academic Session June 2012 MSG 356 Mathematical Programming [Pengaturcaraan Matematik] Duration : 3 hours [Masa : 3 jam] Please check that

More information

IWK 302 Wood Engineering [Kejuruteraan Kayu]

IWK 302 Wood Engineering [Kejuruteraan Kayu] UNIVERSITI SAINS MALAYSIA Second Semester Examination Academic Session 2009/2010 April/May 2010 IWK 302 Wood Engineering [Kejuruteraan Kayu] Duration: 3 hours [Masa: 3 jam] Please check that this examination

More information

MAT 518 Numerical Methods for Differential Equations [Kaedah Berangka untuk Persamaan Pembezaan]

MAT 518 Numerical Methods for Differential Equations [Kaedah Berangka untuk Persamaan Pembezaan] UNIVERSII SAINS MALAYSIA First Semester Examination 0/03 Academic Session January 03 MA 58 Numerical Methods for Differential Equations [Kaedah Berangka untuk Persamaan Pembezaan] Duration : 3 hours [Masa

More information

MAT111 Linear Algebra [Aljabar Linear]

MAT111 Linear Algebra [Aljabar Linear] UNIVERSITI SAINS MALAYSIA Second Semester Examination 2016/2017 Academic Session June 2017 MAT111 Linear Algebra [Aljabar Linear] Duration : 3 hours [Masa : 3 jam] Please check that this examination paper

More information

MAT 222 Differential Equations II [Persamaan Pembezaan II]

MAT 222 Differential Equations II [Persamaan Pembezaan II] - 1 - UNIVERSITI SAINS MALAYSIA First Semester Examination 015/016 Academic Session December 015/January016 MAT Differential Equations II [Persamaan Pembezaan II] Duration : 3 hours [Masa : 3 jam] Please

More information

MST 565 Linear Model [Model Linear]

MST 565 Linear Model [Model Linear] UNIVERSITI SINS MLYSI Second Semester Examination 009/00 cademic Session pril/may 00 MST 565 Linear Model [Model Linear] Duration : 3 hours [Masa : 3 jam] Please check that this examination paper consists

More information


IWK 302 WOOD ENGINEERING [KEJURUTERAAN KAYU] UNIVERSITI SAINS MALAYSIA Second Semester Examination 2010/2011 Academic Session April/May 2011 IWK 302 WOOD ENGINEERING [KEJURUTERAAN KAYU] Duration: 3 hours Masa: [3 jam] Please check that this examination

More information


IUK 107 CHEMISTRY FOR TECHNOLOGIST [KIMIA UNTUK TEKNOLOGIS] UNIVERSITI SAINS MALAYSIA First Semester Examination 2010/2011 Academic Session November 2010 IUK 107 CHEMISTRY FOR TECHNOLOGIST [KIMIA UNTUK TEKNOLOGIS] Duration: 3 hours Masa: [3 jam] Please check that

More information

MAA 101 Calculus for Science Students I [Kalkulus untuk Pelajar Sains I]

MAA 101 Calculus for Science Students I [Kalkulus untuk Pelajar Sains I] UNIVERSITI SAINS MALAYSIA Peperiksaan Kursus Semasa Cuti Panjang Sidang Akademik 9/ Jun MAA Calculus for Science Students I [Kalkulus untuk Pelajar Sains I] Duration : 3 hours [Masa : 3 jam] Please check

More information

MSG 389 Engineering Computation II [Pengiraan Kejuruteraan II]

MSG 389 Engineering Computation II [Pengiraan Kejuruteraan II] UNIVERSITI SAINS MALAYSIA Second Semester Examination 2012/2013 Academic Session June 2013 MSG 389 Engineering Computation II [Pengiraan Kejuruteraan II] Duration : 3 hours [Masa : 3 jam] Please check

More information

UNIVERSITI SAINS MALAYSIA. CPT244 Artificial Intelligence [Kecerdasan Buatan]

UNIVERSITI SAINS MALAYSIA. CPT244 Artificial Intelligence [Kecerdasan Buatan] UNIVERSITI SAINS MALAYSIA Second Semester Examination 2015/2016 Academic Session June 2016 CPT244 Artificial Intelligence [Kecerdasan Buatan] Duration : 2 hours [Masa : 2 jam] INSTRUCTIONS TO CANDIDATE:

More information

IMK 308 Food Preservation Principles [Prinsip Pengawetan Makanan]

IMK 308 Food Preservation Principles [Prinsip Pengawetan Makanan] UNIVERSITI SAINS MALAYSIA Supplementary Semester Examination Academic Session 2008/2009 June 2009 IMK 308 Food Preservation Principles [Prinsip Pengawetan Makanan] Duration: 3 hours [Masa: 3 jam] Please

More information

MAT 101 Calculus [ Kalkulus] Duration : 3 hours [Masa : 3 jam]

MAT 101 Calculus [ Kalkulus] Duration : 3 hours [Masa : 3 jam] UNIVERSITI SAINS MALAYSIA Peperiksaan Semester Pertama Sidang Akademik 011/01 Januari 01 MAT 101 Calculus [ Kalkulus] Duration : 3 hours [Masa : 3 jam] Please check that this eamination paper consists

More information

MAT 101 Calculus [ Kalkulus]

MAT 101 Calculus [ Kalkulus] UNIVERSITI SAINS MALAYSIA Peperiksaan Kursus Semasa Cuti Panjang 01/013 Sidang Akademik Ogos 013 MAT 101 Calculus [ Kalkulus] Duration : 3 hours [Masa : 3 jam] Please check that this eamination paper consists

More information


EEM 423 KEJURUTERAAN KEBOLEHPERCAYAAN UNIVERSITI SAINS MALAYSIA Peperiksaan Semester Pertama Sidang Akademik 2010/2011 November 2010 EEM 423 KEJURUTERAAN KEBOLEHPERCAYAAN Masa : 3 jam ARAHAN KEPADA CALON: Sila pastikan bahawa kertas peperiksaan

More information


EEE 208 TEORI LITAR II UNIVERSITI SAINS MALAYSIA Peperiksaan Semester Pertama Sidang Akademik 2010/2011 November 2010 EEE 208 TEORI LITAR II Masa : 3 jam ARAHAN KEPADA CALON: Sila pastikan bahawa kertas peperiksaan ini mengandungi

More information

-1- UNIVERSITI SAINS MALAYSIA. Second Semester Examination Academic Session 2009/2010. April/May 2010

-1- UNIVERSITI SAINS MALAYSIA. Second Semester Examination Academic Session 2009/2010. April/May 2010 -1- UNIVERSITI SAINS MALAYSIA Second Semester Examination Academic Session 2009/2010 April/May 2010 ESA 382/3 Rekabentuk Subsistem Kapal Angkasa Spacecraft Subsystem Design Duration : 3 hours Masa : 3

More information

MSG 389 Engineering Computation II [Pengiraan Kejuruteraan II]

MSG 389 Engineering Computation II [Pengiraan Kejuruteraan II] UNIVERSITI SAINS MALAYSIA Second Semester Examination 2014/2015 Academic Session June 2015 MSG 389 Engineering Computation II [Pengiraan Kejuruteraan II] Duration : 3 hours [Masa : 3 jam] Please check

More information


UNIVERSITI SAINS MALAYSIA UNIVERSITI SAINS MALAYSIA First Semester Examination Academic Session 2010/2011 November 2010 EBS 201/3 - Mineral Deposits [Mendapan Mineral] Duration : 3 hours [Masa : 3 jam] Please ensure that this examination

More information

REG 363 Site Investigation (Kajian Tapak)

REG 363 Site Investigation (Kajian Tapak) UNIVERSITI SAINS MALAYSIA First Semester Examination 2013/2014 Academic Session December 2013 / January 2014 REG 363 Site Investigation (Kajian Tapak) Duration : 3 hours (Masa: 3 jam) Please check that

More information

MAA 111 Algebra for Science Students [Aljabar untuk Pelajar Sains]

MAA 111 Algebra for Science Students [Aljabar untuk Pelajar Sains] UNIVERSITI SAINS MALAYSIA Peperiksaan Kursus Semasa Cuti Panjang Sidang Akademik 9/ Jun MAA Algebra for Science Students [Aljabar untuk Pelajar Sains] Duration : hours [Masa : jam] Please check that this

More information

EMH 211 Thermodynamics [Termodinamik]

EMH 211 Thermodynamics [Termodinamik] - 1- [EMH 211] UNIVERSITI SAINS MALAYSIA First Semester Examination Academic Session 2016/2017 December 2016 / January 2017 EMH 211 Thermodynamics [Termodinamik] Duration : 3 hours Masa : 3 jam Please

More information


IWK 302 WOOD ENGINEERING [KEJURUTERAAN KAYU] UNIVERSITI SAINS MALAYSIA Supplementary Semester Examination Academic Session 2009/2010 June 2010 IWK 302 WOOD ENGINEERING [KEJURUTERAAN KAYU] Duration: 3 hours [Masa: 3 jam] Please check that the examination

More information

MSG 389 Engineering Computation II [Pengiraan Kejuruteraan II]

MSG 389 Engineering Computation II [Pengiraan Kejuruteraan II] UNIVERSITI SAINS MALAYSIA Second Semester Examination 2015/2016 Academic Session June 2016 MSG 389 Engineering Computation II [Pengiraan Kejuruteraan II] Duration : 3 hours [Masa : 3 jam] Please check

More information

UNIVERSITI SAINS MALAYSIA. CPT115 Mathematical Methods for Computer Science [Kaedah Matematik bagi Sains Komputer]

UNIVERSITI SAINS MALAYSIA. CPT115 Mathematical Methods for Computer Science [Kaedah Matematik bagi Sains Komputer] UNIVERSITI SAINS MALAYSIA Second Semester Examination 2014/2015 Academic Session June 2015 CPT115 Mathematical Methods for Computer Science [Kaedah Matematik bagi Sains Komputer] Duration : 2 hours [Masa:

More information

EMH 451 Numerical Methods For Engineers [Kaedah Berangka Untuk Jurutera]

EMH 451 Numerical Methods For Engineers [Kaedah Berangka Untuk Jurutera] -1- [EMH 451/3] UNIVERSITI SAINS MALAYSIA First Semester Examination 2013/2014 Academic Session December 2013 / January 2014 EMH 451 Numerical Methods For Engineers [Kaedah Berangka Untuk Jurutera] Duration

More information

MAA Calculus for Science Students I [Kalkulus untuk Pelajar Sains I]

MAA Calculus for Science Students I [Kalkulus untuk Pelajar Sains I] UNIVERSITI SAINS MALAYSIA First Semester Eamination Academic Session 6/7 December 6 / January 7 MAA - Calculus for Science Students I [Kalkulus untuk Pelajar Sains I] Duration : 3 hours [Masa : 3 jam]

More information

ESA 382/3 Spacecraft Subsystem Design Rekabentuk Subsistem Kapal Angkasa

ESA 382/3 Spacecraft Subsystem Design Rekabentuk Subsistem Kapal Angkasa -1- UNIVERSITI SAINS MALAYSIA Second Semester Examination Academic Session 2010/2011 April/May 2011 ESA 382/3 Spacecraft Subsystem Design Rekabentuk Subsistem Kapal Angkasa Duration : 3 hours Masa : 3

More information


UNIVERSITI SAINS MALAYSIA -1- [EUM 114/3] UNIVERSITI SAINS MALAYSIA Second Semester Examination 2015/2016 Academic Session June 2016 EUM 114/3 KALKULUS KEJURUTERAAN LANJUTAN [ADVANED ENGINEERING ALULUS] Duration : 3 hours [Masa

More information

EPP 322 Advanced Manufacturing Process [Proses Pembuatan Termaju]

EPP 322 Advanced Manufacturing Process [Proses Pembuatan Termaju] -1- [EPP322/3] UNIVERSITI SAINS MALAYSIA First Semester Examination 2013/2014 Academic Session December 2013 / January 2014 EPP 322 Advanced Manufacturing Process [Proses Pembuatan Termaju] Duration :

More information

EMH 211 Thermodynamics [Termodinamik]

EMH 211 Thermodynamics [Termodinamik] UNIVERSITI SAINS MALAYSIA First Semester Examination Academic Session 2015/2016 December 2015 / January 2016 EMH 211 Thermodynamics [Termodinamik] Duration : 3 hours Masa : 3 jam Please check that this

More information


UNIVERSITI SAINS MALAYSIA UNIVERSITI SAINS MALAYSIA First Semester Examination Academic Session 2011/2012 January 2012 EBS 201/3 Mineral Deposits [Mendapan Mineral] Duration : 3 hours [Masa : 3 jam] Please ensure that this examination

More information

EAA211 Engineering Mathematics for Civil Engineers [Matematik Kejuruteraan untuk Jurutera Awam]

EAA211 Engineering Mathematics for Civil Engineers [Matematik Kejuruteraan untuk Jurutera Awam] UNIVERSITI SAINS MALAYSIA KSCP Examination 2016/2017 Academic Session August 2017 EAA211 Engineering Mathematics for Civil Engineers [Matematik Kejuruteraan untuk Jurutera Awam] Duration : 2 hours [Masa

More information

BST 203/3 Population and Community Ecology [Ekologi Populasi dan Komuniti]

BST 203/3 Population and Community Ecology [Ekologi Populasi dan Komuniti] UNIVERSITI SAINS MALAYSIA Second Semester Examination Academic Session 2013/2014 June 2014 BST 203/3 Population and Community Ecology [Ekologi Populasi dan Komuniti] Duration: 3 hours [Masa: 3 jam] Please

More information


IEK 108 PROCESS FLUID MECHANICS [MEKANIK BENDALIR PROSES] UNIVERSITI SAINS MALAYSIA Supplementary Semester Examination Academic Session 2010/2011 June 2011 IEK 108 PROCESS FLUID MECHANICS [MEKANIK BENDALIR PROSES] Duration: 3 hours Masa: [3 jam] Please check

More information

MAT 263 Probability Theory [Teori Kebarangkalian]

MAT 263 Probability Theory [Teori Kebarangkalian] UNIVERSITI SAINS MALAYSIA Second Semester Examination 2016/2017 Academic Session June 2017 MAT 263 Probability Theory [Teori Kebarangkalian] Duration : 3 hours [Masa : 3 jam] Please check that this examination

More information


UNIVERSITI SAINS MALAYSIA EEM 352 REKABENTUK MEKATRONIK II UNIVERSITI SAINS MALAYSIA Peperiksaan Semester Pertama Sidang Akademik 2010/2011 November 2010 EEM 352 REKABENTUK MEKATRONIK II Masa : 2 Jam Sila pastikan bahawa kertas peperiksaan ini mengandungi TUJUH

More information

MGM 531 Euclidean Geometry [Geometri Euklidan]

MGM 531 Euclidean Geometry [Geometri Euklidan] UNIVERSITI SINS MLYSI First Semester Examination cademic Session 2015/2016 January 2016 MGM 531 Euclidean Geometry [Geometri Euklidan] Duration : 3 hours [Masa : 3 jam] Please check that this examination

More information


UNIVERSITI SAINS MALAYSIA UNIVERSITI SAINS MALAYSIA First Semester Examination Academic Session 2010/2011 November 2010 EBP 103/3 - Polymer Organic Chemistry [Kimia Organik Polimer] Duration : 3 hours [Masa : 3 jam] Please ensure

More information

CPT244 Artificial Intelligence [Kecerdasan Buatan]

CPT244 Artificial Intelligence [Kecerdasan Buatan] Second Semester Examination 2016/2017 Academic Session June 2017 CPT244 Artificial Intelligence [Kecerdasan Buatan] Duration : 2 hours [Masa : 2 jam] INSTRUCTIONS TO CANDIDATE: [ARAHAN KEPADA CALON:] Please

More information

EME 451/3 Computational Fluid Dynamics Pengkomputeran Dinamik Bendalir

EME 451/3 Computational Fluid Dynamics Pengkomputeran Dinamik Bendalir -1- UNIVERSITI SAINS MALAYSIA First Semester Examination Academic Session 2010/2011 November 2010 EME 451/3 Computational Fluid Dynamics Pengkomputeran Dinamik Bendalir Duration : 2 hours Masa : 2 jam

More information

MST 565 Linear Models [Model Linear]

MST 565 Linear Models [Model Linear] UNIVERSITI SAINS MALAYSIA Second Semester Eamination 05/06 Academic Session June 06 MST 565 Linear Models [Model Linear] Duration : hours [Masa : jam] Please check that this eamination paper consists of

More information

Jawab soalan mengikut arahan yang diberikan dalam setiap bahagian. Questions should be answered according to the instructions given in each section.


More information


IEK 108 PROCESS FLUID MECHANICS [MEKANIK BENDALIR PROSES] UNIVERSITI SAINS MALAYSIA Second Semester Examination 2009/2010 Academic Session April/May 2010 IEK 108 PROCESS FLUID MECHANICS [MEKANIK BENDALIR PROSES] Duration: 3 hours Masa: [3 jam] Please check that

More information

(Kertas soalan ini mengandungi 7 soalan dalam 8 halaman yang bercetak) (This question paper consists of 7 questions on 8 printed pages)

(Kertas soalan ini mengandungi 7 soalan dalam 8 halaman yang bercetak) (This question paper consists of 7 questions on 8 printed pages) UNIVERSITI MALAYA UNIVERSITY OF MALAYA PEPERIKSAAN IJAZAH SARJANA MUDA SAINS EXAMINATION FOR THE DEGREE OF BACHELOR OF SCIENCE SESI AKADEMIK 2016/2017 ACADEMIC SESSION 2016/2017 : SEMESTER I : SEMESTER

More information

ESA 380/3 Orbital Mechanics Mekanik Orbit

ESA 380/3 Orbital Mechanics Mekanik Orbit -1- UNIVERSITI SAINS MALAYSIA First Semester Examination Academic Session 2010/2011 November 2010 ESA 380/3 Orbital Mechanics Mekanik Orbit Duration : 3 hours Masa : 3 jam INSTRUCTIONS TO CANDIDATE: ARAHAN

More information

ESA 367/2 Flight Stability & Control I Kestabilan & Kawalan Penerbangan I

ESA 367/2 Flight Stability & Control I Kestabilan & Kawalan Penerbangan I -1- [ESA367] UNIVERSITI SAINS MALAYSIA Second Semester Examination 2010/2011 Academic Session April/May 2011 ESA 367/2 Flight Stability & Control I Kestabilan & Kawalan Penerbangan I Duration : 2 hours

More information

MGM 502 Number Theory [Teori Nombor]

MGM 502 Number Theory [Teori Nombor] UNIVERSITI SAINS MALAYSIA Second Semester Examination 009/010 Academic Session Aril/May 010 MGM 50 Number Theory [Teori Nombor] Duration : 3 hours [Masa : 3 jam] Please check that this examination aer

More information

EAS151 Statics and Dynamics [Statik dan Dinamik]

EAS151 Statics and Dynamics [Statik dan Dinamik] UNIVERSITI SAINS MALAYSIA KSCP Examination 2016/2017 Academic Session August 2017 EAS151 Statics and Dynamics [Statik dan Dinamik] Duration : 3 hours [Masa : 3 jam] Please check that this examination paper

More information


UNIVERSITI SAINS MALAYSIA UNIVERSITI SAINS MALAYSIA Second Semester Examination Academic Session 2010/2011 April/May 2011 EBB 212/4 Raw Materials & Structural Ceramics [Bahan Mentah & Seramik Struktur] Duration : 3 hours [Masa

More information


IMG 222- FOOD MICROBIOLOGY II [MIKROBIOLOGI MAKANAN II] UNIVERSITI SAINS MALAYSIA Second Semester Examination 2010/2011 Academic Session April/May 2011 IMG 222- FOOD MICROBIOLOGY II [MIKROBIOLOGI MAKANAN II] Duration: 3 hours [Masa: 3 jam] Please check that

More information


IEK PROCESS HEAT TRANSFER [PEMINDAHAN HABA PROSES] UNIVERSII SAINS MALAYSIA Supplementary Semester Exaation Academic Session 200/20 June 20 IEK 22 - PROESS HEA RANSFER [PEMINDAHAN HABA PROSES] Duration: 3 hours Masa: [3 jam] Please check that this exaation

More information

(This question paper consists of 12 questions on 6 printed pages) (Kertas soalan ini mengandungi 12 soalan dalam 6 halaman yang dicetak)

(This question paper consists of 12 questions on 6 printed pages) (Kertas soalan ini mengandungi 12 soalan dalam 6 halaman yang dicetak) UNIVERSITY OF MALAYA UNIVERSITI MALAYA EXAMINATION FOR THE DEGREE OF BACHELOR OF SCIENCE PEPERIKSAAN IJAZAH SARJANA MUDA SAINS ACADEMIC SESSION 2011/2012 : SEMESTER 2 SESI AKADEMIK 2011/2012 : SEMESTER

More information



More information

(Kertas ini mengandungi 6 soalan dalam 9 halaman yang dicetak) (This question paper consists of 6 questions on 9 printed pages)


More information


EEE REKABENTUK SISTEM KAWALAN UNIVERSITI SAINS MALAYSIA Peperiksaan Semester Pertama Sidang Akademik 2003/2004 September/Oktober 2003 EEE 453 - REKABENTUK SISTEM KAWALAN Masa: 3 Jam SUa pastikan kertas peperiksaan ini mengandungi SEBELAS

More information

MAT 100 Foundation Mathematics [Asas Matematik]

MAT 100 Foundation Mathematics [Asas Matematik] UNIVERSITI SAINS MALAYSIA First Semester Examination Academic Session 015/016 December 015/January 016 MAT 100 Foundation Mathematics [Asas Matematik] Duration : 3 hours [Masa : 3 jam] Please check that

More information

KOT 222 Organic Chemistry II [Kimia Organik II]

KOT 222 Organic Chemistry II [Kimia Organik II] UNIVERSITI SAINS MALAYSIA First Semester Examination 2009/2010 Academic Session November 2009 KT 222 rganic Chemistry II [Kimia rganik II] Duration : 3 hours [Masa : 3 jam] Please check that this examination

More information

(Kertas soalan ini mengandungi 6 soalan dalam 9 halaman yang dicetak) (This question paper consists of 6 questions on 9 printed pages)


More information

ESA 362/3 Kawalan Penerbangan Pesawat

ESA 362/3 Kawalan Penerbangan Pesawat -1- UNIVERSITI SAINS MALAYSIA Peperiksaan Semester Kedua Sidang Akademik 2005/2006 Second Semester Examination 2005/2006 Academic Session April/Mei 2006 April/May 2006 ESA 362/3 Kawalan Penerbangan Pesawat

More information


IEK 212 PROCESS HEAT TRANSFER [PEMINDAHAN HABA PROSES] UNIVERSITI SAINS MALAYSIA Supplementary Semester Examination Academic Session 2009/2010 June 2010 IEK 212 PROCESS HEAT TRANSFER [PEMINDAHAN HABA PROSES] Duration: 3 hours [Masa: 3 jam] Please check that

More information


UNIVERSITI SAINS MALAYSIA UNIVERSITI SAINS MALAYSIA First Semester Examination Academic Session 2010/2011 November 2010 EBB 202/3 - Crystallography & Bonding In Solids [Kristalografi & Ikatan Dalam Pepejal] Duration : 3 hours [Masa

More information

(Kertas ini mengandungi 5 soalan dalam 5 halaman yang dicetak) (This paper consists of 5 questions in 5 printed pages)


More information

(Kertas soalan ini mengandungi 6 soalan dalam 7 halaman yang dicetak) (This question paper consists of 6 questions on 7 printed pages)

(Kertas soalan ini mengandungi 6 soalan dalam 7 halaman yang dicetak) (This question paper consists of 6 questions on 7 printed pages) UNIVERSITI MALAYA UNIVERSITY OF MALAYA PEPERIKSAAN IJAZAH SARJANA MUDA SAINS EXAMINATION FOR THE DEGREE OF BACHELOR OF SCIENCE SESI AKADEMIK 2014/2015 : SEMESTER 1 ACADEMIC SESSION 2014/2015 : SEMESTER

More information

ESA 380/3 Orbital Mechanics [Mekanik Orbit]

ESA 380/3 Orbital Mechanics [Mekanik Orbit] -1- UNIVERSITI SAINS MALAYSIA First Semester Examination 2011/2012 Academic Session January 2012 ESA 380/3 Orbital Mechanics [Mekanik Orbit] Duration : 3 hours [Masa : 3 jam] Please check that this paper

More information

UNIVERSITI SAINS MALAYSIA. CPT443 Automata Theory & Formal Languages [Teori Automata & Bahasa Formal]

UNIVERSITI SAINS MALAYSIA. CPT443 Automata Theory & Formal Languages [Teori Automata & Bahasa Formal] UNIVERSITI SAINS MALAYSIA Second Semester Examination 2015/2016 Academic Session June 2016 CPT443 Automata Theory & Formal Languages [Teori Automata & Bahasa Formal] Duration : 3 hours [Masa : 3 jam] INSTRUCTIONS

More information

UNIVERSITI SAINS MALAYSIA. CPT112 Discrete Structures [Struktur Diskret]

UNIVERSITI SAINS MALAYSIA. CPT112 Discrete Structures [Struktur Diskret] UNIVERSITI SAINS MALAYSIA Second Semester Examination 201/2015 Academic Session June 2015 CPT112 Discrete Structures [Struktur Diskret] Duration : 3 hours [Masa : 3 jam] INSTRUCTIONS TO CANDIDATE: [ARAHAN

More information

(Kertas soalan ini mengandungi 10 soalan dalam 5 halaman yang dicetak) (This question paper consists of 10 questions on 5 printed pages)

(Kertas soalan ini mengandungi 10 soalan dalam 5 halaman yang dicetak) (This question paper consists of 10 questions on 5 printed pages) UNIVERSITI MALAYA UNIVERSITY OF MALAYA PEPERIKSAAN IJAZAH SARJANA MUDA SAINS EXAMINATION FOR THE DEGREE OF BACHELOR OF SCIENCE SESI AKADEMIK 2016/2017 : SEMESTER 1 ACADEMIC SESSION 2016/2017 : SEMESTER

More information

(Kertas soalan ini mengandungi 3 soalan dalam 11 halaman yang bercetak) (This question paper consists of 3 questions on 11 printed pages)


More information

UNIVERSITI SAINS MALAYSIA. Peperiksaan Semester Pertama Sidang Akademik 2004/2005. Oktober CPT102 - Struktur Diskret

UNIVERSITI SAINS MALAYSIA. Peperiksaan Semester Pertama Sidang Akademik 2004/2005. Oktober CPT102 - Struktur Diskret UNIVERSITI SAINS MALAYSIA Peperiksaan Semester Pertama Sidang Akademik 2004/2005 Oktober 2004 CPT102 - Struktur Diskret Masa : 3 jam ARAHAN KEPADA CALON : Sila pastikan bahawa kertas peperiksaan ini mengandungi

More information

MST 562 Stochastic Processes [Proses Stokastik]

MST 562 Stochastic Processes [Proses Stokastik] UNIVERSITI SAINS MALAYSIA First Semester Examination 2010/2011 Academic Session November 2010 MST 562 Stochastic Processes [Proses Stokastik] Duration : 3 hours [Masa : 3 jam] Please check that this examination

More information

KOT 222 Organic Chemistry II [Kimia Organik II]

KOT 222 Organic Chemistry II [Kimia Organik II] UNIVERSITI SAINS MALAYSIA First Semester Examination 2010/2011 Academic Session November 2010 KT 222 rganic Chemistry II [Kimia rganik II] Duration : 3 hours [Masa : 3 jam] Please check that this examination

More information

KOT 222 Organic Chemistry II [Kimia Organik II]

KOT 222 Organic Chemistry II [Kimia Organik II] UNIVERSITI SAINS MALAYSIA Peperiksaan Kursus Semasa Cuti Panjang Sidang Akademik 2008/2009 June 2009 KOT 222 Organic Chemistry II [Kimia Organik II] Duration : 3 hours [Masa : 3 jam] Please check that

More information

Explain the differences between Geographical Information System (GIS) and other information system as the following:

Explain the differences between Geographical Information System (GIS) and other information system as the following: SECTION A : 50 MARKS BAHAGIAN A : 50 MARKAH INSTRUCTION: This section consists of TWO (2) structured questions. Answer ALL questions. ARAHAN: Bahagian ini mengandungi DUA (2) soalan struktur. Jawab SEMUA

More information

EAS 254E/3 Structural Analysis (Analisis Struktur)

EAS 254E/3 Structural Analysis (Analisis Struktur) UNIVERSITI SAINS MAAYSIA nd. Semester Examination /3 Academic Session Peperiksaan Semester Kedua Sidang Akademik /3 February / March 3 EAS 54E/3 Structural Analysis (Analisis Struktur) Time : 3 hours Masa

More information

EAH 221/3 Fluid Mechanics For Civil Engineers [Mekanik Bendalir Untuk Jurutera Awam]

EAH 221/3 Fluid Mechanics For Civil Engineers [Mekanik Bendalir Untuk Jurutera Awam] UNIVERSITI SAINS MALAYSIA First Semester Examination Academic Session 2009/2010 November 2009 EAH 221/3 Fluid Mechanics For Civil Engineers [Mekanik Bendalir Untuk Jurutera Awam] Duration : 3 hours [Masa

More information

(Kertas soalan ini mengandungi 7 soalan dalam 7 halaman yang bercetak) (This question paper consists of 7 questions on 7 printed pages)

(Kertas soalan ini mengandungi 7 soalan dalam 7 halaman yang bercetak) (This question paper consists of 7 questions on 7 printed pages) UNIVERSITI MALAYA UNIVERSITY F MALAYA PEPERIKSAAN IJAZAH SARJANA MUDA SAINS EXAMINATIN FR THE DEGREE F BACHELR F SCIENCE SESI AKADEMIK 2016/2017 ACADEMIC SESSIN 2016/2017 : SEMESTER I : SEMESTER I SCES3336

More information

MAT Calculus [Kalkulus]

MAT Calculus [Kalkulus] UNIVERSITI SAINS MALAYSIA Firs Semeser Eaminaion 3/ Academic Session Jan MAT - Calculus [Kalkulus] Duraion : 3 hours [Masa : 3 jam] Please check ha his eaminaion paper consiss of SEVEN pages of prined

More information


EEU 104 TEKNOLOGI ELEKTRIK UNIVERSITI SAINS MALAYSIA Peperiksaan Semester Kedua Sidang Akademik 2009/2010 April 2010 EEU 104 TEKNOLOGI ELEKTRIK Masa : 3 jam ARAHAN KEPADA CALON: Sila pastikan bahawa kertas peperiksaan ini mengandungi

More information



More information

MSG Engineering Computation II [Pengiraan Kejuruteraan II]

MSG Engineering Computation II [Pengiraan Kejuruteraan II] UNIVERSITI SAINS MALAYSIA Second Semester Examination 013/014 Academic Session June 014 MSG 389 - Engineering Computation II [Pengiraan Kejuruteraan II] Duration : 3 ours [Masa : 3 jam] Please ceck tat

More information

Kertas ini dibahagikan kepada Bahagian A dan Bahagian B. This paper is divided into Section A and Section B.


More information

(Kertas ini mengandungi 6 soalan dalam 5 halaman yang dicetak) (This question paper consists of 6 questions on 5 printed pages)

(Kertas ini mengandungi 6 soalan dalam 5 halaman yang dicetak) (This question paper consists of 6 questions on 5 printed pages) UNIVERSITI MALAYA UNIVERSITY OF MALAYA PEPERIKSAAN IJAZAH SARJANA MUDA SAINS EXAMINATION FOR THE DEGREE OF BACHELOR OF SCIENCE SESI AKADEMIK 2014/2015 : SEMESTER 2 ACADEMIC SESSION 2014/2015 : SEMESTER

More information



More information

ZCT 104E/3 - Fizik IV (Fizik Moden)

ZCT 104E/3 - Fizik IV (Fizik Moden) UNIVERSITI SAINS MALAYSIA Peperiksaan Semester Kedua Sidang Akademik 2002/2003 Februari - Mac 2003 ZCT 104E/3 - Fizik IV (Fizik Moden) Masa : 3 jam Sila pastikan bahawa kertas peperiksaan ini mengandungi

More information

EAK 263/4 Geomatic Engineering [Kejuruteraan Geomatik]

EAK 263/4 Geomatic Engineering [Kejuruteraan Geomatik] UNIVERSITI SAINS MALAYSIA First Semester Examination Academic Session 2009/2010 November 2009 EAK 263/4 Geomatic Engineering [Kejuruteraan Geomatik] Duration : 3 hours [Masa : 3 jam] Please check that

More information

Jawab soalan mengikut arahan yang diberikan dalam setiap bahagian. Answer the questions according to the instructions given in each section.


More information

EMM 213 Strength of Materials [Kekuatan Bahan]

EMM 213 Strength of Materials [Kekuatan Bahan] -1- UNIVERSITI SAINS MALAYSIA First Semester Examination 2013/2014 Academic Session December 2013 / January 2014 EMM 213 Strength of Materials [Kekuatan Bahan] Duration : 3 hours Masa : 3 jam INSTRUCTIONS

More information